ID: 1193797416

View in Genome Browser
Species Human (GRCh38)
Location X:85892783-85892805
Sequence TAGAGCTACTACTTAAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193797416 Original CRISPR TAGAGCTACTACTTAAAAAT GGG (reversed) Intronic
903027290 1:20438431-20438453 TTGAGATACCATTTAAAAATTGG + Intergenic
903732228 1:25505097-25505119 TTGAGCTAACATTTAAAAATTGG - Intergenic
905074559 1:35258371-35258393 TAAAGCTATTTTTTAAAAATTGG + Intergenic
906819978 1:48919100-48919122 TAAAGCTCCTATTTTAAAATAGG - Intronic
907204411 1:52756060-52756082 GAGAGCTATTTTTTAAAAATAGG - Intronic
907711064 1:56881911-56881933 CAGAGCCACAACTTAGAAATAGG - Intronic
908158625 1:61383768-61383790 AAAAGCTACTACTTGAAAACAGG - Intronic
910174566 1:84415331-84415353 TTCAGCTACTACTTACTAATTGG + Intergenic
911603970 1:99879954-99879976 TTCAGCTACTACATATAAATTGG - Exonic
912506199 1:110158268-110158290 TAGAGGTACTGCTGAAATATGGG - Intronic
914432103 1:147628252-147628274 TAAAGCTACTCCTTAAAAAATGG + Intergenic
916145256 1:161732917-161732939 TAGAGCTGAGACTAAAAAATTGG + Intergenic
917772708 1:178297266-178297288 TTGATCTACTCCTTTAAAATTGG - Intronic
918747244 1:188219905-188219927 TAGATCTACTACTTCTAAAAAGG - Intergenic
918890988 1:190267742-190267764 TAGAGCATTTACTTAAAAACAGG + Intronic
921532049 1:216296196-216296218 TAGTGCTACTTTTTAATAATTGG + Intronic
921653894 1:217711691-217711713 AAGAGCTAGTACTTATAAACAGG + Intronic
924121500 1:240804107-240804129 AAGAACTACCACTTACAAATGGG + Intronic
1066991453 10:42518119-42518141 TAGAGATATAACTTAAATATGGG - Intergenic
1068417078 10:56737173-56737195 TAGAGCTACTACTTCATATCAGG + Intergenic
1069973118 10:72190299-72190321 TAGATCTATGACTTAAATATTGG + Intronic
1070397701 10:76025872-76025894 TATACCTACTACTTAATAGTAGG + Intronic
1074768419 10:116717517-116717539 TAGAGGTACTAGTTCAAAGTCGG + Intronic
1076105499 10:127819499-127819521 TAGATCAATTACTTCAAAATAGG - Intergenic
1079464625 11:20717500-20717522 TAGAGGTTCTATTTACAAATGGG + Intronic
1080203428 11:29701337-29701359 TAGACATATTCCTTAAAAATTGG + Intergenic
1081400659 11:42638305-42638327 TAAAGCTAATACTTTTAAATTGG - Intergenic
1082210913 11:49499666-49499688 TAGAGATAATAATAAAAAATAGG + Intergenic
1086408366 11:86519123-86519145 CATAGCTACTACACAAAAATTGG - Intronic
1087265316 11:96054214-96054236 TAGAGTTACTACTTAGAATCAGG - Intronic
1087533922 11:99419637-99419659 AAAAGATACTATTTAAAAATTGG - Intronic
1090109189 11:123886529-123886551 TAGAGCTACAATTTAAAACCAGG - Intergenic
1090129213 11:124122131-124122153 TGGAACTGCTTCTTAAAAATGGG + Intronic
1090526090 11:127538826-127538848 TAGAACTATCACTTAAAAGTTGG + Intergenic
1091137278 11:133203148-133203170 TAGAATTACTACTCAAAACTAGG + Intronic
1093724208 12:22484614-22484636 TAAAGCTGACACTTAAAAATAGG + Intronic
1095084412 12:38046077-38046099 TAGAGATTCTACTTAAAGAGTGG - Intergenic
1097056652 12:56254085-56254107 TGGAGCTACTGGTTAATAATGGG - Exonic
1097390899 12:59011570-59011592 TAGAGCTAGTATTTCAACATAGG + Intergenic
1099072625 12:78064955-78064977 GAGTTCTAATACTTAAAAATTGG - Intronic
1099820917 12:87708911-87708933 TAAAGATACTACTGAAGAATGGG + Intergenic
