ID: 1193780124 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:85691165-85691187 |
Sequence | TAACACCAACAAATATTGGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1193780119_1193780124 | 30 | Left | 1193780119 | X:85691112-85691134 | CCTCCATGCTTGTGTTCAGTCTG | No data | ||
Right | 1193780124 | X:85691165-85691187 | TAACACCAACAAATATTGGTGGG | No data | ||||
1193780120_1193780124 | 27 | Left | 1193780120 | X:85691115-85691137 | CCATGCTTGTGTTCAGTCTGAAG | No data | ||
Right | 1193780124 | X:85691165-85691187 | TAACACCAACAAATATTGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1193780124 | Original CRISPR | TAACACCAACAAATATTGGT GGG | Intergenic | ||
No off target data available for this crispr |