ID: 1193806562

View in Genome Browser
Species Human (GRCh38)
Location X:86002637-86002659
Sequence GTTCTCCCTTGGTTAGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 987
Summary {0: 1, 1: 0, 2: 1, 3: 78, 4: 907}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193806562_1193806571 1 Left 1193806562 X:86002637-86002659 CCCTTTCCTAACCAAGGGAGAAC 0: 1
1: 0
2: 1
3: 78
4: 907
Right 1193806571 X:86002661-86002683 GCGAGGAGGCAGCCTGGCTGGGG 0: 2
1: 32
2: 114
3: 421
4: 2903
1193806562_1193806574 6 Left 1193806562 X:86002637-86002659 CCCTTTCCTAACCAAGGGAGAAC 0: 1
1: 0
2: 1
3: 78
4: 907
Right 1193806574 X:86002666-86002688 GAGGCAGCCTGGCTGGGGGAGGG 0: 3
1: 77
2: 332
3: 2448
4: 3319
1193806562_1193806575 7 Left 1193806562 X:86002637-86002659 CCCTTTCCTAACCAAGGGAGAAC 0: 1
1: 0
2: 1
3: 78
4: 907
Right 1193806575 X:86002667-86002689 AGGCAGCCTGGCTGGGGGAGGGG 0: 3
1: 88
2: 344
3: 2466
4: 3393
1193806562_1193806573 5 Left 1193806562 X:86002637-86002659 CCCTTTCCTAACCAAGGGAGAAC 0: 1
1: 0
2: 1
3: 78
4: 907
Right 1193806573 X:86002665-86002687 GGAGGCAGCCTGGCTGGGGGAGG 0: 3
1: 76
2: 330
3: 2402
4: 3545
1193806562_1193806570 0 Left 1193806562 X:86002637-86002659 CCCTTTCCTAACCAAGGGAGAAC 0: 1
1: 0
2: 1
3: 78
4: 907
Right 1193806570 X:86002660-86002682 TGCGAGGAGGCAGCCTGGCTGGG 0: 2
1: 34
2: 124
3: 418
4: 2738
1193806562_1193806568 -5 Left 1193806562 X:86002637-86002659 CCCTTTCCTAACCAAGGGAGAAC 0: 1
1: 0
2: 1
3: 78
4: 907
Right 1193806568 X:86002655-86002677 AGAACTGCGAGGAGGCAGCCTGG 0: 1
1: 0
2: 18
3: 132
4: 860
1193806562_1193806569 -1 Left 1193806562 X:86002637-86002659 CCCTTTCCTAACCAAGGGAGAAC 0: 1
1: 0
2: 1
3: 78
4: 907
Right 1193806569 X:86002659-86002681 CTGCGAGGAGGCAGCCTGGCTGG 0: 2
1: 34
2: 146
3: 483
4: 2727
1193806562_1193806572 2 Left 1193806562 X:86002637-86002659 CCCTTTCCTAACCAAGGGAGAAC 0: 1
1: 0
2: 1
3: 78
4: 907
Right 1193806572 X:86002662-86002684 CGAGGAGGCAGCCTGGCTGGGGG 0: 2
1: 30
2: 111
3: 384
4: 2847

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193806562 Original CRISPR GTTCTCCCTTGGTTAGGAAA GGG (reversed) Intronic
902965231 1:19996136-19996158 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
904447295 1:30585515-30585537 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
904671267 1:32167580-32167602 GTTCTCTGTTGGATAAGAAAAGG - Intronic
905051788 1:35058195-35058217 GGCTTCCCTTTGTTAGGAAAGGG + Intergenic
905355503 1:37380973-37380995 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
905843409 1:41205277-41205299 GGCCTCCCTTGGCTAGGAAAGGG - Intronic
905897101 1:41555404-41555426 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
906008656 1:42502379-42502401 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
906571601 1:46846356-46846378 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
906579617 1:46925629-46925651 GGCTTCCCTTGGTTGGGAAATGG + Intergenic
906585720 1:46976182-46976204 GGCTTCCCTTGGCTAGGAAAAGG - Intergenic
906604105 1:47153258-47153280 GGCTTCCCTTGGTTGGGAAAGGG - Intergenic
906714449 1:47956445-47956467 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
906753611 1:48288585-48288607 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
907231652 1:53004863-53004885 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
907857850 1:58321496-58321518 GGCTTCCCTTGGCTAGGAAAAGG - Intronic
908576737 1:65467947-65467969 GGTTTCCCTTGGCTAGGAAAGGG + Intronic
908937696 1:69395367-69395389 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
909261297 1:73492067-73492089 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
909397012 1:75181606-75181628 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
909557409 1:76969254-76969276 GGATTCCCTTGGTTAGGAAAGGG - Intronic
909558345 1:76981225-76981247 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
910281708 1:85508555-85508577 GGCTTCCCTTGGCTAGGAAATGG - Intronic
910318852 1:85921169-85921191 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
910383569 1:86657653-86657675 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
910618862 1:89230693-89230715 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
910709726 1:90167067-90167089 CCTTTCCCTTGGCTAGGAAAGGG - Intergenic
910829104 1:91442025-91442047 AGCCTCCCTTGGCTAGGAAAGGG - Intergenic
910924944 1:92388604-92388626 GGCTTCCCTTGGCTAGGAAAGGG - Exonic
910930281 1:92436667-92436689 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
910956849 1:92715695-92715717 TGCTTCCCTTGGTTAGGAAAGGG - Intronic
911399543 1:97358036-97358058 GGCATCCCTTGGCTAGGAAAGGG - Intronic
911541995 1:99167702-99167724 CATTTCCCTTGGTTAGGAATAGG - Intergenic
911670691 1:100604172-100604194 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
911689782 1:100820167-100820189 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
911700810 1:100949921-100949943 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
912225747 1:107732447-107732469 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
912463188 1:109851271-109851293 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
912636168 1:111295795-111295817 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
912886397 1:113479156-113479178 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
913033091 1:114932641-114932663 GGCTTCTCTTGGTTAGGAAAGGG - Intronic
913102801 1:115584754-115584776 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
913358280 1:117948278-117948300 GTGATCCATTGCTTAGGAAATGG - Intronic
913363153 1:118004721-118004743 GGTTTCCCTTGGCTAGGAAAGGG + Intronic
913473612 1:119215320-119215342 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
913710398 1:121477350-121477372 TCCCTCCCTTGGCTAGGAAAGGG - Intergenic
914352920 1:146855839-146855861 GTTTTCACTTGGTTAGGCAAAGG + Intergenic
914683494 1:149957937-149957959 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
915125699 1:153662360-153662382 CTTCCCCCTTGGGTAGGAAAAGG + Exonic
915576962 1:156785790-156785812 TTTCTCCCTTGGTCAGGGGAAGG + Intronic
915806990 1:158864529-158864551 GGTTTCCCTTGGCTAGAAAAGGG - Intergenic
916379634 1:164195511-164195533 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
916469544 1:165109475-165109497 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
916534457 1:165690597-165690619 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
916645926 1:166785067-166785089 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
916742576 1:167659445-167659467 GTTTTCCCTTAGTTAAAAAAGGG + Intronic
917181410 1:172302105-172302127 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
917192391 1:172431824-172431846 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
917308820 1:173656012-173656034 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
917323861 1:173811900-173811922 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
917391836 1:174545505-174545527 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
917573702 1:176297002-176297024 GACTTCCCTTGGCTAGGAAAGGG + Intergenic
917743655 1:177986235-177986257 GGCTTCCTTTGGTTAGGAAAGGG - Intergenic
917764174 1:178199211-178199233 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
917827376 1:178837767-178837789 ACCTTCCCTTGGTTAGGAAAGGG - Intronic
917900824 1:179541238-179541260 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
917914716 1:179689955-179689977 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
918616610 1:186551218-186551240 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
918968251 1:191378716-191378738 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
919065526 1:192688630-192688652 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
919338719 1:196274878-196274900 TTTGTCCTTTGGTTAAGAAAAGG - Intronic
919377996 1:196817841-196817863 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
919387682 1:196941878-196941900 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
919436749 1:197572151-197572173 GATTTCCCTTGGCTAGGAAAGGG - Intronic
919603142 1:199647551-199647573 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
920643390 1:207776281-207776303 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
920993177 1:210959815-210959837 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
921943173 1:220864170-220864192 GTCTTCCCTTGGCTAGGAACGGG + Intergenic
921981479 1:221263391-221263413 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
923444471 1:234055558-234055580 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
923947098 1:238900356-238900378 GCCTTCCCTTGGCTAGGAAAGGG - Intergenic
1064430995 10:15269729-15269751 GCTCTCCATTGGAGAGGAAAGGG + Intronic
1064829526 10:19446188-19446210 GGCTTCCCTTGGCTAGGAAATGG + Intronic
1065081220 10:22131224-22131246 AGTTTCCCTTGGCTAGGAAAGGG + Intergenic
1065199444 10:23299318-23299340 GTACTGCCTTTGGTAGGAAAAGG + Intronic
1065799097 10:29334860-29334882 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1065886727 10:30084540-30084562 ATTCTCCCTTACTTAGGACAAGG - Intronic
1067172600 10:43920670-43920692 GGCTTCCCTTGGCTAGGAAACGG + Intergenic
1067193326 10:44091126-44091148 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1067335422 10:45358959-45358981 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1068169051 10:53370325-53370347 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1068210080 10:53909741-53909763 GACTTCCCTTGGCTAGGAAAGGG - Intronic
1068239617 10:54288598-54288620 ATCTTCCCTTGGCTAGGAAAGGG - Intronic
1068495322 10:57779056-57779078 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1068534783 10:58229895-58229917 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1068552635 10:58423631-58423653 GGTTTCCCTTTGCTAGGAAAGGG + Intergenic
1068609554 10:59043760-59043782 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1068651576 10:59528406-59528428 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1069199329 10:65593001-65593023 GGCTTCCCTTGGCTAGGAAAAGG + Intergenic
1069227214 10:65959294-65959316 ATCTTCCCTTGGCTAGGAAAGGG + Intronic
