ID: 1193809109

View in Genome Browser
Species Human (GRCh38)
Location X:86030676-86030698
Sequence TCCCTCTGTAGAGGGAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193809109 Original CRISPR TCCCTCTGTAGAGGGAGTCA TGG Intronic
901171090 1:7258035-7258057 TCCCTCTGAAAAGTGAGTCCTGG + Intronic
901265976 1:7911016-7911038 GCATTCTGTAGAGGCAGTCACGG - Intergenic
901386647 1:8913904-8913926 ACCCTCTGTAGAGTGTTTCACGG - Intergenic
901453291 1:9349162-9349184 TCCCTCTGCAGGGGAAGCCAAGG + Intronic
901717147 1:11164998-11165020 TGCATCTGTTGAGGTAGTCATGG - Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903115380 1:21175752-21175774 TCCCGCTGTAGGGGGAGCCGAGG + Intronic
904080435 1:27869144-27869166 TCCCACTGTAGAGGAAGGTAAGG - Intergenic
908393365 1:63703326-63703348 CCCCTCTCTGGAGGGAGGCAAGG + Intergenic
911164720 1:94714364-94714386 TCCCTCAGCAGAGGGAGACTGGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
918406875 1:184220249-184220271 TCCATGTCTAGAGGAAGTCAAGG - Intergenic
918559767 1:185850587-185850609 GGCCTCTGCAGAGGCAGTCATGG - Intronic
919342709 1:196333984-196334006 TCCCTCTGTAGGAAGAGACAGGG + Exonic
920096620 1:203490668-203490690 TCCCTCAGAAGAGAGAGTCTGGG - Exonic
921305350 1:213791012-213791034 TCCCTCAGTAGGGAAAGTCAAGG + Intergenic
923446714 1:234078018-234078040 TTCCTCTGCAGTAGGAGTCAAGG - Intronic
1067521913 10:47014058-47014080 TGGCCCTGTAGAGGGAGCCACGG - Intergenic
1069449098 10:68501841-68501863 TACTTTTGTAGAGGGAGTGAGGG - Intronic
1070173892 10:73954171-73954193 TTCCTCAGGACAGGGAGTCATGG + Intergenic
1071569999 10:86691584-86691606 TCCCTCTGTAAAGGGAATCTAGG + Intronic
1073149378 10:101301599-101301621 TCCCTCTGGAGAGGGCATAACGG - Intergenic
1073571560 10:104584735-104584757 TTCCTCTGTTGAGGGAGACGTGG + Intergenic
1078656481 11:13245415-13245437 ACCCTCTGGAGAGAGAGTCAAGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083277877 11:61607460-61607482 TCCCTCTGCAGAGGGAAACTGGG - Intergenic
1083712619 11:64558588-64558610 TTCCTCTAGAGACGGAGTCACGG - Intronic
1084288600 11:68147400-68147422 TCCCACTGTACAGAGAGGCAGGG - Intergenic
1084315878 11:68345235-68345257 TCCCTCAGTAGAGGGACGCTTGG + Intronic
1089116518 11:116099586-116099608 CAGCTCTGAAGAGGGAGTCACGG + Intergenic
1089666573 11:120024216-120024238 TACCCCTGGAGGGGGAGTCAGGG + Intergenic
1091461127 12:643948-643970 TCCCTCTGCAGATGGAGTGAAGG + Intronic
1092324447 12:7514888-7514910 TTCATCTGTAGAGATAGTCAAGG - Intergenic
1092898884 12:13040147-13040169 TCTCTCTGCAGAGGGAGTGAGGG + Intergenic
1092938709 12:13387493-13387515 GCCCTCAGAAGAGGGAGCCAAGG + Intergenic
1093315510 12:17645560-17645582 TCCCTCCATAGATGGAGTCAAGG - Intergenic
1093320450 12:17707335-17707357 CCCCTCTGGAGAGTGAGACAAGG - Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096677646 12:53234139-53234161 TCCTTCTGTAGAGGGGCTTAGGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1099028543 12:77495816-77495838 TCCCAATGCAGTGGGAGTCAGGG + Intergenic
1101914438 12:108885244-108885266 TAAGTCTGCAGAGGGAGTCAGGG + Intronic