1104839297 12:131813566-131813588 GAGAGCTTCTACCTAAAAAGAGG - Intergenic
1105439084 13:20401081-20401103 CTGAGCTACTACTAAAAAATAGG - Intergenic
1106167757 13:27263850-27263872 CATGGCTATTACTTAAAAATAGG - Intergenic
1106216292 13:27703914-27703936 TAGAGCTCCTATATAATAATGGG - Intergenic
1108579791 13:51818600-51818622 TAGAGGTACTAAATAAACATGGG + Intergenic
1108819039 13:54323267-54323289 TAATGCTTCTAATTAAAAATTGG - Intergenic
1108868694 13:54954667-54954689 TAGATTTGCTACTGAAAAATGGG + Intergenic
1109481477 13:62961154-62961176 GAGAGCTACAAGTAAAAAATGGG + Intergenic
1110884146 13:80611708-80611730 TAGAGTTTCTACATAAGAATTGG + Intergenic
1111306685 13:86422703-86422725 AAGTACTCCTACTTAAAAATGGG + Intergenic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112536209 13:100258953-100258975 TAGAGCAACTTCTTAAAATGAGG - Intronic
1112985780 13:105447461-105447483 TAGAGCTTCTATTAAAAGATTGG - Intergenic
1113358007 13:109601508-109601530 TGGAGCTCCCTCTTAAAAATGGG + Intergenic
1114036408 14:18633276-18633298 TTGAGCAACTAATTAGAAATAGG + Intergenic
1114122227 14:19681757-19681779 TTGAGCAACTAATTAGAAATAGG - Intergenic
1115092270 14:29592028-29592050 TAAAGCGAATATTTAAAAATAGG + Intronic
1116016467 14:39413791-39413813 GAGAGCTACTGCTTACAAAAAGG - Intronic
1116073356 14:40078099-40078121 TAGAGCTACACCATAAAAAATGG - Intergenic
1116119545 14:40705274-40705296 TAAAGATACTACCTAAGAATGGG + Intergenic
1117332964 14:54732156-54732178 AATAGCTAATATTTAAAAATCGG + Intronic
1117608488 14:57457097-57457119 TATAGCAACCACTTAAAAAAAGG - Intergenic
1117644318 14:57835330-57835352 TACAGCTACTTCTCAACAATTGG + Intronic
1121779654 14:96614070-96614092 TAGTGCTACAAGATAAAAATGGG - Intergenic
1121800527 14:96770386-96770408 TAGAGTTACTGCCTCAAAATGGG + Intergenic
1125295579 15:38199492-38199514 TAAAACTACCACTAAAAAATCGG - Intergenic
1126310279 15:47308149-47308171 TTGGGCCACTACTTAAATATTGG - Intronic
1126569440 15:50134408-50134430 TTGAGCTAGTCCTTGAAAATTGG + Intronic
1126975647 15:54176252-54176274 TAGAGATGCTACTAAAAAGTGGG - Intronic
1127354679 15:58186853-58186875 TAAAGCAACTATTTAAAAAATGG - Intronic
1127943895 15:63730071-63730093 TATAGCAAATACTTAAAAATTGG - Intronic
1128227512 15:66012531-66012553 TAGAATTATTAATTAAAAATAGG - Intronic
1128264037 15:66252693-66252715 AAAAAATACTACTTAAAAATAGG - Intronic
1130674771 15:85941932-85941954 TGGAGATACTACTTGAAAAAAGG + Intergenic
1132597010 16:757082-757104 TAAAGCTGTTATTTAAAAATGGG - Intronic
1135624720 16:23983944-23983966 TAAAGCACCTACTTGAAAATGGG + Intronic
1137003834 16:35254358-35254380 TTGAGCTACCACTTATAAGTGGG - Intergenic
1138866194 16:60823287-60823309 TTGGGCCACTACTTGAAAATGGG - Intergenic
1140502373 16:75444872-75444894 TGGAGCTAAGACTTAAAATTAGG - Intronic
1141934121 16:87225625-87225647 TAAAGCTGTTACTTAAAAAAGGG - Intronic
1142252170 16:88996996-88997018 TAGAACTTCAACTTATAAATTGG + Intergenic
1144496757 17:15750980-15751002 TAGACCTACTAATTATAAACTGG + Intergenic
1144904883 17:18633913-18633935 TAGACCTACTAATTATAAACTGG - Intergenic
1149978664 17:61291722-61291744 AAGAGCTGCTACTTTAAAACTGG - Intronic
1150151607 17:62813488-62813510 TATATCTCCAACTTAAAAATGGG - Intergenic