1069259904 10:66382166-66382188 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1069734582 10:70645391-70645413 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1070007150 10:72435626-72435648 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1070217679 10:74403649-74403671 GGCTTCCCTTGGCTAGGAAATGG + Intronic
1071790922 10:88953134-88953156 GTTCTCAGTTTATTAGGAAATGG - Intronic
1071824953 10:89316306-89316328 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1071978941 10:90984087-90984109 GCTCTGCCTTGGTGAGGAGAGGG + Intergenic
1072244950 10:93535186-93535208 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1072380028 10:94858432-94858454 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1072477637 10:95778053-95778075 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1072775094 10:98182947-98182969 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1072929239 10:99646461-99646483 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1073745843 10:106467439-106467461 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1073940630 10:108693946-108693968 GGCTTCCCTTGGTTAGGAAAGGG - Intergenic
1073998151 10:109339540-109339562 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1074017112 10:109545547-109545569 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1074017265 10:109546505-109546527 GACTTCCCTTGGTTAGGAAAGGG - Intergenic
1074117840 10:110470945-110470967 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1075805381 10:125184891-125184913 GGCTTCCCTTGGTTAGGAAAGGG + Intergenic
1076159221 10:128229489-128229511 GGTATCCCTTGGCTAGGAAAGGG + Intergenic
1076397833 10:130154242-130154264 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1076590983 10:131581879-131581901 AGTTTCCCTTGGTGAGGAAAGGG + Intergenic
1078119293 11:8490152-8490174 AGTTTCCCTTGGCTAGGAAAGGG - Intronic
1078321594 11:10339831-10339853 GGCTTCCCTTGGCTAGGAAAAGG - Intronic
1078482603 11:11691753-11691775 GGCATCCCTTGGCTAGGAAAGGG - Intergenic
1078560385 11:12366171-12366193 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1078726797 11:13939264-13939286 AGTTTCCCTTGGCTAGGAAAGGG + Intergenic
1078793560 11:14569449-14569471 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1078796826 11:14600650-14600672 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1079232276 11:18659016-18659038 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1079463726 11:20708246-20708268 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1079682917 11:23321192-23321214 GTCTTCCCTTGGCTAGGAAAGGG - Intergenic
1079957456 11:26882407-26882429 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1080031433 11:27665506-27665528 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1080482651 11:32667563-32667585 CAGCTCCCTTGGCTAGGAAAGGG + Intronic
1080490847 11:32762838-32762860 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1080736616 11:35022178-35022200 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1080818216 11:35779347-35779369 GTCTTCCCTTGGCTAGGAAAGGG + Intronic
1080867601 11:36209286-36209308 GTTGTTCTGTGGTTAGGAAAGGG + Intronic
1080917364 11:36673627-36673649 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1081143849 11:39536714-39536736 GCCTTCCCTTGGCTAGGAAAGGG + Intergenic
1081587438 11:44397067-44397089 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1081768224 11:45627799-45627821 AGTTTCCCTTGGCTAGGAAAGGG - Intergenic
1082029231 11:47592965-47592987 GGTGTCCCTTGGTTAGGACAGGG + Intronic
1082613864 11:55335189-55335211 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1082945088 11:58749845-58749867 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1083008567 11:59372241-59372263 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1086117292 11:83266341-83266363 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1086307341 11:85496135-85496157 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1086442047 11:86838018-86838040 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1086456898 11:86968000-86968022 GGCTTCCCTTGGTTAGGAAAGGG + Intergenic
1086494337 11:87386732-87386754 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1086506319 11:87508157-87508179 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1086812060 11:91322207-91322229 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1086979533 11:93178299-93178321 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1087243395 11:95806461-95806483 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1087311122 11:96545216-96545238 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1087482436 11:98718385-98718407 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1088004673 11:104926244-104926266 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1088152198 11:106758405-106758427 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1088309071 11:108441060-108441082 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1089192825 11:116666927-116666949 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1090216333 11:124968564-124968586 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1090322262 11:125857570-125857592 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1090756139 11:129793620-129793642 ATTCTGCTTTGGTTAGGATATGG + Intergenic
1091309103 11:134560321-134560343 CTTCTTCCTTGGTGAGGAGACGG + Intergenic
1091421292 12:343010-343032 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1091687630 12:2574888-2574910 GTTCTCCTTTGGTATGGGAATGG + Intronic
1091867231 12:3851344-3851366 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1092562701 12:9633172-9633194 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1092661951 12:10748143-10748165 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1092711299 12:11340325-11340347 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1093085964 12:14867254-14867276 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1093672917 12:21899550-21899572 AGCCTCCCTTGGCTAGGAAAGGG - Intronic
1093677609 12:21962412-21962434 GGCTTCCCTTGGTTAGGAAAGGG - Intergenic
1093802293 12:23388906-23388928 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1093900453 12:24625528-24625550 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1093992914 12:25610246-25610268 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1093998247 12:25665861-25665883 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1094430783 12:30367263-30367285 ATCTTCCCTTGGCTAGGAAAGGG + Intergenic
1094759946 12:33520951-33520973 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1094791554 12:33920836-33920858 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1095140519 12:38657112-38657134 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1095186600 12:39207955-39207977 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1095720182 12:45392086-45392108 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1095802567 12:46283721-46283743 GGGTTCCCTTGGCTAGGAAAGGG - Intergenic
1096030566 12:48410344-48410366 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1097301397 12:58023059-58023081 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1097364906 12:58701539-58701561 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1097365751 12:58710277-58710299 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1097749565 12:63337095-63337117 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1097774963 12:63634521-63634543 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1097912191 12:64982269-64982291 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1098696997 12:73572317-73572339 GGTTTCCCTTGGCTAGGAGAGGG - Intergenic
1099216622 12:79861546-79861568 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1099434119 12:82623354-82623376 GTTCTTCCTTGGGGAGGAACTGG - Intergenic
1099740348 12:86626954-86626976 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1099779109 12:87171613-87171635 GGCTTCCCTTGGCTAGGAAACGG - Intergenic
1099965498 12:89440854-89440876 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1100463410 12:94823024-94823046 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1100505162 12:95212840-95212862 ATTCTTCCTTGGTTGGTAAAAGG - Intronic
1100737433 12:97552468-97552490 TTTCTCCCTTGATTGGGAATTGG + Intergenic
1100748627 12:97672788-97672810 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1100907820 12:99321606-99321628 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1100965713 12:100010963-100010985 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1100981905 12:100168673-100168695 GTTCTGTGTTGGTTAGGCAAGGG - Intergenic
1101175272 12:102143387-102143409 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1101301739 12:103489858-103489880 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1101628642 12:106471373-106471395 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1101636961 12:106551823-106551845 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1103032587 12:117629109-117629131 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1103154703 12:118674509-118674531 GGTTTCCCTTGGCTAGGAAAGGG + Intergenic
1103203647 12:119110727-119110749 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1103255461 12:119538324-119538346 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1104495136 12:129230175-129230197 GTTCTTCCTTTCTCAGGAAAGGG - Intronic
1105070313 12:133230519-133230541 GCTCTCCACTGGTCAGGAAAGGG - Intronic
1105255115 13:18739244-18739266 GTTTTCCCCTGGTTAGGCAATGG - Intergenic
1105283471 13:18983965-18983987 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1105915333 13:24910196-24910218 TTTTTCCCTTTATTAGGAAATGG + Intronic
1106457632 13:29941132-29941154 ATTTACCCTTTGTTAGGAAATGG - Intergenic
1106640982 13:31584391-31584413 TGCTTCCCTTGGTTAGGAAAGGG + Intergenic
1106980169 13:35270563-35270585 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1107380725 13:39854178-39854200 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1108170314 13:47734994-47735016 GGCTTCCCTTGGCTAGGAAACGG - Intergenic
1108217660 13:48200965-48200987 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1108308601 13:49163541-49163563 GGCTTCCCTTGGCTAGGAAAAGG + Intronic
