ID: 1193795840

View in Genome Browser
Species Human (GRCh38)
Location X:85871937-85871959
Sequence ATGCAGATCTTCAGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193795840 Original CRISPR ATGCAGATCTTCAGCCATCT TGG Intronic
902502879 1:16922351-16922373 AGCCAGATCCTCATCCATCTAGG + Intronic
903116280 1:21181128-21181150 ATTCAGAGCTGCAGCCACCTTGG + Intergenic
903217702 1:21852336-21852358 ATCCAGCTTTTCAGGCATCTGGG + Intronic
904137997 1:28328942-28328964 ATGAAGCTCTTCGGCCTTCTCGG + Intergenic
905342615 1:37289705-37289727 AGGCTCTTCTTCAGCCATCTGGG - Intergenic
905743117 1:40389503-40389525 TCACAGATCTTCAGCTATCTGGG - Intronic
908186727 1:61659438-61659460 CTGCTTATCTTCAGCCTTCTTGG - Intergenic
913330672 1:117664605-117664627 ATGCAGATAATTAGTCATCTTGG + Intergenic
918217324 1:182403540-182403562 ATACAGATCTTTCGCCTTCTTGG - Intergenic
919021234 1:192108417-192108439 AAGCAGATTTTTAGCCATTTAGG - Intergenic
920732097 1:208496973-208496995 AGGCAGATCTCCAGGCATTTGGG - Intergenic
921589832 1:216990531-216990553 ATGCGGATTTTCTCCCATCTTGG + Intronic
1064155172 10:12897896-12897918 GTGCTGATTTTCAGGCATCTTGG + Exonic
1067995871 10:51272662-51272684 CTGCAGATGTTCACCCAGCTGGG - Intronic
1068170325 10:53384488-53384510 ATGCAGGTCATAAACCATCTTGG + Intergenic
1071986231 10:91053649-91053671 ATGCTGAATTTCAGCCATGTTGG - Intergenic
1072160969 10:92766156-92766178 ATGCAAATCTTAAGACCTCTTGG + Intergenic
1073034350 10:100552910-100552932 CTGCTTGTCTTCAGCCATCTTGG + Exonic
1074284856 10:112088525-112088547 ATGCAGCTCCACAGCCTTCTAGG + Intergenic
1075943331 10:126409942-126409964 ATGCAGGTCTGCAGACAGCTTGG - Intergenic
1080389552 11:31832216-31832238 ATGTAGTTTTCCAGCCATCTAGG + Intronic
1082155498 11:48804575-48804597 TTGCAACTATTCAGCCATCTTGG + Intergenic
1084081994 11:66833493-66833515 ATCCACATCTTCAGCTTTCTAGG + Intronic
1084573260 11:69972789-69972811 AGGTAGATCTGCAGGCATCTGGG - Intergenic
1086147202 11:83565241-83565263 ATGCAGATATCCACCCTTCTGGG - Intronic
1086597440 11:88590419-88590441 ATTCAAATCTTCAGACCTCTGGG - Intronic
1087579298 11:100031408-100031430 AAGCAGATGTTCATACATCTGGG + Intronic
1089609952 11:119663577-119663599 TTGCAGAGCTTCTGCCATGTGGG + Exonic
1089941937 11:122427862-122427884 ATACAAATCTTCAGCTATTTTGG - Intergenic
1090311508 11:125745327-125745349 ATGCAGGTCTACAGCCAAGTGGG - Intergenic
1090938319 11:131365266-131365288 AGGGAGAGCTGCAGCCATCTTGG - Intergenic
1095844987 12:46734909-46734931 AGGCAGATCTTCAGGCATTCAGG + Intergenic
1096933655 12:55243413-55243435 ATGTAGATCTACAGCCAGCAGGG - Intergenic
1097595339 12:61621555-61621577 AGGCAGATTTTCAGCCTCCTTGG - Intergenic
1100279052 12:93100802-93100824 AAACAGATTTGCAGCCATCTCGG - Intergenic
1100403243 12:94250464-94250486 ATGGAGAGCTTCAGCTATCCGGG + Intronic
1103732271 12:123035750-123035772 TGGCAAAGCTTCAGCCATCTGGG - Intronic
1106322103 13:28650350-28650372 AAGCAGAGCTGCAGCCAGCTTGG + Intergenic
1109095400 13:58107720-58107742 AGGCAGATCTCCAGGCATCTTGG - Intergenic
