ID: 1193805919

View in Genome Browser
Species Human (GRCh38)
Location X:85994344-85994366
Sequence AATTGCTTGCAGAAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193805919_1193805920 0 Left 1193805919 X:85994344-85994366 CCAGCACACTTCTGCAAGCAATT 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1193805920 X:85994367-85994389 AACACAGTCCAGTGCCAGTCAGG 0: 1
1: 0
2: 1
3: 29
4: 251
1193805919_1193805923 27 Left 1193805919 X:85994344-85994366 CCAGCACACTTCTGCAAGCAATT 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1193805923 X:85994394-85994416 GCTACATTCACTGACAACCCTGG 0: 1
1: 0
2: 1
3: 10
4: 81
1193805919_1193805924 28 Left 1193805919 X:85994344-85994366 CCAGCACACTTCTGCAAGCAATT 0: 1
1: 0
2: 0
3: 7
4: 138
Right 1193805924 X:85994395-85994417 CTACATTCACTGACAACCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193805919 Original CRISPR AATTGCTTGCAGAAGTGTGC TGG (reversed) Intronic
904940820 1:34164251-34164273 CATTCCTTGCAGGAGGGTGCAGG - Intronic
905409605 1:37759365-37759387 AATTGCATGCAGAAGGATGGAGG - Intronic
907571145 1:55485139-55485161 AAATACTGCCAGAAGTGTGCTGG - Intergenic
909006884 1:70287173-70287195 AATTTCTCTCAGAAGTGTTCAGG - Intronic
911255451 1:95628073-95628095 AATTGTATGCAGAAGGGTGGAGG + Intergenic
914648214 1:149673900-149673922 AGGGGCTTGCAGAAGGGTGCAGG + Intergenic
916428980 1:164709603-164709625 AATTTCTTGCATAGGTCTGCTGG + Intronic
916577698 1:166081984-166082006 AATGGCTTGGAGAAGGGTGGCGG - Intronic
917734394 1:177907312-177907334 CATTACTTGCAAAAGTGTGATGG - Intergenic
920193396 1:204210114-204210136 CATTGCCTGCAGAAGTGGACTGG - Intronic
920367695 1:205456704-205456726 AAATGCCTGCATATGTGTGCGGG - Intergenic
920443817 1:206000772-206000794 AAGTCCTTGCAGGAGTGTGCTGG - Intronic
920553723 1:206887829-206887851 ACTTGCTGTCAGAAGTGTTCAGG - Intergenic
923450668 1:234114159-234114181 AATGGCATGCAGTGGTGTGCTGG - Intronic
924591148 1:245405796-245405818 AATTGCTTACTGAATTGTGTAGG + Intronic
1062875433 10:939552-939574 GATTTCTTGCAGAAATCTGCTGG + Intergenic
1067700027 10:48564743-48564765 AAATGCTTGCAGAAGAGAGAGGG - Intronic
1068020851 10:51581782-51581804 AATTGCATGCAGGATTGTGTAGG - Intronic
1076241728 10:128913726-128913748 AATTGCTAGGAGAAGTGTATAGG + Intergenic
1081205308 11:40268130-40268152 AATAACTTTCAGAAGTGTGGTGG + Intronic
1084853676 11:71965669-71965691 AACTGCTTGCACAGGTATGCAGG - Intronic
1086286219 11:85254133-85254155 AATTGTTGGCAGAAGTGGGCAGG - Intronic
1086559273 11:88148347-88148369 AAGTGCTTGCTTAATTGTGCTGG + Intronic
1087890051 11:103527672-103527694 AAATGCTAGGAGAAGGGTGCTGG - Intergenic
1088279595 11:108122581-108122603 CATTACTTGCACAAGGGTGCTGG + Intronic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1098840440 12:75471240-75471262 AATTGCTTAAAGAAGTTTGTGGG + Intergenic
