ID: 1193787812

View in Genome Browser
Species Human (GRCh38)
Location X:85781882-85781904
Sequence TTTATCCAGTCCATAATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193787812_1193787816 26 Left 1193787812 X:85781882-85781904 CCATTAATTATGGACTGGATAAA No data
Right 1193787816 X:85781931-85781953 CATACTATGCACTCATAAAAAGG No data
1193787812_1193787814 3 Left 1193787812 X:85781882-85781904 CCATTAATTATGGACTGGATAAA No data
Right 1193787814 X:85781908-85781930 AATGTGGTACATATACACCATGG 0: 3058
1: 26518
2: 15879
3: 9004
4: 6202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193787812 Original CRISPR TTTATCCAGTCCATAATTAA TGG (reversed) Intergenic
No off target data available for this crispr