1110055657 13:70967465-70967487 ATGCAGATCTGCAACCACCTAGG - Intergenic
1111602398 13:90491637-90491659 ATGTATATCTTTAGCCATTTTGG - Intergenic
1117773919 14:59163121-59163143 GTGCAGCACTTCAGACATCTAGG - Intergenic
1118400133 14:65372230-65372252 ATGGAGATCCTCATCCACCTTGG + Intergenic
1118819736 14:69337528-69337550 ATGCAGATCTTCGGCCCCCCAGG + Intronic
1123179399 14:106454175-106454197 ATGCACATCTTCTGAAATCTAGG + Intergenic
1123580539 15:21711483-21711505 ATGCAGATACACAGCCAACTGGG + Intergenic
1123617187 15:22154106-22154128 ATGCAGATACACAGCCAACTGGG + Intergenic
1123797115 15:23783203-23783225 ATGCAGATACTCCGCCATCAGGG - Intergenic
1127430212 15:58899032-58899054 ATCTAGATCTTCAGGCATCTTGG - Intronic
1129772110 15:78208897-78208919 ATCCAGCTGCTCAGCCATCTAGG - Intronic
1202989409 15_KI270727v1_random:445728-445750 ATGCAGATACACAGCCAACTGGG + Intergenic
1137013319 16:35345345-35345367 ATGCAGATCTTTAACATTCTTGG - Intergenic
1138712682 16:58986863-58986885 ATGTACATCTTCAGAGATCTGGG + Intergenic
1138718650 16:59053164-59053186 AAACAGTTCATCAGCCATCTAGG - Intergenic
1139342650 16:66278482-66278504 AGGCAGATTTCCAGGCATCTGGG + Intergenic
1139366395 16:66436219-66436241 ATTCAGATCTTCAGCAACATGGG + Intronic
1142275005 16:89113786-89113808 CCGCAGAACTGCAGCCATCTTGG - Intronic
1142907902 17:3058851-3058873 ATAAAAGTCTTCAGCCATCTAGG - Intergenic
1142926661 17:3245415-3245437 ATAAAAGTCTTCAGCCATCTAGG + Intergenic
1144484857 17:15656082-15656104 AGGCTCATCTTCAGCCCTCTGGG + Intronic
1146554466 17:33811883-33811905 ATGCAGAACTTCTCCCAGCTTGG + Intronic
1147848750 17:43424832-43424854 CTGCAGATCTTCATTCATCTCGG + Intergenic
1149229722 17:54519035-54519057 ATGCAGCTCTTCAGCCGCCCAGG + Intergenic
1151141043 17:71992656-71992678 CTGCATCTATTCAGCCATCTTGG - Intergenic
1151520516 17:74625890-74625912 AAACAAATCTTCAGCCTTCTTGG + Intergenic
1153020823 18:627389-627411 AAGCAGATCTTGAGCAATGTTGG + Exonic
1155200652 18:23514755-23514777 TTGAAGATCTGAAGCCATCTAGG - Intronic
1155656904 18:28203329-28203351 ACGCAGACCATCATCCATCTTGG + Intergenic
1159829127 18:73251260-73251282 ATGCTTATTTTCTGCCATCTTGG - Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1165224633 19:34345981-34346003 ATGCAGATCTTATGCCCTCGGGG - Intronic
1166338665 19:42123841-42123863 ATGAAGGACTTGAGCCATCTGGG - Intronic
926956981 2:18312394-18312416 TAGCAGATCTTCAGCTATGTTGG - Intronic
930405598 2:50951742-50951764 ATGCAGATGTTCAGGCATGAGGG - Intronic
930929488 2:56862859-56862881 CTGCAGCTAGTCAGCCATCTTGG + Intergenic
930948529 2:57107508-57107530 ATCCAGATATGCAGACATCTGGG + Intergenic
933210473 2:79561773-79561795 ATTCAGATCTTTGCCCATCTTGG + Intronic
933797929 2:85936391-85936413 ATGAAAATCATCAGCCATGTAGG + Intergenic
933850306 2:86361362-86361384 ATGAAGATTTTCAGCCCTTTTGG - Intergenic
939993457 2:148898173-148898195 ATGGAGACCTTCAGGCACCTAGG + Intronic
940133895 2:150414346-150414368 AGGCTGATTGTCAGCCATCTGGG - Intergenic
941532332 2:166685839-166685861 CTGTAGACCATCAGCCATCTTGG - Intergenic