1108810592 13:54219196-54219218 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1108988734 13:56628910-56628932 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1109165202 13:59025779-59025801 TTTATCCCTTTCTTAGGAAAAGG + Intergenic
1109385953 13:61629227-61629249 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1109566424 13:64121378-64121400 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1109669395 13:65585380-65585402 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1109806613 13:67452485-67452507 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1109816200 13:67588552-67588574 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1110510259 13:76342511-76342533 GGCCTCCCTTGGCTAGGAAAGGG - Intergenic
1110699099 13:78526276-78526298 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1110729695 13:78866093-78866115 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1110767785 13:79300266-79300288 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1111932598 13:94526856-94526878 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1112087448 13:96046708-96046730 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1112131126 13:96524764-96524786 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1112232358 13:97602078-97602100 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1112363100 13:98734521-98734543 GTCTTCCCTTGGCTAGGAAAGGG - Intronic
1113276957 13:108741035-108741057 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1113300959 13:109018728-109018750 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1113348815 13:109508214-109508236 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1114240239 14:20860337-20860359 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1114677549 14:24453811-24453833 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1114784991 14:25586108-25586130 GTCTTCCCTTGGCTGGGAAAGGG + Intergenic
1114964340 14:27939168-27939190 GGCTTCCCTTGGTTAGGAAAGGG - Intergenic
1115116750 14:29889461-29889483 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1115123162 14:29961272-29961294 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1115294686 14:31812543-31812565 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1115440101 14:33424659-33424681 ATTCTCCCTTGGACAGCAAAGGG + Intronic
1115711296 14:36054158-36054180 CTTCCCCCTTGGGTAGGAAAGGG + Intergenic
1115717724 14:36124329-36124351 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1115774419 14:36699855-36699877 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1115869757 14:37786527-37786549 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1116052868 14:39825933-39825955 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1116212738 14:41968715-41968737 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1116482761 14:45411615-45411637 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1116727266 14:48576159-48576181 GGCTTCCCTTGGTTAGGAAAGGG + Intergenic
1116792708 14:49356803-49356825 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1117005712 14:51419087-51419109 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1117123712 14:52596731-52596753 GGCTTCCCTTGCTTAGGAAAGGG + Intronic
1117170013 14:53084860-53084882 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1117261044 14:54033603-54033625 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1117489149 14:56228838-56228860 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1117811454 14:59551708-59551730 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1117856803 14:60042651-60042673 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1117900660 14:60529198-60529220 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1117952626 14:61098168-61098190 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1118450026 14:65892262-65892284 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1118559911 14:67067862-67067884 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1118621986 14:67621752-67621774 GTTCTCCCTTACTATGGAAATGG - Intronic
1118829986 14:69421912-69421934 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1119930595 14:78542596-78542618 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1120742963 14:88128132-88128154 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1121214039 14:92233342-92233364 GGCTTCCCTTGGTTCGGAAAGGG + Intergenic
1122443388 14:101750159-101750181 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1122940970 14:104981224-104981246 GTCCTCCCCTGGCTAAGAAATGG + Intergenic
1124918014 15:33995916-33995938 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1124935476 15:34166171-34166193 GTATTCCCTTGGCTAGGAAAGGG - Intronic
1124948435 15:34292922-34292944 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1125779528 15:42252155-42252177 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1125957919 15:43803459-43803481 CTTCTCTCTAGGATAGGAAATGG - Intergenic
1126239461 15:46425148-46425170 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1126385522 15:48089551-48089573 GTTCTTCCCTGGTTAGGGCAGGG - Intergenic
1126412046 15:48382258-48382280 GTCCTTCCTTGGTTTGGAAATGG - Intergenic
1126476296 15:49068761-49068783 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1126595530 15:50380922-50380944 GTAGTCCAGTGGTTAGGAAAAGG + Intergenic
1127253905 15:57271497-57271519 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1127339520 15:58026603-58026625 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1127452621 15:59131538-59131560 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1127525051 15:59784591-59784613 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1127583424 15:60358676-60358698 ATTCTCCCCTTGTTAGCAAAAGG + Intronic
1128339867 15:66813907-66813929 GGCTTCCCTTGGGTAGGAAAGGG + Intergenic
1130858769 15:87867048-87867070 CTTCTGGCTTGGTTAGGAAAGGG - Intronic
1131183272 15:90254983-90255005 GATATCCCTTGGTTAGGACATGG + Intronic
1131323384 15:91420002-91420024 GTACTGCCTTGGGTAGGAACTGG + Intergenic
1133848219 16:9476992-9477014 GTTTTCCCTTGGTTACCAGATGG + Intergenic
1134221516 16:12358539-12358561 GTCCTGCCTTGGGTAGAAAAAGG - Intronic
1135301792 16:21334950-21334972 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1136600588 16:31284627-31284649 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1137335747 16:47547013-47547035 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1137370087 16:47897053-47897075 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1137461540 16:48668549-48668571 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1137471036 16:48758896-48758918 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1137525095 16:49228308-49228330 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1137907037 16:52333632-52333654 GTCTTCCCTTGGCTAGGAAAGGG - Intergenic
1138260344 16:55615652-55615674 GACTTCCCTTGGCTAGGAAAGGG - Intergenic
1138692917 16:58785759-58785781 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1138702530 16:58879026-58879048 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1138734014 16:59229876-59229898 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1139105228 16:63819902-63819924 GGCTTCCCTTGGCTAGGAAAAGG - Intergenic
1139981105 16:70859679-70859701 GTTTTTACTTGGTTAGGCAAAGG - Intronic
1140054175 16:71511084-71511106 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1140147397 16:72324593-72324615 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1140454193 16:75095270-75095292 GTTGTCCCCTGGGGAGGAAAGGG - Intronic
1140695118 16:77525179-77525201 GACTTCCCTTGGGTAGGAAAGGG - Intergenic
1141799714 16:86298497-86298519 GATATCCCCTGGTGAGGAAAGGG - Intergenic
1142220404 16:88851594-88851616 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1144294001 17:13855699-13855721 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1145396790 17:22502834-22502856 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1145738311 17:27249418-27249440 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1146145520 17:30412787-30412809 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1149079910 17:52642950-52642972 GTTGTCCCTTCGTTAGTATAAGG - Intergenic
1149133722 17:53340096-53340118 GGCTTCCCTTGGTTAGGAAAGGG - Intergenic
1149197006 17:54133087-54133109 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1149240108 17:54639402-54639424 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1149723482 17:58868724-58868746 TTTCTTCCTTGGTTAGGGTATGG + Intronic
1149990580 17:61381143-61381165 GTCCTCCCGTGGGTAGGAAGGGG - Intronic
1150094079 17:62357159-62357181 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1153419326 18:4886426-4886448 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1154401607 18:14043489-14043511 GGCTTCCCTTGGCTAGGAAAAGG + Intergenic
1154435907 18:14341358-14341380 GTTTTCCCCTGGTTAGGCAATGG + Intergenic
1155562501 18:27093652-27093674 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1155796708 18:30047406-30047428 GGTTTCGCTTGGTTAGGAAGCGG - Intergenic
1155967517 18:32049844-32049866 TTTACCCCATGGTTAGGAAAAGG + Intronic
1156421597 18:36960043-36960065 GGCTTCCCTTGGCTAGGAAACGG - Intronic
1156434436 18:37111761-37111783 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1156443879 18:37219736-37219758 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1157036725 18:43984194-43984216 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1157061746 18:44300098-44300120 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1157658845 18:49420751-49420773 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1157709497 18:49840450-49840472 CTTCTCCCTGGGTTAGTAAAAGG - Intronic
1157787964 18:50502990-50503012 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1158145745 18:54309995-54310017 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1162565745 19:11445218-11445240 GTTCTCCCCTGGTAAGGGCAGGG + Intronic
1162962371 19:14135909-14135931 GATCTCCGTGGGTTAAGAAATGG + Intronic