1102499368 12:113340863-113340885 CACCTCTGTAGAGGAAGGCATGG - Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1104822837 12:131687991-131688013 TCCCTCTCCAGGGGCAGTCAGGG - Intergenic
1105572839 13:21620303-21620325 GCCCTCTGCTGAGGGAGGCAGGG - Intergenic
1106485225 13:30166589-30166611 TACCTCTATAGAGGCAGACAGGG + Intergenic
1107014882 13:35700370-35700392 TCCCTCTGGAGTGGAAGGCAGGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1111613498 13:90635968-90635990 TCCTTCTGTTGAAGGAGTCTAGG + Intergenic
1113233954 13:108248400-108248422 TTCCTCTGTGGAGGGAGGGAGGG + Intergenic
1114725034 14:24927262-24927284 ACCCTCTGGAGAGTGAGCCAGGG - Intronic
1116173247 14:41430048-41430070 TCCCAATGTAGAGGGGGTTAGGG - Intergenic
1119161832 14:72459204-72459226 TCCTTCCGTAGAGGGAATGAGGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120833163 14:89016111-89016133 TCCCTCTGTGGAGGGTGACTAGG + Intergenic
1122341815 14:101033504-101033526 TCCCGAAGTAGAGGGAGTCTGGG + Intergenic
1122357498 14:101132406-101132428 GACCTCTGTAGATGGAGTCAAGG + Intergenic
1125531174 15:40414549-40414571 TGCCTGTGTAGAAAGAGTCAGGG + Intronic
1128129172 15:65214417-65214439 TCTTTCTGTAGTGGGAGGCAGGG + Intergenic
1129692305 15:77720858-77720880 GCCAGCTGTGGAGGGAGTCATGG - Intronic
1129696525 15:77743372-77743394 TCCCCCATTACAGGGAGTCAAGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130666235 15:85872188-85872210 CCCCACTGTGGAGGGAGCCAAGG - Intergenic
1130763306 15:86843259-86843281 CCCTGCTGTAGAGAGAGTCATGG + Intronic
1131985238 15:98036562-98036584 TCCCTCTGTAGGTGGTGTTATGG - Intergenic
1133280696 16:4663623-4663645 GCCCTCTATGGAGGGAGTCAGGG + Intronic
1133434970 16:5771289-5771311 TCCTTCTGAGGAGGGAGTTAGGG + Intergenic
1134365169 16:13570519-13570541 TCACACTCTAGAGGGAGTTAGGG + Intergenic
1135351481 16:21733065-21733087 TGCCTCTGAAGAGGGAGGCTAGG - Intronic
1135449963 16:22549193-22549215 TGCCTCTGAAGAGGGAGGCTAGG - Intergenic
1137535006 16:49314010-49314032 TCCTACTGTTGAGGGAGGCATGG + Intergenic
1137575140 16:49594384-49594406 TCCCTCTGTTGAGAGAGGCCTGG - Intronic
1138538928 16:57676517-57676539 TCCCTCAGTAGAGGAGCTCACGG - Intronic
1140051397 16:71484482-71484504 TGCCTCAGTGGAGGGAGACAGGG - Intronic
1141707477 16:85675298-85675320 TCCCTCTGCAGAGGGACAGATGG - Exonic
1143131269 17:4678994-4679016 TCCCTCTGTTGAGGGTGTTGAGG - Intronic
1144787248 17:17838714-17838736 TCCCTCTGCAGAGGCAGGGAGGG + Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1150819039 17:68420178-68420200 TCCCTCTCTAGGTGGAGCCAGGG + Exonic
1150849260 17:68688878-68688900 TCCATCTGTGGAGGGAGGGAAGG - Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152464895 17:80460642-80460664 TTCCTCTGTTGAGGGACACACGG - Intergenic
1155646535 18:28085112-28085134 TGTCTCTCTAGAGGAAGTCAGGG - Intronic
1157293294 18:46425036-46425058 TGCCTTTGGAGAGGGAGTCTCGG + Intronic
1157296249 18:46447403-46447425 TCCCTCTGAAGAGAGAGGAAAGG + Intronic
1158842405 18:61402080-61402102 TCTCTTTGCAAAGGGAGTCAAGG - Intronic
1159192000 18:65058400-65058422 TTCTTCAGTAGAAGGAGTCAGGG + Intergenic
1160775986 19:855940-855962 TCCCCCTGTGGAGGCAGACAAGG - Exonic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1161322146 19:3646235-3646257 TCCCTCTGGGGAGGGAGACTGGG + Intronic
