ID: 1193795891

View in Genome Browser
Species Human (GRCh38)
Location X:85872653-85872675
Sequence TTCTTGGTAAACAGTCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193795891 Original CRISPR TTCTTGGTAAACAGTCAAGA AGG (reversed) Intronic
905624703 1:39480956-39480978 TGGTTGGTAAACAGTAAAGCTGG + Intronic
905762114 1:40567993-40568015 GTATTGGGAAACATTCAAGATGG - Intergenic
908069585 1:60443670-60443692 TATTTGGTAAAAAGTAAAGAAGG - Intergenic
910386544 1:86689581-86689603 TTCTTGGTAAACTGATTAGATGG + Intergenic
910705888 1:90129207-90129229 TTCTTGGCAAGCAGTCCATACGG - Intergenic
912596725 1:110886187-110886209 TTATTGGAAAACAGGCAAGCTGG - Intronic
913523031 1:119664190-119664212 TTGTTGGTAAAGAGCCATGAAGG - Intronic
923149368 1:231219723-231219745 TTATTGGCAAATATTCAAGATGG + Intronic
923704649 1:236334164-236334186 TTCTTGATATAAAGTCAAGTAGG - Intergenic
924953992 1:248909945-248909967 TTCTTGGTAGGCTGTGAAGATGG + Intronic
1063591786 10:7402068-7402090 TGTTTGGTACACAGGCAAGATGG + Intronic
1068872456 10:61959878-61959900 TTCTGGGTAGACAGTCCATAGGG - Intronic
1070552779 10:77503970-77503992 AGCTTGGCAAACAGTGAAGAGGG + Intronic
1072048022 10:91676421-91676443 TTCTTGGAAGACAGTTATGATGG + Intergenic
1074380747 10:112978150-112978172 CTATTGGAAAACAGTTAAGAGGG + Intronic
1075080389 10:119379608-119379630 TTCGTGGGAAACAGGGAAGAGGG - Intronic
1077978025 11:7270208-7270230 TTCTTGCTAAAAGGTCAACATGG - Intronic
1078943735 11:16039023-16039045 TTCCTGGTAACCAGGCAAAAAGG - Intronic
1080916227 11:36663103-36663125 TTCTTTGTAAACACTTAAAAAGG - Intergenic
1083420364 11:62549060-62549082 CTCTTGGTCAACAGGGAAGAAGG + Intronic
1092484364 12:8889593-8889615 TTCTTGGTGAAGTGTCAAGATGG + Intergenic
1094279303 12:28717668-28717690 TTCTGCCTAAACAGTGAAGAAGG - Intergenic
1096124428 12:49109331-49109353 TTCTTGGTGGACAGTCCACATGG - Intronic
1102392240 12:112558500-112558522 TTCAGGGTAAACAGGCAAGATGG - Intergenic
1102548803 12:113675779-113675801 TTCTGTGAAAACAATCAAGAAGG - Intergenic
1105006890 12:132727162-132727184 TTATTGCTAAACTGTCAAAAAGG - Exonic
1105743424 13:23353134-23353156 TTTTGGGAAAACAGTCAACATGG - Intronic
1105815483 13:24032399-24032421 TTCTTCTTAAACAGTCCACATGG + Intronic
1106435266 13:29717997-29718019 GTCTTGGAACACAGACAAGATGG - Intergenic
1107031558 13:35859194-35859216 TTGTTGTTAAACAGCCAAGCAGG + Intronic
1108615164 13:52125672-52125694 TTATTGGTAAACACTGAAGTGGG + Intronic
1109612733 13:64787758-64787780 TTCTTGGGAAACAAACAACACGG - Intergenic
1111756200 13:92398835-92398857 TTCTGGGTATGTAGTCAAGAAGG - Intronic
1114039815 14:18667328-18667350 CTGTTGGTAAGCAGTCAAGATGG - Intergenic
1114044856 14:18865878-18865900 CTGTTGGTAAGCAGTCAAGATGG - Intergenic
1114119367 14:19653644-19653666 CTGTTGGTAAGCAGTCAAGATGG + Intergenic
1115533586 14:34351503-34351525 TTCTAGGTAAACTATTAAGAAGG - Intronic