1163380211 19:16961249-16961271 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1164133209 19:22384847-22384869 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1164394782 19:27852907-27852929 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1165003787 19:32787848-32787870 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1166179645 19:41098743-41098765 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1166343325 19:42151211-42151233 ATGCTCCCTTTGTTAGGAAGGGG - Intronic
1168170568 19:54585701-54585723 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
926074765 2:9933081-9933103 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
926344175 2:11930542-11930564 GTTCTCCTTTGCTTTGCAAAAGG - Intergenic
926366617 2:12139385-12139407 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
926648545 2:15316457-15316479 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
926941772 2:18145059-18145081 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
927446981 2:23171756-23171778 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
927564055 2:24095344-24095366 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
928333300 2:30374318-30374340 TTTCTCCCTAGCTTGGGAAATGG - Intergenic
929025766 2:37600100-37600122 GTCTTCCCTTGGCTAGGAAAGGG + Intergenic
929958363 2:46477878-46477900 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
930143135 2:47973730-47973752 AGCCTCCCTTGGCTAGGAAAGGG - Intergenic
930223373 2:48767803-48767825 GACTTCCCTTGGCTAGGAAAGGG + Intronic
930274792 2:49298678-49298700 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
930467679 2:51774976-51774998 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
930893679 2:56421270-56421292 ATCTTCCCTTGGCTAGGAAAGGG - Intergenic
930908943 2:56606734-56606756 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
931016524 2:57987746-57987768 TATGTCCCTTGGCTAGGAAATGG + Intronic
931074809 2:58698769-58698791 GTCCTCCCTTGGTTTGGAGTGGG + Intergenic
931204690 2:60136114-60136136 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
931305143 2:61021254-61021276 GGCATCCCTTGGTTAGGAAAGGG - Intronic
931306530 2:61034542-61034564 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
931885781 2:66615534-66615556 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
931971215 2:67589139-67589161 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
931986212 2:67744874-67744896 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
932323918 2:70842406-70842428 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
932327985 2:70876102-70876124 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
932539941 2:72641297-72641319 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
933366753 2:81362874-81362896 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
933631291 2:84662342-84662364 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
933880402 2:86663893-86663915 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
934318341 2:91947480-91947502 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
934617048 2:95778681-95778703 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
934643845 2:96045878-96045900 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
934837262 2:97601972-97601994 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
935273964 2:101460152-101460174 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
936244766 2:110817027-110817049 CTTCTCCCTTAGCTACGAAAGGG + Intronic
936775374 2:115965928-115965950 GGCTTCCCTTGGGTAGGAAAGGG + Intergenic
936995446 2:118409493-118409515 GGCTTCCCTTGGGTAGGAAAGGG - Intergenic
937074876 2:119095947-119095969 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
937632876 2:124123140-124123162 GCCTTCCCTTGGTTATGAAAGGG - Intronic
937677728 2:124610033-124610055 GGTCTCCTTTGGGGAGGAAATGG + Intronic
938559411 2:132458039-132458061 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
939019957 2:136946892-136946914 GACTTCCCTTGGCTAGGAAAGGG + Intronic
939055528 2:137360449-137360471 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
939426624 2:142046834-142046856 TTTCTGCCTTGTTGAGGAAAGGG + Intronic
939426742 2:142048193-142048215 TTTCTGCCTTGTTGAGGAAAGGG + Intronic
939730810 2:145782604-145782626 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
940644466 2:156376163-156376185 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
940732016 2:157403470-157403492 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
940891651 2:159041693-159041715 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
940995816 2:160148685-160148707 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
941041485 2:160628491-160628513 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
941100152 2:161286395-161286417 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
941376463 2:164737307-164737329 CTGCTCCCCTGGTTGGGAAAGGG - Intronic
941523758 2:166581429-166581451 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
941532358 2:166686029-166686051 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
941896066 2:170630142-170630164 GGTTTCCCTTGGCTAGGAAAGGG - Intronic
942636548 2:178013117-178013139 GTTCTCACTTGGATCTGAAAAGG - Intronic
942668867 2:178352322-178352344 GGCTTCCCTCGGTTAGGAAATGG - Intronic
942779900 2:179629752-179629774 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
942790753 2:179757863-179757885 AGTTTCCCTTGGCTAGGAAAGGG + Intronic
942854817 2:180532497-180532519 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
942873553 2:180765310-180765332 GGCGTCCCTTGGCTAGGAAAGGG - Intergenic
942952014 2:181731858-181731880 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
943038489 2:182774756-182774778 GGTTTCCCTTGGCTAGGAAAGGG + Intronic
943088506 2:183346219-183346241 TTTCTCCCTTTGTCAGTAAATGG + Intergenic
943233585 2:185290054-185290076 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
943262900 2:185688294-185688316 AGCTTCCCTTGGTTAGGAAAGGG + Intergenic
943300045 2:186186806-186186828 GGCTTCCCTTGGCTAGGAAAAGG + Intergenic
943628435 2:190223994-190224016 GGTTTCCCTTGGCCAGGAAAGGG - Intronic
943930001 2:193836769-193836791 GGCTTCCCTAGGTTAGGAAAGGG + Intergenic
944165105 2:196710408-196710430 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
944521031 2:200566971-200566993 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
944600684 2:201300163-201300185 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
944613038 2:201430730-201430752 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
945116786 2:206415981-206416003 GACTTCCCTTGGCTAGGAAAGGG + Intergenic
945161897 2:206900139-206900161 GGCCTCCCTTGGCTAGGAAAGGG + Intergenic
945533802 2:210987257-210987279 GGCTTCCCTTGGTTAGGAACAGG + Intergenic
945677707 2:212875927-212875949 GTCTTCCCTTGGCTAGGAAAGGG - Intergenic
945706146 2:213234741-213234763 GTTTTCCCTTGGGAAGGGAAGGG - Intergenic
945776717 2:214114714-214114736 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
946696884 2:222368661-222368683 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
946719029 2:222584580-222584602 GGCATCCCTTGGCTAGGAAAGGG - Intronic
947483551 2:230525647-230525669 ATACTCCCTTGTCTAGGAAAGGG - Intronic
948025845 2:234775687-234775709 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1168767611 20:392388-392410 TTTCTCCGTTGGTAAGGAAAAGG + Intronic
1169012801 20:2264652-2264674 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1170176128 20:13471907-13471929 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1170342346 20:15343279-15343301 GGTTTCCTTTGGTTAGAAAAGGG - Intronic
1171050467 20:21853647-21853669 GTCTTCCCTTGGCTAGGAAAGGG - Intergenic
1172332961 20:34088652-34088674 GTTCTCACTTGCTGAGGATAAGG - Exonic
1172456318 20:35077166-35077188 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1173451433 20:43167681-43167703 TGTCTCCCTTGCTCAGGAAATGG + Intronic
1173543886 20:43877038-43877060 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1176657282 21:9598480-9598502 GAACTCCCATGGATAGGAAAGGG - Intergenic
1176716602 21:10355615-10355637 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1176841127 21:13844276-13844298 GTTTTCCCCTGGTTAGGCAACGG - Intergenic
1177111479 21:17034344-17034366 GGCTTCCCTTGGGTAGGAAAGGG - Intergenic
1179401363 21:41086973-41086995 GTTCTCTGTTGGAAAGGAAATGG - Intergenic
1180601734 22:17024321-17024343 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1180641025 22:17299545-17299567 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1181326987 22:22057508-22057530 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1182169176 22:28209376-28209398 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1182197015 22:28529149-28529171 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1182789787 22:32941688-32941710 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1184237513 22:43191485-43191507 GTTCTCTCTTATTTGGGAAATGG + Intergenic
949288074 3:2429970-2429992 GGCTTCCCTTGGTGAGGAAAGGG + Intronic
949456658 3:4246168-4246190 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
949532055 3:4965962-4965984 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
949632596 3:5944481-5944503 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
950701362 3:14751456-14751478 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
950862775 3:16164751-16164773 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
951012131 3:17693317-17693339 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
951183212 3:19682712-19682734 GACTTCCCTTGGCTAGGAAAGGG + Intergenic
951389192 3:22082286-22082308 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
951439541 3:22707287-22707309 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
951469129 3:23036340-23036362 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
951617723 3:24566947-24566969 GCCTTCCCTTGGCTAGGAAAGGG - Intergenic
951653745 3:24981693-24981715 AGCTTCCCTTGGTTAGGAAAGGG + Intergenic
952550592 3:34472139-34472161 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
952748780 3:36806897-36806919 GGTCTCCTTTGGATTGGAAAAGG - Intergenic
952814014 3:37431290-37431312 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