943529813 2:189065168-189065190 ATGCATATCTATAGCCATGTTGG - Intronic
945009727 2:205448158-205448180 ATTCACACCTTCAGCCCTCTTGG + Intronic
948579016 2:238971571-238971593 ATGCAGATCTTCCCACAGCTGGG + Intergenic
1169699460 20:8430231-8430253 ATGTAGATGTTCTTCCATCTTGG - Intronic
1173433212 20:43009881-43009903 ATGCAGCTCTGCAGCCAGCTGGG - Intronic
1173657332 20:44709428-44709450 GTGGAGTTCTGCAGCCATCTTGG - Intergenic
1175391062 20:58627832-58627854 ATCCACTTCTTCAGCCATGTGGG - Intergenic
1179335706 21:40450995-40451017 ATACAGATTTTCATCCATCCTGG - Intronic
1180039300 21:45267888-45267910 ATGCAGATCTTCATGGATCTGGG + Intronic
1180091674 21:45536739-45536761 ATGCCGAGCGTCAGCCATGTGGG + Intronic
1181431831 22:22886378-22886400 GTTCAGATCTGCAGCCCTCTAGG - Intronic
1184158579 22:42684809-42684831 ATGAAGATCTTCAGGGGTCTTGG - Intergenic
949654722 3:6204878-6204900 CTGCTGATCTTCAGCCATCTGGG + Intergenic
950504915 3:13388690-13388712 ATGCAGATTCCCAGGCATCTTGG - Intronic
950520269 3:13493960-13493982 AGGCAGATCTTCTGACATCTGGG + Intronic
953733727 3:45472939-45472961 AAGCAGATCCCCAGGCATCTGGG - Intronic
954624217 3:52013711-52013733 ATCCAGAGCTTCAGCCCTTTGGG - Intergenic
956375971 3:68613936-68613958 ATGTAGATATTCAGCCTTCAAGG + Intergenic
959280472 3:104331581-104331603 ATGCATATTTGTAGCCATCTGGG - Intergenic
959606106 3:108243217-108243239 ATGAAGGGCTTCAGCCATGTGGG + Intergenic
966065780 3:175819793-175819815 AAGCAGATGTGCTGCCATCTAGG + Intergenic
966360467 3:179123545-179123567 ATGCCTATAGTCAGCCATCTTGG - Intergenic
966651603 3:182306947-182306969 ATGCATATCCTTATCCATCTGGG - Intergenic
969393383 4:6905780-6905802 TTGCTGATCTGCAGCCATCTGGG + Intergenic
970385342 4:15550411-15550433 GTGCAGATAATAAGCCATCTGGG + Intronic
972997659 4:44902078-44902100 ATGCAGCTCTCCAGCTATCTTGG + Intergenic
975501507 4:75090847-75090869 AGGCAGATGTGCTGCCATCTAGG - Intergenic
976431783 4:84970566-84970588 ATGTAGATTTTCTGCCACCTTGG + Intergenic
977359672 4:95986146-95986168 CTGAAGAGCTGCAGCCATCTGGG - Intergenic
978173330 4:105700787-105700809 ATGTATATCTTTATCCATCTTGG - Intronic
980141244 4:128920315-128920337 ATGCAGATCCTCTGTCATCTGGG + Intronic
982043577 4:151419371-151419393 CTGCAGATCTTGAGACTTCTTGG + Intronic
986343317 5:6811325-6811347 AAGCACATCATCAGCCAACTAGG - Intergenic
986840249 5:11688198-11688220 ATGAAGCTCTTGAGCCAGCTTGG - Intronic
991954347 5:71977655-71977677 ATGCACATCTTTATCCATCATGG + Intergenic
992087931 5:73294697-73294719 AAGCAGCTCTTCTGCCATGTGGG - Intergenic
992688818 5:79223492-79223514 ATGCAGCCCTTCAGACACCTTGG + Intronic
996279256 5:121708207-121708229 AGGCAGATCTGCAGCAATCTGGG + Intergenic
996792552 5:127308120-127308142 ATGCAGATCTCAAGCCCTCCTGG - Intronic
998992310 5:147831571-147831593 ACGCAGAACTTCAGCCATGAAGG - Exonic
1002439388 5:179256464-179256486 ATCCACATCTTCATCCATGTAGG - Intronic
1004599386 6:17132956-17132978 AGGCAGATCTTCAGGCATCTGGG + Intergenic
1004834260 6:19513457-19513479 ATGCAGATTTTCAACTATGTGGG + Intergenic