1117196050 14:53341185-53341207 TTCTTGGAAAAAAGCCAACAAGG + Intergenic
1121073716 14:91049149-91049171 TTCATGGTAGAAAGTTAAGAAGG + Intronic
1121990735 14:98554274-98554296 TTCTTGGTAAACTGCCAAGAAGG - Intergenic
1122647505 14:103205109-103205131 TTCTTGCTATGCAGTCCAGATGG + Intergenic
1123540386 15:21283783-21283805 ATCTTTGAAAACAGTCAGGAAGG - Intergenic
1123972015 15:25516137-25516159 CTCTTGTTAAACAGACAACAGGG - Intergenic
1125905156 15:43384979-43385001 TGCTTGGAAATGAGTCAAGAGGG + Intronic
1129977694 15:79836112-79836134 TCCTTGGTAAGCAGTTAAGATGG - Intronic
1130058510 15:80551560-80551582 CTCTGGGGAAACAGTCAAGGGGG - Intronic
1202948699 15_KI270727v1_random:10931-10953 ATCTTTGAAAACAGTCAGGAAGG - Intergenic
1136673406 16:31877739-31877761 TTCTTGGAAAACACAAAAGATGG + Intronic
1140863903 16:79042962-79042984 ATCTTAGCAGACAGTCAAGAAGG - Intronic
1144999883 17:19296925-19296947 TGCTTGGGAAAAAGTCCAGAAGG - Intronic
1145185934 17:20794228-20794250 TTCTTGATAAAAAGAAAAGAAGG - Intergenic
1145299641 17:21623893-21623915 TTCCTGGTAGAGAGTAAAGAAGG + Intergenic
1147139351 17:38452678-38452700 TTGTTGGTGAACAGTCAAGTGGG + Intronic
1148411184 17:47468620-47468642 TTCTTGATAAAAAGAAAAGAAGG + Intergenic
1149068207 17:52505840-52505862 ATCTTGGATAACAGTCAGGAAGG - Intergenic
1153092488 18:1363870-1363892 TCCTGGGTTAACAATCAAGATGG - Intergenic
1156793295 18:41005924-41005946 TATTTGGTATACAGTAAAGATGG + Intergenic
1157366610 18:47070814-47070836 TTCTTGTTACCCATTCAAGATGG + Intronic
1158681880 18:59575300-59575322 TTCATGGGAAACAGGCAAGGAGG + Intronic
926435099 2:12829067-12829089 TTCTTGCGAAACAACCAAGATGG + Intergenic
928738899 2:34326119-34326141 TTCTAGGGAAAGAGTCCAGATGG - Intergenic
930433365 2:51309981-51310003 TTAATGGTAAGCAGTTAAGAAGG + Intergenic
932459073 2:71870845-71870867 TTCTGGTTAAAGAGGCAAGATGG + Intergenic
936293714 2:111248799-111248821 TTCTGGTTAAACAGTGAGGATGG + Intergenic
937742300 2:125369749-125369771 TTCCTGGCAAAAAGTCAAGTAGG + Intergenic
937818362 2:126279078-126279100 TTCTTGATAAATAGGAAAGATGG + Intergenic
938270736 2:129968279-129968301 CTGTTGGTAAGCAGTCAAGATGG + Intergenic
940074290 2:149723214-149723236 TTCTTGATAAGCAGTGAAGAAGG - Intergenic
940080654 2:149797089-149797111 TTCTTGAGCAACAGTCAGGATGG + Intergenic
941397594 2:164992311-164992333 ATCTTTGAAAACAGTCAGGAAGG - Intergenic
942749442 2:179270828-179270850 TTTTTGGTAAACTGTCCAAAGGG + Intergenic
943151699 2:184122018-184122040 TTCCCGGGAAAGAGTCAAGAAGG + Intergenic
943977016 2:194495555-194495577 TTTTTTGGAAACAGTAAAGATGG - Intergenic
944390160 2:199209717-199209739 TTCTTAGTAAACAGTCCTAATGG - Intergenic
944474222 2:200087362-200087384 GTATTGGTACACAGTCCAGAGGG + Intergenic
945050769 2:205822063-205822085 TCCTGGAGAAACAGTCAAGAAGG + Intergenic