952863971 3:37839020-37839042 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
953112200 3:39953761-39953783 GGCTTCCCTTGGCTAGGAAAAGG - Intronic
953254633 3:41278027-41278049 GGCTTCCCTTGGGTAGGAAAGGG - Intronic
953515936 3:43591837-43591859 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
953553770 3:43925600-43925622 TTTCTCCCTTGGTTGGAAAATGG + Intergenic
953653143 3:44823921-44823943 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
954501016 3:51014073-51014095 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
955483034 3:59408577-59408599 GTTCTCCCTTTCTCAGGGAATGG + Intergenic
955667299 3:61364224-61364246 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
955895341 3:63694135-63694157 GGTTTCCCTTGGCTAGGAAAGGG - Intergenic
956065128 3:65389863-65389885 TTTCTCCCTTGAGGAGGAAAAGG + Intronic
956093087 3:65688482-65688504 CTTCCCCCTTGGGTAGGAAAGGG - Intronic
956139984 3:66136879-66136901 GCTCTCTCTTTGTTATGAAAGGG - Intronic
956360742 3:68443973-68443995 GATCTCACTTTGTTAGGAAATGG - Intronic
956477423 3:69637254-69637276 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
956862490 3:73338764-73338786 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
956993274 3:74794347-74794369 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
957140849 3:76354310-76354332 GTTCTCCTTAATTTAGGAAAAGG - Intronic
957811624 3:85229363-85229385 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
958191775 3:90193532-90193554 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
958413989 3:93852668-93852690 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
959059799 3:101605716-101605738 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
959097439 3:101971331-101971353 GGCTTCCCTTGGTTAGGAAAGGG + Intergenic
959815766 3:110671644-110671666 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
960188091 3:114669077-114669099 GTTCTCCCCTGGTGGGGAAGGGG - Intronic
960230922 3:115226378-115226400 TTTTTCCCTTGGTTAGCAAATGG + Intergenic
960565786 3:119130292-119130314 GGATTCCCTTGGCTAGGAAAGGG - Intronic
960653900 3:119981431-119981453 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
960655907 3:120003981-120004003 GCCTTCCCTTGGGTAGGAAAGGG - Intronic
960836085 3:121908290-121908312 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
960911227 3:122651168-122651190 GGCTTCCCTTGGCTAGGAAATGG - Intergenic
961992023 3:131202330-131202352 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
962049408 3:131796952-131796974 GTTCTCTCTTTCTTTGGAAAGGG + Intronic
962180392 3:133200168-133200190 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
962232892 3:133681440-133681462 GGCTTCCCTTGGCTAGGAAAAGG - Intergenic
962513460 3:136126207-136126229 GGCTTCCCTTGGTTAGGAAAGGG - Intronic
962602825 3:137007695-137007717 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
962624442 3:137211238-137211260 GGCTTCCCTTGGTTAGGAAAGGG - Intergenic
962645091 3:137430713-137430735 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
962834181 3:139172375-139172397 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
962914124 3:139883350-139883372 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
963031999 3:140987798-140987820 GGTTTCCCTTGGCTAGGAAAGGG - Intergenic
963109018 3:141670134-141670156 GGCTTCCCTTGGTTAGGAAAGGG - Intergenic
963306829 3:143662538-143662560 GGCTTCCCTTGGGTAGGAAAGGG - Intronic
963531505 3:146477320-146477342 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
963714436 3:148786542-148786564 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
963816240 3:149834468-149834490 GTCCTCCTATGGTTTGGAAATGG + Intronic
963984462 3:151575633-151575655 GTCTTCCCTTGGCTAGGAAAGGG + Intergenic
964264129 3:154875059-154875081 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
964269997 3:154945369-154945391 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
964701729 3:159575011-159575033 GGCTTCCCTTGGCTAGGAAAAGG + Intronic
965161624 3:165140279-165140301 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
965221374 3:165931308-165931330 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
965651554 3:170938832-170938854 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
965781603 3:172292120-172292142 GGTTTCCCTTGTTTAGGCAATGG - Intronic
965973313 3:174589278-174589300 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
966150361 3:176861516-176861538 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
966494099 3:180560133-180560155 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
967199324 3:187058203-187058225 GACTTCCCTTGGCTAGGAAAGGG + Intronic
967248462 3:187512922-187512944 GGTTTCCCTTGGCTAGGAAAGGG - Intergenic
968155933 3:196380717-196380739 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
968275070 3:197434990-197435012 GTCCTCCCTTGGGGAGGAGATGG + Intergenic
970496243 4:16628838-16628860 GGCTTCCCTTGGATAGGAAAGGG - Intronic
970655416 4:18225278-18225300 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
970775397 4:19668783-19668805 GGTTTCTCTTGGCTAGGAAAGGG - Intergenic
970982951 4:22123259-22123281 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
971467179 4:26976155-26976177 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
971560723 4:28077171-28077193 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
972685580 4:41349669-41349691 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
972965353 4:44502324-44502346 GGCTTCCCTTGGCTAGGAAAAGG + Intergenic
973198341 4:47471816-47471838 GTGATCTCTTGGTTAGTAAAAGG - Intergenic
973237679 4:47922963-47922985 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
973312928 4:48728956-48728978 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
973592665 4:52458469-52458491 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
973598959 4:52522085-52522107 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
973629037 4:52801861-52801883 GGCCTCCCTTGGCTGGGAAAGGG - Intergenic
973874712 4:55206129-55206151 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
973883516 4:55297363-55297385 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
974127495 4:57714324-57714346 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
974176504 4:58332492-58332514 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
974254199 4:59428727-59428749 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
974287780 4:59892188-59892210 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
974470175 4:62309486-62309508 GACTTCCCTTGGCTAGGAAAGGG - Intergenic
974654302 4:64799691-64799713 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
974871728 4:67652760-67652782 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
975064336 4:70041816-70041838 GGTTTCTCTTGGCTAGGAAAGGG + Intergenic
975094131 4:70437631-70437653 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
975203241 4:71615999-71616021 GTCTTCCCTTAGCTAGGAAAGGG - Intergenic
975232143 4:71947805-71947827 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
975247960 4:72142338-72142360 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
975305841 4:72847872-72847894 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
975309322 4:72884640-72884662 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
975503203 4:75110060-75110082 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
975727189 4:77303496-77303518 GGCTTCCCTTGGCTAGGAAAAGG + Intronic
975807310 4:78126309-78126331 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
975844051 4:78506659-78506681 GGCTTCCCTTGGCTAGGAAAAGG + Intronic
976462769 4:85331851-85331873 GTTATTCCTTGGTTGTGAAATGG - Intergenic
976477966 4:85506653-85506675 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
976760053 4:88539155-88539177 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
976969497 4:91088015-91088037 GATCTCACTTGCTTAAGAAATGG + Intronic
976974933 4:91154412-91154434 GGCTTCCCTTGGTTTGGAAAGGG + Intronic
976993933 4:91405778-91405800 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
977288681 4:95139836-95139858 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
977511195 4:97965075-97965097 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
977714715 4:100168915-100168937 GCTCTACCTTGGTTGGGAATAGG + Intergenic
977905956 4:102478125-102478147 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
977946446 4:102919643-102919665 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
978205336 4:106074022-106074044 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
978464514 4:108994190-108994212 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
978705593 4:111705983-111706005 TTTCTCCATTTGTTAGGTAATGG - Intergenic
979023061 4:115527038-115527060 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
979272892 4:118783012-118783034 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
979487480 4:121285019-121285041 GGGTTCCCTTGGCTAGGAAAGGG - Intergenic
979510725 4:121550589-121550611 AGTTTCCCTTGGCTAGGAAAGGG + Intergenic
979928152 4:126593989-126594011 GTTTTCCAGTGGTTAGGAAGAGG + Intergenic
979934027 4:126669954-126669976 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
980558751 4:134443054-134443076 GGTTTCCCTTGGCTAGGAAAGGG + Intergenic
980594033 4:134928974-134928996 GGCTTCCCTTGGTTAGGAAAAGG + Intergenic
980803533 4:137783865-137783887 AGGCTCCCTTGGCTAGGAAAGGG - Intergenic
981131514 4:141162713-141162735 GCTTTTCCTTGGCTAGGAAATGG - Intronic
981512658 4:145574553-145574575 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
981560969 4:146048211-146048233 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
981655901 4:147112164-147112186 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
982320337 4:154070751-154070773 TTTCTCCCATGGCTAGGACAAGG + Intergenic
982323805 4:154108690-154108712 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
982759086 4:159259544-159259566 GTCATCCCTTTGTTATGAAATGG - Intronic
982785704 4:159533961-159533983 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
983334551 4:166375172-166375194 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