1161568551 19:5017096-5017118 TCCCTGTGCAGAGGGAGGAAGGG + Intronic
1162018503 19:7858109-7858131 TCCCCCTGTGGCGGGAGGCAGGG + Intronic
1162369546 19:10270598-10270620 TCCCTCAGTGGAGGGAGCCCGGG + Intergenic
1163230296 19:15997427-15997449 TCCCCTAGTAGAGGCAGTCAAGG + Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163680956 19:18682306-18682328 TCCCTCTCTTGAGGGAGGGAGGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
926441885 2:12897630-12897652 TCCCTCTCTGGAGGGAAGCAGGG + Intergenic
927537141 2:23872390-23872412 TCTCTCTGAAGAGGCTGTCATGG - Intronic
929117383 2:38455972-38455994 TCCCTCTTAAGAGAGAGTCCTGG + Intergenic
929124765 2:38513078-38513100 TCCCTGTGTAGAGAGAGGGAGGG + Intergenic
929928591 2:46234809-46234831 TTCTTCTGTAGATGGAGGCAAGG + Intergenic
930319106 2:49831928-49831950 ACCCTCTGCAGAAGGAGTCCAGG - Intergenic
930539823 2:52691099-52691121 AGCCTCTGTAAAGGGAATCAAGG - Intergenic
930871113 2:56171984-56172006 TCTCTTTGCAGTGGGAGTCATGG - Intergenic
930875688 2:56212931-56212953 TTCCTCTTTGGAGGGAGTAAGGG - Intronic
931528222 2:63182648-63182670 TGGCTCTGTAGAATGAGTCAGGG + Intronic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
933636981 2:84719454-84719476 TGCCTCTGTGAAGGGAGGCATGG - Intronic
935729796 2:106055949-106055971 TTCCTCCGTGAAGGGAGTCAAGG - Intergenic
935972088 2:108539626-108539648 TGCTTCTGGAGAGGGAGTCTAGG + Intronic
938077113 2:128345903-128345925 TCCCCCTGTGGAGGAAGGCAAGG - Intergenic
938228989 2:129641568-129641590 TCCCTCTGCAGGTGGACTCAAGG + Intergenic
938231321 2:129662497-129662519 TTCCTCTGTAAAAGGAGCCAGGG + Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938781458 2:134588576-134588598 TCCCTCTGGAGAGAGTCTCAAGG - Intronic
938982783 2:136542398-136542420 TGCCTCTGTGGGGGGAGTCAGGG + Intergenic
939757320 2:146130516-146130538 TCCCTCTGTAGGGCTAGTCTGGG - Intergenic
939934041 2:148267579-148267601 TACCTCTGGAGAGGGAGGCAAGG - Intronic
941095572 2:161237432-161237454 TCCCTCTGTAGAGCAGGGCAGGG - Intergenic
944278912 2:197871888-197871910 TCCCTTTGTAGAGGGTGTAAAGG - Intronic
948442590 2:238004886-238004908 TCCCTCTGGAGATGGAGGAAGGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948777943 2:240299507-240299529 TCCCCCTGGAGAGAGGGTCATGG - Intergenic
1171238411 20:23546366-23546388 TCCTTCTGCTGATGGAGTCAGGG + Intergenic
1171243255 20:23588061-23588083 TCCTTCTGCTGATGGAGTCAGGG - Intergenic
1172547027 20:35770271-35770293 TGCCTCAGTTGAGGTAGTCAGGG - Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1175132872 20:56802791-56802813 CCCCTTTGTGGAGGGGGTCAAGG + Intergenic
1175245186 20:57577985-57578007 TCCCTGTGCATGGGGAGTCACGG - Intergenic
1175646614 20:60679609-60679631 GCCCTCTGTGGAGGTAGCCAGGG - Intergenic
1175763122 20:61574377-61574399 TCTCACTGCAGTGGGAGTCATGG + Intronic
1176687636 21:9865287-9865309 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1177911114 21:27033597-27033619 TCCCTCATCAGAGGGAGTAATGG - Intergenic
1178384098 21:32135319-32135341 GCCCTCTGGAGAGGGCGTGAGGG + Intergenic
1179262114 21:39766512-39766534 TCCCACTGTAGTTGGAGGCAGGG - Intronic