1171560891 20:26124364-26124386 TTCCTGGCAGACAGTGAAGAAGG - Intergenic
1173498449 20:43535426-43535448 TGCTTGGAGAACATTCAAGAAGG - Intronic
1173602056 20:44302539-44302561 CTCTTGGTAAAAAGTGAAGTAGG - Intergenic
1174566938 20:51471669-51471691 TTCATGGTGAAAAGTCAGGAAGG - Intronic
1174585827 20:51607446-51607468 TTCTTGTTCTACAGGCAAGAAGG + Intronic
1177496200 21:21895117-21895139 TTCTGGGTAAAAATTCAAGAGGG - Intergenic
1178129274 21:29552502-29552524 TTCTGGGGAAACGGGCAAGAAGG - Intronic
1179347036 21:40568209-40568231 TTCTTGGGAAACTGTCAGAATGG - Intronic
1180463379 22:15588438-15588460 CTGTTGGTAAGCAGTCAAGATGG - Intergenic
1182166978 22:28185235-28185257 TTCTGTGTAGACAGACAAGATGG - Intronic
951127473 3:19000865-19000887 TTCTTGGCAACCAACCAAGATGG - Intergenic
951374541 3:21897254-21897276 TTATTGATAAACAGGCAAGAGGG + Intronic
952927688 3:38333462-38333484 GTCTTGGCAAAAACTCAAGATGG + Intergenic
955495183 3:59523997-59524019 TTCTTGGGAAACAGCAAAGTAGG + Intergenic
960165475 3:114396556-114396578 TTATTGGTCATCAGTCATGAAGG + Intronic
960419763 3:117429622-117429644 TTCTTAGTTAACTGTCATGATGG + Intergenic
961249550 3:125489016-125489038 TTCTTGGTATACAAACTAGACGG + Intronic
962685571 3:137844699-137844721 TGCTTACTAAAAAGTCAAGAAGG - Intergenic
963493370 3:146029280-146029302 TGATTGTTAAAAAGTCAAGAAGG - Intergenic
964158507 3:153616884-153616906 TTCTTTGTGAACAGACAAGGAGG + Intergenic
969966201 4:10999014-10999036 TTCTTGGGAGAGAGTCAGGAGGG - Intergenic
970234122 4:13941071-13941093 TTCATGGTATGCAGCCAAGATGG - Intergenic
972450638 4:39194819-39194841 TTCTTAGTAAGCAGTGAACAGGG - Intronic
976320580 4:83710074-83710096 AGCTTGGTAGGCAGTCAAGAAGG - Intergenic
976860382 4:89658704-89658726 TTGGTGTTAAACAGTGAAGAGGG - Intergenic
977094726 4:92726115-92726137 TTCCTGGTAAACAGGCAAAATGG - Intronic
981128004 4:141129041-141129063 GTTTTGGAAAACAGTCTAGAAGG + Intronic
983307400 4:166008917-166008939 TTCTTGGTAAAAAGTAGAGAAGG + Intronic
983864155 4:172743503-172743525 TTCTTGGTAAAGTTTCCAGAGGG - Intronic
984412520 4:179412438-179412460 TTCTTGGTAACCAGTAAATTAGG - Intergenic
987265930 5:16255211-16255233 TTCTTGTGACACAGTCTAGAAGG - Intergenic
988701814 5:33682926-33682948 TTCTTGGTAGACAAGAAAGAGGG - Intronic
988913984 5:35874169-35874191 TCCTTGGTAGAAAGTCAAGAAGG + Intronic
989036061 5:37173159-37173181 TTGTTGGTAAACAGAAAAAAAGG + Intronic
989198094 5:38735513-38735535 TAGTTGGTAAACAGACAATACGG - Intergenic
990355121 5:54959658-54959680 TTCTGGGAAAAAAATCAAGAAGG - Intergenic
990415793 5:55585314-55585336 TTCTTGGAACACAATCTAGAAGG + Intergenic
992513268 5:77462538-77462560 TTTTAGGTAAAAAGTTAAGATGG - Intronic
993632270 5:90300619-90300641 TTCTTGGGAAACATTGAAGTAGG + Intergenic
1002831221 6:823132-823154 TTCTCAGGAAACAGTCACGATGG - Intergenic
1006977613 6:38118079-38118101 TTTTTGGGAAACCGTAAAGAGGG + Intronic