983594278 4:169448891-169448913 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
983677786 4:170316619-170316641 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
983694454 4:170510994-170511016 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
983727683 4:170949225-170949247 TTACTCCCTGGCTTAGGAAATGG + Intergenic
984434058 4:179685584-179685606 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
985418143 4:189757649-189757671 GAACTCCCATGGATAGGAAAGGG + Intergenic
985473817 5:66036-66058 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
986127120 5:4893481-4893503 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
986323100 5:6649665-6649687 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
986653733 5:9990059-9990081 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
986653838 5:9990959-9990981 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
987014295 5:13801509-13801531 ATTCAACCTTGGTTAGGAAGTGG - Intronic
987279758 5:16400856-16400878 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
988668286 5:33354065-33354087 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
988687591 5:33540042-33540064 GGCTTCCCTTGGATAGGAAAGGG - Intronic
989337511 5:40336113-40336135 GTCTTCCCTTGGCTAGGAAAGGG - Intergenic
989345317 5:40423120-40423142 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
989358099 5:40567295-40567317 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
989418212 5:41205460-41205482 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
989622964 5:43402750-43402772 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
989670258 5:43908908-43908930 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
989678440 5:44001493-44001515 TTTCCCCCTTAATTAGGAAAAGG - Intergenic
989768794 5:45117699-45117721 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
989966473 5:50471146-50471168 CCCCTCCCTTGGCTAGGAAAGGG + Intergenic
990164150 5:52976515-52976537 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
990230327 5:53706087-53706109 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
990713078 5:58606133-58606155 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
990898894 5:60729054-60729076 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
991151437 5:63375900-63375922 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
991200035 5:63980812-63980834 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
991243483 5:64484902-64484924 GGCTTCCCTTGGCTAGGAAAAGG + Intergenic
991364325 5:65852842-65852864 GGTTTCCCTTAGCTAGGAAAGGG + Intronic
991425065 5:66482262-66482284 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
991575824 5:68102439-68102461 GTCTTCCCTTGGCTAGGAAATGG - Intergenic
992136135 5:73748119-73748141 GTTCTTCCTTTTTTAGGAAATGG + Intronic
992274694 5:75102833-75102855 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
992276880 5:75129870-75129892 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
992604453 5:78441110-78441132 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
992756452 5:79911204-79911226 GGCTTCCCTTGATTAGGAAAGGG - Intergenic
992873463 5:81028888-81028910 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
993044118 5:82847949-82847971 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
993052707 5:82944269-82944291 AGTTTCCCTTGGCTAGGAAAGGG - Intergenic
993244249 5:85431694-85431716 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
993345605 5:86778375-86778397 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
993578959 5:89635839-89635861 GCCTTCCCTTGGCTAGGAAAGGG + Intergenic
993888257 5:93442280-93442302 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
993948040 5:94138356-94138378 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
993984636 5:94583240-94583262 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
994039653 5:95244414-95244436 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
994160302 5:96549627-96549649 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
994586553 5:101716183-101716205 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
994924902 5:106102242-106102264 TTTTTCCCTTGGTGAGGGAAAGG - Intergenic
995179193 5:109214401-109214423 GAATTCCCTTGGCTAGGAAAGGG + Intergenic
995179199 5:109214423-109214445 GAATTCCCTTGGCTAGGAAAGGG + Intergenic
995270761 5:110217409-110217431 AGCTTCCCTTGGTTAGGAAAAGG + Intergenic
995459740 5:112390281-112390303 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
995670576 5:114598246-114598268 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
995690405 5:114819184-114819206 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
995749817 5:115442117-115442139 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
996147333 5:119992066-119992088 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
996477843 5:123941604-123941626 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
996520760 5:124423358-124423380 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
996588805 5:125121947-125121969 TTCCTACCTTGGTCAGGAAATGG + Intergenic
997187707 5:131898834-131898856 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
997245994 5:132349678-132349700 GGCTTCCCTTGGCTAGGAAAAGG + Intergenic
997927283 5:138042395-138042417 CTTCCCCCTAGGTTAAGAAATGG - Intronic
998835636 5:146200633-146200655 ACTCTCCCTTGGTTGGGAAGGGG + Intergenic
999111230 5:149123153-149123175 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
999176702 5:149636869-149636891 GTTCTCCCAGGGTTGGTAAAAGG + Intergenic
999312754 5:150562358-150562380 GTTCTCCCTTGGGAAGGAATAGG + Intergenic
999559721 5:152787813-152787835 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
999594666 5:153189503-153189525 GTTGTCTCTTGGTTACAAAATGG - Intergenic
1000033580 5:157424560-157424582 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1000068943 5:157721151-157721173 GACTTCCCTTGGCTAGGAAAGGG - Intergenic
1000214267 5:159139756-159139778 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1000412348 5:160946988-160947010 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1000591588 5:163165259-163165281 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1000595658 5:163212192-163212214 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1001009267 5:168083353-168083375 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1001347816 5:170922727-170922749 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1002673127 5:180886327-180886349 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1003228607 6:4229093-4229115 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1003316846 6:5020580-5020602 GGCTTCCCTTGGTTAGGAAAGGG + Intergenic
1003496536 6:6668363-6668385 GGTTTCCCTTGGCTAGGAAAGGG - Intergenic
1003763838 6:9213696-9213718 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1003819679 6:9882539-9882561 AGCTTCCCTTGGTTAGGAAAGGG - Intronic
1003970987 6:11299074-11299096 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1004831513 6:19481967-19481989 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1005558108 6:27008605-27008627 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1005935939 6:30521012-30521034 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1006041559 6:31260407-31260429 GTTTTCCCTTGGCTAGGAAAGGG + Intergenic
1007166494 6:39832150-39832172 CAGCTCCCTTGGTGAGGAAAGGG + Intronic
1007988404 6:46230678-46230700 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1008474632 6:51922849-51922871 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1008633133 6:53382936-53382958 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1009457978 6:63878878-63878900 GGCCTCCCTTGGCTAGGAAAGGG + Intronic
1009797778 6:68494670-68494692 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1009880435 6:69560352-69560374 GGCTTCCCTTGGTTAGGGAAAGG - Intergenic
1009998186 6:70920331-70920353 GGCTTCCCTTGGATAGGAAAGGG + Intronic
1009998635 6:70925385-70925407 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1010102515 6:72125896-72125918 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1010171845 6:72984619-72984641 GGCTTCCCTTGGCTAGGAAACGG + Intronic
1010266073 6:73869329-73869351 TTTCTCCCTTTGGTTGGAAATGG + Intergenic
1010282264 6:74035603-74035625 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1010422172 6:75688302-75688324 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1010463841 6:76143626-76143648 CCTTTCCCTTGGCTAGGAAAGGG + Intergenic
1010670039 6:78676179-78676201 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1010682905 6:78817750-78817772 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1010688297 6:78877730-78877752 GGGTTCCCTTGGCTAGGAAAGGG - Intronic
1010755708 6:79664075-79664097 GTCTTCCCTTGGATAGGAAAGGG + Intronic
1010820694 6:80411865-80411887 CAGCTTCCTTGGTTAGGAAAGGG + Intergenic
1010997691 6:82551911-82551933 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1011209136 6:84936135-84936157 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1011245192 6:85314833-85314855 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1011288584 6:85751865-85751887 GGGTTCCCTTGGCTAGGAAATGG - Intergenic
1011336998 6:86272427-86272449 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1011348028 6:86392807-86392829 GACTTCCCTTGGCTAGGAAAGGG - Intergenic
1011537360 6:88390929-88390951 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1011909678 6:92420968-92420990 GGATTCCCTTGGCTAGGAAAGGG - Intergenic
1012129364 6:95471640-95471662 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1012484147 6:99702334-99702356 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1012585273 6:100914041-100914063 GGCATCCCTTGGCTAGGAAAGGG + Intergenic
1012589951 6:100968927-100968949 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1012597970 6:101062213-101062235 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1012881795 6:104799946-104799968 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1012933208 6:105338627-105338649 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1012940981 6:105415217-105415239 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1013386853 6:109640340-109640362 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1013661355 6:112300020-112300042 TCTCTACCTTGGTTAGGCAAAGG - Intergenic