1151185196 17:72359118-72359140 TAGGGCTAATACTTAAACCTGGG + Intergenic
1154126311 18:11695236-11695258 TTGAGCAAATGCTTAAAAATAGG - Intronic
1155279404 18:24223344-24223366 GAAAGCTACTTTTTAAAAATAGG + Intronic
1155725449 18:29075900-29075922 TAGAGTTGCAAGTTAAAAATAGG - Intergenic
1155802026 18:30117612-30117634 TTGAGCTAATCCTTAAAAGTAGG - Intergenic
1157536141 18:48458990-48459012 CAGAGCTATTACATAAAACTGGG + Intergenic
1159391848 18:67803594-67803616 AATAGCTACTACCTAATAATTGG - Intergenic
1159604319 18:70459269-70459291 TAGAGCTATTGTTTTAAAATGGG - Intergenic
1159791066 18:72779549-72779571 CAGTGCTACTACTTGGAAATGGG - Intronic
1164006610 19:21155617-21155639 CTGAGCTACTGTTTAAAAATTGG - Intronic
1164449588 19:28349239-28349261 TAAACCTACTTTTTAAAAATGGG + Intergenic
928774331 2:34740130-34740152 TGGTGCTACTAATTATAAATTGG - Intergenic
929015664 2:37491888-37491910 TTTAGCTCCTACTTATAAATGGG + Intergenic
931854248 2:66285214-66285236 TAGAGCTAAGACTTAAATCTAGG - Intergenic
931912185 2:66912409-66912431 TAGAACTAAAAGTTAAAAATGGG + Intergenic
933137049 2:78750911-78750933 TGGAGCAACTAGTAAAAAATAGG + Intergenic
933506700 2:83185318-83185340 TAGATATACTGCTTAAAAAAAGG + Intergenic
933532202 2:83524979-83525001 TAGAGCTACACCTTAAAAGAAGG - Intergenic
935819643 2:106882074-106882096 TTAAGCTGCAACTTAAAAATGGG - Intronic
937605237 2:123792694-123792716 TAGAGGTAGGACTCAAAAATTGG - Intergenic
938737241 2:134197454-134197476 TGGATCTAGCACTTAAAAATTGG + Intronic
938846927 2:135219729-135219751 TAGAGAAATTACTTAAAAATTGG + Intronic
940581709 2:155588266-155588288 TAGTGTTACTTCTAAAAAATTGG - Intergenic
942632370 2:177964606-177964628 TTTAGCTTCTACTTAAAAGTGGG + Intronic
942701168 2:178712423-178712445 TATAACTACGACTGAAAAATCGG - Exonic
943016903 2:182523792-182523814 TAAAGCTAATTCTTAAAAATGGG + Intergenic
943025411 2:182622153-182622175 TAGAACCACTATTTAAAACTAGG + Intergenic
943810616 2:192183662-192183684 TAGAGCTTATGCTTTAAAATGGG - Intronic
943926251 2:193784623-193784645 TAGGGCAACTACCAAAAAATAGG + Intergenic
947015306 2:225612862-225612884 TAGAGCTTCAACATATAAATTGG + Intronic
1169744241 20:8927437-8927459 TGTAGCTAATTCTTAAAAATAGG + Intronic
1169912136 20:10655641-10655663 TAGCGTTACTCCTTAAAATTTGG + Intronic
1169997373 20:11573451-11573473 TAGAGGTACTTATTTAAAATGGG - Intergenic
1170460768 20:16574588-16574610 TGGAGCTAGGACTTAAAAACAGG - Intergenic
1174814816 20:53677712-53677734 TAAAGCTTCTACATAAAAATTGG + Intergenic
1177236237 21:18392685-18392707 TAAAGATACTACTCAAAACTGGG + Intronic
1177661738 21:24093128-24093150 TAGAGCTTCTACAGAAAAACTGG - Intergenic
1178639219 21:34332808-34332830 TAGAGCTTCAACATATAAATTGG + Intergenic
1180460534 22:15560336-15560358 TTGAGCAACTAATTAGAAATAGG + Intergenic
1181382100 22:22513843-22513865 TGGAGCTACTTCTTGACAATAGG + Exonic
1183168250 22:36163933-36163955 TAAAGCTAATATTTAAAAAAAGG - Intronic
949734791 3:7159661-7159683 TAGAGCTAGTATTTAAACCTAGG - Intronic
949792877 3:7812334-7812356 AAGAGCTACTCTTTAAAAGTTGG + Intergenic
950250947 3:11464776-11464798 TAGAGCTATAATTTGAAAATAGG - Intronic
953969015 3:47332718-47332740 TAGAGCCAGGCCTTAAAAATAGG + Intronic