1100074156 12:90757967-90757989 AATTGTTTACAGAAGTGAACTGG + Intergenic
1101675828 12:106915305-106915327 AGGTGTTTGCAGAAGTGTGGGGG - Intergenic
1101714985 12:107302782-107302804 AGATACATGCAGAAGTGTGCTGG - Intergenic
1103985480 12:124764418-124764440 AAATGCTTACAGAACTGGGCAGG - Intergenic
1112527482 13:100165711-100165733 AACTGCATGCTGAAGTGTACAGG - Intronic
1113375675 13:109763387-109763409 AATTCATTCCAAAAGTGTGCTGG - Intronic
1117280051 14:54230860-54230882 GATTGCTGGCAGAGGTTTGCAGG + Intergenic
1117953207 14:61103177-61103199 CATTGCTTCCATATGTGTGCTGG - Intergenic
1120289891 14:82554317-82554339 AATGGATAGCAGAAATGTGCTGG - Intergenic
1128106978 15:65052239-65052261 AATTTCCTGCAGTAGTGTGAGGG + Intronic
1129518086 15:76169099-76169121 AATTGGGTGCATAAGTGTGATGG - Intronic
1129614497 15:77087488-77087510 GCCTGGTTGCAGAAGTGTGCAGG - Intergenic
1132642848 16:985487-985509 AAGTGCCTGCTGAAGTCTGCAGG + Exonic
1138748069 16:59386704-59386726 ACTTGTTTCCGGAAGTGTGCAGG - Intergenic
1143201778 17:5118269-5118291 AACCTCTTGCAGGAGTGTGCAGG + Exonic
1150136145 17:62696406-62696428 AAATGCTTGCAGGTGGGTGCAGG - Intergenic
1155418941 18:25632993-25633015 AAGTGTCTGCAGGAGTGTGCTGG - Intergenic
1155759537 18:29548522-29548544 ATTTGGTTGCAGAAGTCTTCTGG + Intergenic
1157607747 18:48936740-48936762 AATTCCTTGCAGAATTATGATGG - Intronic
1157663143 18:49463244-49463266 AACTGCCTGCAGAAGTATGATGG + Intergenic
1158240550 18:55372596-55372618 AATTTTTTTCAGAAGTGTGGGGG - Intronic
1161887387 19:7007450-7007472 ATTGGCGTGCAGATGTGTGCGGG + Intergenic
1161887822 19:7010454-7010476 ATTGGCGTGCAGATGTGTGCGGG - Intergenic
1163335555 19:16669291-16669313 AATTGCTTGAACCAGTGAGCCGG - Intronic
1163682840 19:18693300-18693322 AATTGCTTGAACCAGGGTGCTGG + Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
925452672 2:3983327-3983349 ATTTGCATGCAGAAGTATTCAGG + Intergenic
925575543 2:5356327-5356349 AATTACTTGCTGAAGTTAGCTGG - Intergenic
925680770 2:6419053-6419075 AATTGCACCCAGAAATGTGCTGG - Intergenic
926618150 2:15020362-15020384 TATTGTTTCAAGAAGTGTGCTGG + Intergenic
928301861 2:30132157-30132179 AAATACTTGCAGAAGATTGCAGG - Intergenic
929731845 2:44503296-44503318 CATTGCTTGCAAGAGTGTGAGGG + Intronic
932698028 2:73973258-73973280 AACTGCTTGCAGGAGTGATCAGG - Intergenic
932883537 2:75526869-75526891 AAACACTGGCAGAAGTGTGCAGG + Intronic
932967478 2:76493740-76493762 AATTCATTGCAGAAGTGTAATGG + Intergenic
934579382 2:95426437-95426459 ACTAGCTTGCAGAAGTGAGGGGG + Intergenic
934600061 2:95650287-95650309 ACTAGCTTGCAGAAGTGAGGGGG - Intergenic
941566695 2:167117742-167117764 AATTCCTTGGAGAGGTTTGCTGG - Intronic
944925272 2:204457723-204457745 AAATGCATGCAGAACTATGCAGG + Intergenic
945511854 2:210713018-210713040 TATTGCTTTCAGCAGTGTCCTGG + Intergenic
