ID: 1193788192

View in Genome Browser
Species Human (GRCh38)
Location X:85786063-85786085
Sequence AAAGATTCGTGCACCCACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193788191_1193788192 -10 Left 1193788191 X:85786050-85786072 CCATAACTATTCTAAAGATTCGT No data
Right 1193788192 X:85786063-85786085 AAAGATTCGTGCACCCACATTGG No data
1193788190_1193788192 1 Left 1193788190 X:85786039-85786061 CCAACAAGAAGCCATAACTATTC No data
Right 1193788192 X:85786063-85786085 AAAGATTCGTGCACCCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193788192 Original CRISPR AAAGATTCGTGCACCCACAT TGG Intergenic
No off target data available for this crispr