1012029160 6:94036704-94036726 TTCTGGGGAAAAATTCAAGACGG + Intergenic
1012241972 6:96883500-96883522 TTCTCTGTAAACATTAAAGAGGG + Intergenic
1012629263 6:101442845-101442867 ATCTGGGAAAACAGTCCAGACGG - Intronic
1012780137 6:103547105-103547127 TTCTGGGGAAACATTCAAGCTGG - Intergenic
1014470700 6:121811135-121811157 TTCCTGGTAAAAACTAAAGAAGG - Intergenic
1015921742 6:138273350-138273372 TCCCTGGTAAGCAGTCAAGTAGG + Intronic
1018671239 6:166179259-166179281 TTCTAACTAGACAGTCAAGAGGG + Intergenic
1020133733 7:5574499-5574521 TGCTTGGTGGACAGTCAAAATGG - Intergenic
1022182827 7:27939035-27939057 TTCTTGCTAAACAGTGATGGTGG - Intronic
1028491164 7:91413849-91413871 TCCTTGGTCAACAGTCTAGAGGG - Intergenic
1029328142 7:99827456-99827478 CTCCAGGTAAACAGACAAGAAGG - Intergenic
1030442336 7:109602246-109602268 TTCTTGGTATAAAGACAAGATGG - Intergenic
1030571193 7:111226823-111226845 TTTTTGGTAAACTGACTAGAAGG + Intronic
1033422192 7:141213606-141213628 TTATTGGTAAACTTTGAAGATGG + Intronic
1034042891 7:147898033-147898055 AATCTGGTAAACAGTCAAGAGGG - Intronic
1034826108 7:154264564-154264586 TGCTTGGTATAGAGTGAAGAGGG + Intronic
1036016083 8:4786183-4786205 TTCTTGCTTAAGAGCCAAGATGG - Intronic
1037070517 8:14641305-14641327 TTCTTGATAAAGTTTCAAGATGG + Intronic
1037451773 8:19022631-19022653 TTCCTGGAAAACACTGAAGATGG - Intronic
1040809169 8:51431336-51431358 TTCTTGGAAACAAGTGAAGAGGG - Intronic
1042852431 8:73229296-73229318 TTTTTGGTAAAAAGGCTAGAGGG - Intergenic
1043049627 8:75369181-75369203 TCCTTGGTAAAGAGAAAAGAAGG + Intergenic
1043746734 8:83881987-83882009 TTTATTTTAAACAGTCAAGATGG + Intergenic
1046206908 8:111012398-111012420 TACTTGGAAAACAGTCATCAGGG - Intergenic
1050063272 9:1732785-1732807 TTCATGGTAAAGACTCACGATGG - Intergenic
1052225754 9:26083575-26083597 TCCTTGGGAAACACTGAAGAGGG + Intergenic
1055204883 9:73716813-73716835 TTATAGGGAAAAAGTCAAGAGGG - Intergenic
1055569136 9:77598748-77598770 TTCTGGGAAAAGAGCCAAGAGGG + Intronic
1058161235 9:101572540-101572562 CTCTTACTAAACAGTCAGGATGG + Exonic
1059052053 9:110936968-110936990 TTCTTGGTAAAATGTCAAGTAGG + Intronic
1185568864 X:1117237-1117259 CTGTGGGTAAACAGTCAGGAAGG + Intergenic
1186100881 X:6155362-6155384 TTCTTAGTGAACAGTATAGAAGG - Intronic
1186890657 X:13956203-13956225 TTCTTGATAAACAGTAACTATGG + Intergenic
1187324133 X:18271060-18271082 ATCTTGGGAAACAATCTAGAAGG + Intronic
1189184048 X:39036331-39036353 TTCTTTTTATACAGTCAAAATGG - Intergenic
1192802799 X:74483488-74483510 TTGGTGGTAAGCAATCAAGAGGG - Intronic
1193795891 X:85872653-85872675 TTCTTGGTAAACAGTCAAGAAGG - Intronic
1195397305 X:104425279-104425301 TTCCGGGTAAACAGGCAGGAAGG + Intergenic
1196968207 X:121081039-121081061 TTGTTTGCAAACAGTCAAGCAGG - Intergenic
1201588179 Y:15584798-15584820 TTCTCTGTAAACAGTCTAAAGGG - Intergenic