946909490 2:224445534-224445556 AATTGCTTGCAGCAGGGAGGTGG - Intergenic
947666703 2:231910565-231910587 AGGTGCTGGCAGAAGTTTGCTGG - Intergenic
1170088557 20:12564918-12564940 AATTTCTTGCAGTTGTGTGCAGG - Intergenic
1170489474 20:16858044-16858066 AATTGCCTCCAGAGGTGGGCAGG - Intergenic
1175067342 20:56300620-56300642 ACATGCATGCTGAAGTGTGCAGG + Intergenic
1179478316 21:41661990-41662012 AGTTTCTTGGAGAAGTGGGCTGG + Intergenic
1184835614 22:47019289-47019311 AGATGCTTGCTGAAGTGTGAGGG - Intronic
949868262 3:8564910-8564932 AATGACTTGCAGAAGATTGCTGG - Intronic
953838203 3:46366064-46366086 AATGGATTGTAGAAGTGGGCAGG - Intergenic
955072111 3:55580540-55580562 AATTGCTTTCATAAGGGTGCTGG + Intronic
956547486 3:70420349-70420371 ATTTGTTTTCAGAAATGTGCTGG + Intergenic
957453925 3:80416373-80416395 ACTTTCTTGGAGATGTGTGCAGG + Intergenic
959598867 3:108156703-108156725 AATAGCTTTCAGTGGTGTGCTGG - Intergenic
960768170 3:121161442-121161464 AATTGCTTTCAAAATTTTGCGGG + Intronic
961443097 3:126964407-126964429 ACATGCTTGCACATGTGTGCTGG - Intergenic
963292832 3:143510944-143510966 AATTTCTTGGAGAAGTGAACAGG - Intronic
966061419 3:175760986-175761008 AATATCTTGCAGTAGTGTGTTGG + Intronic
970369530 4:15393342-15393364 AATGGCCTGCAGAAGAGTGTGGG - Intronic
971591611 4:28475961-28475983 AAATGATTGCAGAAATGTCCTGG + Intergenic
972361447 4:38329161-38329183 ATTTCCTTGCAGAAGGGTGGTGG - Intergenic
978325537 4:107549867-107549889 AATTCCATGCAGATATGTGCTGG + Intergenic
978558769 4:110009583-110009605 AATTGTTTGCAGTACAGTGCGGG - Intronic
979178359 4:117692801-117692823 AATTGCTAACAGAAGTGCACAGG + Intergenic
981884228 4:149653500-149653522 AAAAGCCTGAAGAAGTGTGCAGG - Intergenic
984128429 4:175841606-175841628 AACACATTGCAGAAGTGTGCTGG - Intronic
985066512 4:186127292-186127314 ACTTCCTAGCAGCAGTGTGCTGG - Intronic
988033179 5:25792623-25792645 AATTGCTTGCACCAGTGAGGTGG + Intergenic
991322723 5:65393234-65393256 AATTGCTTAAAAAAGTGTGTAGG + Intronic
991962155 5:72055762-72055784 AATTTCTTGGAGAAGAGAGCAGG - Intergenic
993228026 5:85194698-85194720 GATTGCTTGCACAAAGGTGCTGG - Intergenic
993504914 5:88696710-88696732 AATTGCTTTCAGAGGTTTGATGG - Intergenic
1002553754 5:180018206-180018228 AATTGCTTGAACAAGGGTGGTGG + Intronic
1003485031 6:6568326-6568348 AATTACTTGCAGAAGGGTAGGGG - Intergenic
1004251185 6:14024441-14024463 AGATGCAGGCAGAAGTGTGCAGG - Intergenic
1010067601 6:71703189-71703211 AATTGCAGGCAAAAGTGTGGTGG - Intergenic
1013696880 6:112713489-112713511 AATTGCAGGCAGAAAGGTGCAGG - Intergenic
1015439159 6:133227660-133227682 TATTGCTTCTATAAGTGTGCTGG + Intergenic
1021662276 7:22931560-22931582 AATTGCTTTAAAAAGTTTGCTGG + Intergenic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1022737475 7:33089629-33089651 AAATGTTTGCACTAGTGTGCTGG + Intergenic