1013883122 6:114929115-114929137 GGCTTCCCTTGGATAGGAAAGGG + Intergenic
1014013272 6:116501074-116501096 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1014128511 6:117804853-117804875 GGCTTCCCTTGGTTAGGAAAGGG + Intergenic
1014907092 6:127043457-127043479 GACTTCCCTTGGCTAGGAAACGG - Intergenic
1014924548 6:127255271-127255293 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1014938720 6:127413507-127413529 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1015028963 6:128570943-128570965 GTTCTGCTTTGGTTTGGCAATGG + Intergenic
1015242166 6:131036771-131036793 TTTCTCCTTTGTTTAGGCAATGG - Intronic
1015247056 6:131086555-131086577 GACTTCCCTTGGCTAGGAAATGG - Intergenic
1016265893 6:142232373-142232395 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1016333917 6:142983307-142983329 GGCTTCCCTTGGTTAGCAAAGGG + Intergenic
1016334857 6:142993955-142993977 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1016655668 6:146515594-146515616 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1017411480 6:154172374-154172396 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1017659901 6:156663714-156663736 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1018076048 6:160214654-160214676 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1018113942 6:160564736-160564758 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1020344196 7:7145526-7145548 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1020380077 7:7534364-7534386 TTTTTTCCTTGGTTAGCAAAGGG - Intronic
1020774168 7:12432259-12432281 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1020809960 7:12839717-12839739 GACTTCCCTTGGCTAGGAAAGGG - Intergenic
1020818826 7:12940007-12940029 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1020834063 7:13126755-13126777 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1021071622 7:16248798-16248820 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1021201710 7:17734922-17734944 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1021238770 7:18175367-18175389 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1021282717 7:18740177-18740199 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1021307153 7:19045948-19045970 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1021379253 7:19947668-19947690 TTTATTCCTTGGTTAGGAAATGG - Intergenic
1021379923 7:19954609-19954631 GGATTCCCTTGGCTAGGAAAGGG + Intergenic
1021755194 7:23844758-23844780 GGTTTCCCTTGGCTAGGAAAGGG - Intergenic
1021798207 7:24278900-24278922 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1021870581 7:25002181-25002203 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1022136054 7:27449455-27449477 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1022347248 7:29528444-29528466 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1022453554 7:30537706-30537728 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1022496221 7:30854787-30854809 GATGTCCCTTGGGTAGGCAATGG + Intronic
1022745412 7:33166790-33166812 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1023651230 7:42371350-42371372 GGCTTCCCTTGGGTAGGAAAGGG + Intergenic
1024015966 7:45315508-45315530 CTCTTCCCTTGGCTAGGAAAGGG - Intergenic
1024591251 7:50887062-50887084 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1024667077 7:51558065-51558087 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1024704402 7:51941506-51941528 GGTTTCCCTTTGCTAGGAAAAGG - Intergenic
1024738268 7:52328718-52328740 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1024930534 7:54663562-54663584 GGTCTCACTTGGTTAGGATATGG + Intergenic
1026589528 7:71682993-71683015 GTGGCCCCTTTGTTAGGAAATGG + Intronic
1027574474 7:79915282-79915304 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1028013623 7:85679740-85679762 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1028086652 7:86644718-86644740 GTTCTCCCTTGGATTTGGAAAGG + Exonic
1028114462 7:86981894-86981916 GGTTTCCCTTGGCTAGGAAAGGG - Intronic
1028340908 7:89718917-89718939 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1028630071 7:92925134-92925156 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1028646899 7:93108540-93108562 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1028692079 7:93663944-93663966 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1028785936 7:94794579-94794601 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1028836112 7:95376982-95377004 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1028884724 7:95918410-95918432 CTTCTTCCTTGGTTAGCAAGTGG - Intronic
1028888814 7:95964177-95964199 GTTCTCCCTGGGCTGGGAATTGG + Intronic
1028979765 7:96954422-96954444 CTTGTCCCTTAGTTAGGAATAGG + Intergenic
1029017552 7:97329955-97329977 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1029057362 7:97760637-97760659 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1029801658 7:102954165-102954187 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1029850598 7:103457549-103457571 GGCTTCCCTTGGGTAGGAAAGGG + Intergenic
1029854798 7:103504654-103504676 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1029902718 7:104059028-104059050 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1029951989 7:104595968-104595990 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1030177707 7:106671967-106671989 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1030202450 7:106919013-106919035 GGCTTCCCTTGGGTAGGAAAGGG - Intergenic
1030298372 7:107951433-107951455 GGTCTCCATTGACTAGGAAAAGG + Intronic
1030526514 7:110661019-110661041 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1030936722 7:115594026-115594048 GACTTCCCTTGGCTAGGAAATGG - Intergenic
1030970282 7:116047240-116047262 GGCTTCCCTTTGTTAGGAAAGGG - Intronic
1031157054 7:118122433-118122455 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1031458386 7:122012828-122012850 TTTCTCACTTGCATAGGAAATGG - Exonic
1031699018 7:124900737-124900759 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1031905022 7:127451174-127451196 GGCTTCCCTTGGTTAGGAAAGGG - Intergenic
1032250714 7:130254954-130254976 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1032764328 7:134976199-134976221 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1033107118 7:138537116-138537138 AGCTTCCCTTGGTTAGGAAAGGG + Intronic
1033599970 7:142882330-142882352 GTTCTCCCATGCTTCAGAAAAGG + Intronic
1034040131 7:147868880-147868902 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1034360832 7:150496446-150496468 GGTGTCCCTTGGCTAGGAAAGGG - Intergenic
1037398308 8:18467096-18467118 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1039281502 8:35990082-35990104 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1039347676 8:36725967-36725989 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1040071123 8:43189536-43189558 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1040410858 8:47152979-47153001 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1040431771 8:47349878-47349900 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1040473027 8:47752196-47752218 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1040607286 8:48946566-48946588 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1040772340 8:50992384-50992406 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1041155881 8:54986205-54986227 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1041217558 8:55615949-55615971 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1041909831 8:63077395-63077417 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1041951721 8:63510666-63510688 GTCTTCCCTTGGCTAGGAAAGGG + Intergenic
1042070842 8:64931474-64931496 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1042110853 8:65379844-65379866 GTCTTCCCTTGGCTAGGGAAGGG - Intergenic
1042171767 8:65998681-65998703 GGCTTCCCTTGGCTAGGAAACGG + Intergenic
1042308742 8:67358851-67358873 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1042541057 8:69907464-69907486 GGCTTCCTTTGGTTAGGAAAGGG - Intergenic
1043048804 8:75359760-75359782 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1043089213 8:75876232-75876254 GGCTTCCCTTGGCTAGGAAAAGG + Intergenic
1043328249 8:79080294-79080316 GTTCTTCCTTGGGAGGGAAAGGG + Intergenic
1043497898 8:80823160-80823182 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1044254538 8:90045268-90045290 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1044470661 8:92562744-92562766 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1044576994 8:93780277-93780299 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1044809087 8:96039023-96039045 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1044956638 8:97488058-97488080 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1044960795 8:97528941-97528963 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1045071187 8:98506307-98506329 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1045933545 8:107654156-107654178 GTCTTCCCTTGGCTAGGAAGGGG + Intergenic
1046115272 8:109776869-109776891 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1046609778 8:116410550-116410572 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1046900757 8:119521208-119521230 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1047473467 8:125202123-125202145 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1047931525 8:129732895-129732917 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1048467014 8:134674177-134674199 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1048796356 8:138153526-138153548 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1050049978 9:1589289-1589311 GGCTTCCCTTTGTTAGGAAAGGG + Intergenic