954075930 3:48180307-48180329 TAGATCTCTTACTTAAAACTTGG - Intronic
955677804 3:61467367-61467389 TTGAGCTGCTCCTTAAAAAGTGG - Intergenic
956625731 3:71264870-71264892 CACAGCTACTTTTTAAAAATGGG + Intronic
957245774 3:77713825-77713847 TAAAGCTGAAACTTAAAAATAGG - Intergenic
957499262 3:81032810-81032832 TAGTGTTAATAGTTAAAAATAGG - Intergenic
959197334 3:103201317-103201339 TAGAGTTAGTACTTACAAAACGG - Intergenic
959708896 3:109364672-109364694 TTTAGCTACTGCTTAATAATAGG + Intergenic
961099182 3:124184044-124184066 GTGAGCTGCTGCTTAAAAATGGG + Intronic
963760222 3:149280831-149280853 TAGAGCTAATATTTACAAAAGGG - Intergenic
963885783 3:150580811-150580833 CACAGCTACTAGTGAAAAATAGG + Intronic
964342792 3:155725970-155725992 TAGGGCAACTACTAAAAATTAGG - Intronic
965240015 3:166184351-166184373 TAGAGCTACAATTTAAATCTAGG - Intergenic
965380413 3:167981309-167981331 GAGAGCCACAACTTAAAACTAGG - Intergenic
967217655 3:187224176-187224198 TTGAGATAATACTTAAACATAGG - Intronic
967250423 3:187532096-187532118 TTGAGCTACAGCTAAAAAATGGG + Intergenic
967747497 3:193074257-193074279 TAAAGATACTACCTAAAACTGGG + Intergenic
970035135 4:11724490-11724512 TAGAGTTGCTTATTAAAAATGGG - Intergenic
970716923 4:18937170-18937192 TAGAGCTAGGACTTAAAAGTTGG - Intergenic
971615329 4:28782078-28782100 TAGAGACAATACTTCAAAATTGG - Intergenic
971699632 4:29953937-29953959 CAGAGCTATTGCTCAAAAATTGG + Intergenic
971864465 4:32151379-32151401 AAGAGTTACTACTTATACATTGG - Intergenic
971894619 4:32576176-32576198 TAAAGCTACTAGAAAAAAATGGG + Intergenic
973660416 4:53099658-53099680 TAGAGCTGCTTGTTAAAAACAGG - Intronic
976271274 4:83232645-83232667 AAGAGCTAATACTAAAGAATTGG - Intergenic
979727342 4:123978554-123978576 TATTGTTAGTACTTAAAAATAGG + Intergenic
981050856 4:140308206-140308228 TTGTGCTAGTAATTAAAAATTGG + Intronic
982850222 4:160305515-160305537 TTGAGCAAAGACTTAAAAATAGG - Intergenic
983121933 4:163897109-163897131 TAGTGTTACTCCATAAAAATTGG - Intronic
987550093 5:19368508-19368530 TAGCGTGACTGCTTAAAAATGGG - Intergenic
990671073 5:58130620-58130642 TAGATTTACTTTTTAAAAATGGG + Intergenic
991621136 5:68546347-68546369 TTGAGTTAGAACTTAAAAATTGG + Intergenic
992590696 5:78293476-78293498 AAGTGCTACTACTTCAAATTGGG - Intronic
995011239 5:107259234-107259256 TAGAGATACTACTCAAAACTGGG + Intergenic
996617685 5:125460584-125460606 TAGAGCTACGACTTAAGATGAGG - Intergenic
998228634 5:140345568-140345590 TAGAGCTACTATGTAAAAATGGG - Intronic
999035358 5:148343056-148343078 AAGAGCACCTGCTTAAAAATAGG + Intergenic
1001996289 5:176161896-176161918 TAGAGCAACCACTAAAAAAGTGG + Intergenic
1002973149 6:2045821-2045843 TATAGTTATTACTTACAAATGGG - Intronic
1003182361 6:3802910-3802932 TAGAGCTGCACCTTTAAAATAGG + Intergenic
1007787322 6:44288204-44288226 TAGAGCTATTATCTAAAATTTGG - Intronic
1008931226 6:56942473-56942495 CAGAGCAACTAATTAAAAAAAGG - Intronic
1011331187 6:86208177-86208199 TAATGTTACTACATAAAAATGGG - Intergenic
1013385035 6:109619393-109619415 TAAAGCAAGTACTCAAAAATAGG - Intronic
1013987475 6:116213045-116213067 TAGAGATAATAATTAAAATTGGG + Intronic
1014314810 6:119850523-119850545 TAGAGCTAGTAGTTATAATTAGG + Intergenic