1024140434 7:46457708-46457730 AAGTGCTCACAGAAGTGTGTTGG + Intergenic
1024933939 7:54692453-54692475 AAATGAATGCAGTAGTGTGCAGG + Intergenic
1026859867 7:73778835-73778857 AATTGTGTGCAGAACTGTGGAGG + Intergenic
1029608665 7:101615023-101615045 AATTGCAGGCAGGAGTGGGCGGG - Intronic
1031131811 7:117841684-117841706 AATTGCATGCATAGGAGTGCAGG + Intronic
1031672662 7:124569124-124569146 AATTGCCTGCTGGAGTGTGCTGG - Intergenic
1032327406 7:130943271-130943293 AATTGCTTGAGAAAATGTGCTGG + Intergenic
1032948935 7:136885299-136885321 GCTTGCTTGCAAAAGTGAGCAGG + Intronic
1033138143 7:138801667-138801689 AAATGCTTGAAGAAGTTTGGAGG + Intronic
1035611813 8:971663-971685 TATTCCTGGCAGAAGTATGCGGG - Intergenic
1035745276 8:1957805-1957827 ATTTGCTTTCAGAAGTGAGCTGG + Exonic
1036056594 8:5261924-5261946 AATGGCACGCAGAAGTGTGGGGG + Intergenic
1036150213 8:6290071-6290093 AATTAATTTCAGGAGTGTGCAGG - Intergenic
1038065172 8:23956309-23956331 AATTGCTTGCTGAAGTATAATGG + Intergenic
1038239466 8:25795372-25795394 ATTTACATGCAGAAGTGGGCAGG + Intergenic
1038494912 8:27994531-27994553 AAGGGCTTGCAGGAGTGGGCTGG + Intergenic
1041163195 8:55065758-55065780 AATTGCTTGCAGAATCCTCCTGG + Intergenic
1042937995 8:74079901-74079923 ATGTGCATGCAGATGTGTGCAGG + Intergenic
1043157501 8:76802469-76802491 ACTTGCTTGCAGAAGCTTGTAGG - Intronic
1046035025 8:108830328-108830350 AATTGTTTGCAGAATTGAGTTGG + Intergenic
1050249816 9:3732978-3733000 ACTTGCTTGCTGCAGTGTGCTGG - Intergenic
1051691619 9:19719131-19719153 TATTGCTTGAAGAAGTTTTCTGG + Intronic
1055495501 9:76850467-76850489 ACTTGTTGGCAGCAGTGTGCTGG - Exonic
1056262797 9:84865272-84865294 ACTTGTTTGCAGAATTGAGCCGG + Intronic
1056952848 9:91058716-91058738 GATTGTCTGCAGAAGTGTTCTGG + Intergenic
1058192354 9:101934150-101934172 GATTACTTGCAGAAGTGTTAGGG + Intergenic
1059819542 9:117956806-117956828 AATTAGTTGCAGAAGTAGGCAGG + Intergenic
1060678730 9:125542005-125542027 AATTGCTTGCAGACGCTAGCAGG + Intronic
1062391119 9:136334234-136334256 AGGTGCTGGCAGAGGTGTGCTGG + Intronic
1187547822 X:20268897-20268919 ACGTGCTTGCAGAAGTTTGGAGG + Intergenic
1193805919 X:85994344-85994366 AATTGCTTGCAGAAGTGTGCTGG - Intronic
1194165210 X:90507092-90507114 AATTGCTGGCAGAACTGATCAGG + Intergenic
1194819830 X:98491718-98491740 AATTTCCTGCAGTAGTGTTCTGG - Intergenic
1194878902 X:99225636-99225658 AATTCCTGGCAGAAGAGGGCAGG + Intergenic
1196257943 X:113544828-113544850 GGTTGGTTGCAGAAGTGTGGAGG - Intergenic
1196796058 X:119502803-119502825 CAAGGCTGGCAGAAGTGTGCTGG - Intergenic
1197027715 X:121775041-121775063 AATTGCTTTCAGCAGTGTTTTGG + Intergenic
1198092787 X:133348469-133348491 AAAGGCTCACAGAAGTGTGCTGG + Intronic
1199728221 X:150605747-150605769 AATGGCTTTCAGATGGGTGCTGG + Intronic