1050407658 9:5327130-5327152 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1050422225 9:5477735-5477757 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1050478299 9:6063555-6063577 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1050597279 9:7216469-7216491 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1050604185 9:7283612-7283634 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1050700224 9:8330107-8330129 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1050787676 9:9426147-9426169 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1051124783 9:13791751-13791773 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1051614813 9:18997179-18997201 GGCTTCCCTTGGTTAGGAAAGGG - Intronic
1051860451 9:21619129-21619151 ATTCTCCCTTGCTGATGAAAAGG - Intergenic
1052217311 9:25982775-25982797 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1052441239 9:28498558-28498580 AGTTTCCCTTGGCTAGGAAAGGG + Intronic
1052714463 9:32098748-32098770 GGATTCCCTTGGCTAGGAAAGGG - Intergenic
1052770474 9:32684346-32684368 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1052813985 9:33085653-33085675 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1052887709 9:33666236-33666258 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1052992956 9:34532466-34532488 CTCTTCCCTTGGCTAGGAAAGGG + Intergenic
1053041627 9:34878454-34878476 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1054887292 9:70212529-70212551 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1054889965 9:70240517-70240539 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1055533127 9:77207664-77207686 GTTCTCACTAGGGTGGGAAAGGG + Intronic
1055614221 9:78054432-78054454 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1055617065 9:78083813-78083835 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1055642895 9:78334545-78334567 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1055894771 9:81162489-81162511 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1056426336 9:86480936-86480958 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1057015540 9:91647684-91647706 GTGCTCCCTTGGGTAGGAAGGGG - Intronic
1057685930 9:97234544-97234566 CTTCTCCCTTGCTTAGCACACGG + Intergenic
1057698168 9:97342083-97342105 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1057769112 9:97951288-97951310 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1058074649 9:100638202-100638224 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1058203021 9:102067090-102067112 TGTTTCCCTTGGCTAGGAAAGGG + Intergenic
1058819223 9:108713689-108713711 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1058926151 9:109666096-109666118 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1059020234 9:110568621-110568643 GTTCTACCTTGCTGAGGGAAGGG + Intronic
1059623613 9:116036409-116036431 GGCTTCCCTTGGATAGGAAAAGG - Intergenic
1059825651 9:118025791-118025813 TTGATCACTTGGTTAGGAAAGGG + Intergenic
1059864698 9:118501426-118501448 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1060133970 9:121133560-121133582 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1061214365 9:129212484-129212506 CTTCCTCCTTGGTTAAGAAAAGG - Intergenic
1061552415 9:131345299-131345321 TGTTTCCCTTGGCTAGGAAAGGG + Intergenic
1062703514 9:137920863-137920885 ATTCTCCCTTTCTTAGTAAATGG - Intronic
1203635004 Un_KI270750v1:102054-102076 GAACTCCCATGGATAGGAAAGGG - Intergenic
1186585616 X:10870041-10870063 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1186914670 X:14206779-14206801 GTCTTCCCTTTGCTAGGAAAGGG + Intergenic
1187374543 X:18740036-18740058 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1187705442 X:22005361-22005383 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1187829191 X:23363561-23363583 GGCTTCCCTTGGGTAGGAAAGGG + Intronic
1188044023 X:25404522-25404544 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1188044862 X:25413959-25413981 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1188123074 X:26334214-26334236 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1188202589 X:27309392-27309414 GTCCTCCCTTGGTCAGCATAGGG - Intergenic
1188272077 X:28152622-28152644 GACTTCCCTTGGCTAGGAAAGGG + Intergenic
1188820628 X:34770509-34770531 GGTCTCCCTTGGCTGGGAATGGG + Intergenic
1189029656 X:37437558-37437580 GTACTGTCATGGTTAGGAAATGG + Intronic
1189930514 X:46004241-46004263 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1189978491 X:46486297-46486319 GTCTTCCCTTGGCTAGGAAAGGG + Intronic
1190152004 X:47956920-47956942 GCGCTCACTTGGTTAGGGAAAGG - Intronic
1190160655 X:48029229-48029251 GCGCTCACTTGGTTAGGGAAAGG + Intronic
1190209537 X:48433673-48433695 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1190840771 X:54142315-54142337 GCCTTCCCTTGGCTAGGAAAGGG - Intronic
1191073749 X:56429987-56430009 GGCCTCCCTTGGCTAGGAAAGGG + Intergenic
1191084265 X:56547427-56547449 GACTTCCCTTGGCTAGGAAAGGG - Intergenic
1191121703 X:56912874-56912896 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1191153989 X:57251936-57251958 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1191170729 X:57444510-57444532 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1191197869 X:57744206-57744228 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1191588802 X:62858310-62858332 CTCTTCCCTTGGCTAGGAAAGGG - Intergenic
1191601928 X:63018112-63018134 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1191643380 X:63452261-63452283 GGTTTTCCTTGGCTAGGAAAGGG + Intergenic
1191711356 X:64152815-64152837 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1191733454 X:64363823-64363845 GTCTTCCCTTGGCTAGGAAATGG - Intronic
1191886590 X:65894590-65894612 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1192023927 X:67427601-67427623 GGCTTCCCTTGGTTAGGGAAGGG + Intergenic
1192371878 X:70521044-70521066 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1192406394 X:70890439-70890461 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1192522919 X:71816904-71816926 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1192612895 X:72585656-72585678 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1192678810 X:73230048-73230070 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1192727483 X:73768130-73768152 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1192857304 X:75025717-75025739 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1193316088 X:80066466-80066488 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1193338551 X:80319481-80319503 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1193402580 X:81063905-81063927 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1193435977 X:81475362-81475384 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1193661886 X:84267796-84267818 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1193806562 X:86002637-86002659 GTTCTCCCTTGGTTAGGAAAGGG - Intronic
1193811298 X:86054630-86054652 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1194761784 X:97803817-97803839 GGTTTCCCTTGGCTAGGAAAGGG + Intergenic
1195218878 X:102727435-102727457 GTACTCTCTTGTTTAGGAAGAGG - Intronic
1195546138 X:106114568-106114590 GCTGCCCCTTGGTTTGGAAATGG + Intergenic
1195547280 X:106126753-106126775 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1195622021 X:106966519-106966541 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1195729294 X:107949460-107949482 GACATCCCTTGGCTAGGAAAGGG + Intergenic
1195787986 X:108548010-108548032 CTCTTCCCTTGGCTAGGAAAGGG + Intronic
1195845952 X:109228996-109229018 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1195932885 X:110096589-110096611 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1195947382 X:110229741-110229763 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1196094495 X:111784657-111784679 GGCTTCCCTTGGCTAGGAAAGGG - Intronic
1196158990 X:112462015-112462037 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1196526496 X:116733928-116733950 GTTCCCTCTTGTTTGGGAAAGGG + Intergenic
1197279816 X:124522141-124522163 TTTCTCCCTTTGTAAGCAAAGGG + Intronic
1197477971 X:126946994-126947016 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1198335829 X:135665440-135665462 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1198572330 X:137971186-137971208 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1198603342 X:138308994-138309016 TTTCTCCCTAGGAAAGGAAAAGG + Intergenic
1198663437 X:138996265-138996287 GGCTTCCCTTGGGTAGGAAAGGG - Intronic
1198725850 X:139676231-139676253 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1198858488 X:141044519-141044541 GGCATCCCTTGGATAGGAAAGGG - Intergenic
1198904209 X:141542869-141542891 GGCATCCCTTGGATAGGAAAGGG + Intergenic
1199302936 X:146233870-146233892 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1199344148 X:146719272-146719294 GACTTCCCTTGGCTAGGAAAGGG - Intergenic
1199637130 X:149824735-149824757 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1199796185 X:151200035-151200057 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1199939637 X:152612504-152612526 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1199968545 X:152841214-152841236 GGCTTCCCTTGGCTAGGAAAGGG + Intronic
1201185891 Y:11402562-11402584 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1201353433 Y:13071837-13071859 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1201364254 Y:13186250-13186272 ATCTTCCCTTGGCTAGGAAAGGG - Intergenic
1201393137 Y:13520207-13520229 GGGTTCCCTTGGCTAGGAAAGGG + Intergenic
1201541614 Y:15110866-15110888 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1201561514 Y:15322234-15322256 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1201583141 Y:15532165-15532187 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1201776182 Y:17668489-17668511 GTCTTCCCTTGGCTAGGAAAGGG + Intergenic
1201783302 Y:17745950-17745972 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1201818251 Y:18160037-18160059 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic
1201825374 Y:18237503-18237525 GTCTTCCCTTGGCTAGGAAAGGG - Intergenic
1201956559 Y:19630063-19630085 GCTTTCCCTTTGCTAGGAAAGGG + Intergenic
1201961970 Y:19690627-19690649 GTTTTCCCTTGGTTAGCGGAGGG + Intergenic
1201971433 Y:19801832-19801854 GGCTTCCCTTGGCTAGGAAAGGG - Intergenic
1202042041 Y:20695821-20695843 GGCTTCCCTTGGCTAGGAAAGGG + Intergenic