1015372494 6:132470257-132470279 TAGAGTTATTACTTAATTATTGG + Intronic
1016238135 6:141892878-141892900 TTTAGCTCCTACTTATAAATAGG - Intergenic
1016591832 6:145754533-145754555 TACAGCTACTACGTAAGTATGGG - Intergenic
1017226402 6:152027346-152027368 TAGAGCTAATATCAAAAAATGGG - Intronic
1020698925 7:11452712-11452734 ATGAGCTACTATTTAAAAAATGG + Intronic
1020959186 7:14780881-14780903 TAGAGCTACATCATAAAAAAAGG - Intronic
1023104643 7:36751557-36751579 TAGAGCAACCACTTAACACTTGG + Intergenic
1024421145 7:49168036-49168058 TAGAGCAACAACAAAAAAATGGG + Intergenic
1025874796 7:65470776-65470798 TAAATCAACTACTTAAATATTGG - Intergenic
1027748416 7:82108494-82108516 TAGAGCTTCAACATATAAATTGG + Intronic
1027889581 7:83953554-83953576 TACAACTACTACTTTAAAATGGG + Intergenic
1027925134 7:84450624-84450646 TAAATTTACTACTTACAAATAGG - Intronic
1027982629 7:85245415-85245437 TAGTGCTAGTTCTTAAAAACAGG - Intergenic
1028684694 7:93578233-93578255 TAGAGCTAGTCTTTAATAATGGG - Intergenic
1032187502 7:129739914-129739936 CAGAGCTGCTGCTGAAAAATGGG + Intronic
1033257673 7:139816251-139816273 TAGAGATACTACTTGAGACTGGG - Intronic
1034161548 7:148997545-148997567 TAGATCTGACACTTAAAAATTGG + Intergenic
1037119783 8:15268689-15268711 TAAAGCTAGTACTCAATAATTGG + Intergenic
1037230995 8:16658569-16658591 TAGGGCAACCACTTAAAAATAGG + Intergenic
1039206774 8:35164288-35164310 TAAAGATACTACTTGAAACTGGG - Intergenic
1040782323 8:51124343-51124365 TAGAGCCAGTATTTGAAAATAGG + Intergenic
1041401800 8:57453843-57453865 TAGAGATTATTCTTAAAAATAGG - Intergenic
1041871600 8:62640482-62640504 TAGAGATACTACCCAAAACTAGG - Intronic
1042899555 8:73709615-73709637 AAGAGCTAGTACTTAAACTTAGG - Intronic
1047634592 8:126746659-126746681 TAGATAAACTAATTAAAAATGGG + Intergenic
1049117368 8:140700762-140700784 TACAACTACTTCTTAAAACTTGG - Intronic
1050421448 9:5469716-5469738 TAGAGCAAATACTTAACAAATGG - Exonic
1050701353 9:8343266-8343288 TATAACCACTACTTTAAAATAGG + Intronic
1051042945 9:12836422-12836444 TAAAGCTACTAAATAAAATTGGG + Intergenic
1055978773 9:81979878-81979900 TGGTGCTACTAATTAATAATGGG - Intergenic
1059400621 9:114067997-114068019 TAGAACTACTTCTAAAAGATGGG + Intronic
1059982358 9:119787145-119787167 TATAGTTACTCCCTAAAAATGGG + Intergenic
1186249858 X:7654118-7654140 TAGACCTACTCCCTTAAAATGGG - Intergenic
1188176070 X:26991275-26991297 TAGAAATACTATTGAAAAATTGG + Intergenic
1193797416 X:85892783-85892805 TAGAGCTACTACTTAAAAATGGG - Intronic
1194211555 X:91076239-91076261 TAAAGATACTATTTTAAAATAGG + Intergenic
1194601866 X:95931362-95931384 TAGAGCTGCTAATGATAAATTGG - Intergenic
1196155319 X:112422240-112422262 TAGAGTGACTACTATAAAATAGG + Intergenic
1196535466 X:116838496-116838518 TAGAGCTAGGACCTGAAAATGGG + Intergenic
1197419811 X:126224839-126224861 TACAGCTATTACTTAAGAGTTGG + Intergenic
1198238037 X:134755277-134755299 AAGAGCTACCACTTAATAGTTGG - Intronic
1199495926 X:148452338-148452360 TAGACAGCCTACTTAAAAATAGG - Intergenic
1200812435 Y:7499984-7500006 TGGAGTTATTACTCAAAAATTGG + Intergenic
1201465583 Y:14276847-14276869 TAGACCTACTCCCTTAAAATAGG - Intergenic
1201695991 Y:16826908-16826930 TGGAGCAACTACCTAAAAATAGG + Intergenic