1005176964 6:23058386-23058408 CTGCTCATATTCAGCCATCTTGG - Intergenic
1006226360 6:32540024-32540046 ATGCAAATCAGCAGCCATCAGGG - Intergenic
1006572365 6:35016191-35016213 AGCCAGATCTTCAGGCTTCTAGG + Intronic
1008620069 6:53263071-53263093 CTGCAGAGCTCCAGCCCTCTAGG - Intergenic
1009971414 6:70628939-70628961 ATGCATACATTCAGCCATCTAGG + Intergenic
1016077835 6:139818733-139818755 AGGCAGATCTGCAATCATCTGGG + Intergenic
1016663866 6:146611762-146611784 ATGCATCTAGTCAGCCATCTTGG + Intronic
1016912841 6:149215855-149215877 ATACAGTCCTTCAGCCATCCCGG - Intergenic
1017854156 6:158334560-158334582 ATGCAGATCTTCAACTGTGTGGG + Intronic
1019745105 7:2695408-2695430 ATGCAGATTTTCAAGCATCATGG - Intronic
1021368612 7:19813083-19813105 AACCAGAACATCAGCCATCTTGG + Intergenic
1023332658 7:39135151-39135173 ATCCAGATTTTCAGATATCTTGG - Intronic
1023525919 7:41102872-41102894 ATTCAGATGTTGAGCCTTCTGGG - Intergenic
1028277125 7:88870638-88870660 ATGCAGATTTTTAGCTGTCTGGG + Intronic
1029822487 7:103159298-103159320 ATGGAGGTCTTTAACCATCTTGG + Intergenic
1034818820 7:154198072-154198094 TTGCACATCTACAGCCATCTGGG - Intronic
1037024348 8:14014638-14014660 TTGGACATTTTCAGCCATCTGGG - Intergenic
1039254519 8:35704672-35704694 ATGCAGATCTTCTAGAATCTTGG + Intronic
1039721556 8:40169713-40169735 ATGCAGATCCTCAGGCCTCAGGG - Intergenic
1043198091 8:77326098-77326120 ATGAAAATCTTCAGCAAACTAGG - Intergenic
1043491641 8:80755088-80755110 ATGCAAATCTTAAGCCATGGTGG - Intronic
1044172500 8:89072207-89072229 ATGCAGATCTCCAGGCACCAGGG - Intergenic
1044311097 8:90693676-90693698 ATGCAAATCTTAAACCATCAGGG - Intronic
1044706020 8:95009491-95009513 ATTTAGATCCTCAGCCATCTGGG + Intronic
1045435720 8:102161888-102161910 ATGGAGATATTGAGCCATCATGG - Intergenic
1048044433 8:130759722-130759744 AAGCAGATTTTTAGCCATTTAGG - Intergenic
1048961784 8:139585670-139585692 ATGCAGATTTTCAGTGATCACGG - Intergenic
1052210980 9:25902918-25902940 ATGCAGCTGCTCAGCAATCTAGG - Intergenic
1053135703 9:35649260-35649282 TTGCAAGTCTTCAGCCTTCTAGG + Intergenic
1059835114 9:118143006-118143028 AGCCAGATATTCAGCCATATGGG + Intergenic
1187372792 X:18724748-18724770 ACGCAGATCTTCAACTCTCTGGG + Intronic
1187479192 X:19639548-19639570 ATGCAGATCTTAAGCCACACGGG + Intronic
1188219859 X:27527634-27527656 CTGGAGCTATTCAGCCATCTTGG + Intergenic
1191863006 X:65681270-65681292 ATGCAGAATTGCAGCCATCTGGG + Intronic
1192007586 X:67234107-67234129 ATGTTCATTTTCAGCCATCTTGG - Intergenic
1192823579 X:74670020-74670042 CTGCAGAAAGTCAGCCATCTGGG - Intergenic
1193795840 X:85871937-85871959 ATGCAGATCTTCAGCCATCTTGG + Intronic
1196190998 X:112794307-112794329 ATGCCTATCTTTAGCCAACTCGG - Intronic
1196281706 X:113830030-113830052 ATGAAGATCTTTAGCATTCTTGG - Intergenic
1197623603 X:128779519-128779541 AAGCACATCTTTAGCTATCTTGG + Intergenic
1199995645 X:153024043-153024065 TTGCAGGTCTTCTGCCCTCTGGG + Intergenic
1200392886 X:155962138-155962160 ATGTAGATACTCAGCCATCAAGG - Intergenic