ID: 1193791187

View in Genome Browser
Species Human (GRCh38)
Location X:85816748-85816770
Sequence CCCAAACAGAAGTGCAGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193791187_1193791193 25 Left 1193791187 X:85816748-85816770 CCTTACCTGCACTTCTGTTTGGG No data
Right 1193791193 X:85816796-85816818 ATTGAAATAGCTTACTAACCAGG No data
1193791187_1193791190 -4 Left 1193791187 X:85816748-85816770 CCTTACCTGCACTTCTGTTTGGG No data
Right 1193791190 X:85816767-85816789 TGGGTTCTAGACTCCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193791187 Original CRISPR CCCAAACAGAAGTGCAGGTA AGG (reversed) Intergenic
No off target data available for this crispr