1179776915 21:43670567-43670589 TGCCTCTGTAGAGGGAGAGCAGG + Intronic
1180814771 22:18782410-18782432 CCCATCTGTAAAGCGAGTCAGGG - Intergenic
1182974230 22:34607545-34607567 TCCATCTGAACATGGAGTCAAGG - Intergenic
1183312353 22:37117422-37117444 TCCATCTGTACAGGGATTTAAGG + Intergenic
1184478019 22:44731873-44731895 CCCCTCTGTAGAGTGAGGCCAGG - Intronic
1203225959 22_KI270731v1_random:78689-78711 CCCATCTGTAAAGCGAGTCAGGG + Intergenic
1203264868 22_KI270734v1_random:8097-8119 CCCATCTGTAAAGCGAGTCAGGG - Intergenic
949605368 3:5646858-5646880 ACCCTCTGTAGAAGGTGTTATGG + Intergenic
949985123 3:9534553-9534575 CCCCTCTTTAGAAGGAGCCAAGG - Intronic
950082738 3:10235018-10235040 TCCCTCTGTGGTGGGACTCAGGG - Intronic
955433015 3:58870089-58870111 TCCCCTTGTAGAGGGAGGGAGGG - Intronic
959133410 3:102386864-102386886 TACTTCTGGAGAGGGAGTCTAGG - Intronic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
961241629 3:125416561-125416583 TGCCTTAGTAGAGGGAGTCAAGG + Intergenic
964669332 3:159208319-159208341 TCCCTCTGTCGAGAGAGACCAGG + Intronic
965052298 3:163666306-163666328 TTCCTCTGTAGTGGGATTGATGG + Intergenic
969779627 4:9389363-9389385 TCCACATGTAGATGGAGTCAGGG - Intergenic
971341048 4:25769399-25769421 TCCCTCTTTAGCCTGAGTCATGG - Intronic
972480273 4:39489955-39489977 AACCTCTGAAGAGGGAGTCTGGG - Intergenic
976808409 4:89073819-89073841 TACCCCGGAAGAGGGAGTCAAGG + Intronic
977798185 4:101193608-101193630 TCCGTCTGGAGAGGGAGTAAAGG - Intronic
979005315 4:115287568-115287590 TTCCTCTGTAGAATGAGTTAAGG + Intergenic
979295690 4:119030659-119030681 CCCCTCTGGAGAAGGCGTCAGGG - Exonic
980350988 4:131683103-131683125 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
982545025 4:156723871-156723893 CCCCACTGTAGTGGGCGTCATGG - Intergenic
983081235 4:163387597-163387619 ACCCTATGTGGAGGGTGTCAGGG + Intergenic
984103151 4:175511768-175511790 TGACTCTGTAGAGGGAATCCAGG - Intergenic
985947061 5:3194090-3194112 TCTCTGTGTAGAGGGAGGGATGG + Intergenic
986740674 5:10702532-10702554 TCCCTCTTTAGAGGGAGCTCAGG + Intronic
988731026 5:33973059-33973081 TACCTCTGTGATGGGAGTCAGGG + Intronic
991969571 5:72126113-72126135 TCCCTGTGTTGAGGGAAGCAGGG + Intronic
994188319 5:96839670-96839692 TCCCTCTGAGCAGGGAGTGAAGG - Intronic
1002674667 5:180901034-180901056 TCCCACTGCAGGGGGACTCAGGG + Intronic
1003030132 6:2594378-2594400 TCCTTCTGTAAAGGGAGCTATGG + Intergenic
1003047744 6:2749800-2749822 TCCCTCTGCAGAGGGAGGCCAGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003331901 6:5135955-5135977 TCCGTCTGTAGGGGGACTCTAGG + Intronic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005808155 6:29494361-29494383 TCCCTAGGATGAGGGAGTCAGGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007679391 6:43624064-43624086 TGACACTGTAGAGGGAGGCATGG + Exonic
1010466645 6:76174970-76174992 TTCCTCTCTAGAGGCAGTCTGGG - Intergenic
1016399127 6:143659360-143659382 ACCCTCTGCTGAGGGTGTCAGGG + Intronic
1017440809 6:154462847-154462869 GCCCTCTGTGGCGGGAGGCAGGG - Intronic
1018869015 6:167767455-167767477 TCCCTCTATGGAGTGTGTCATGG - Intergenic
1019146588 6:169979155-169979177 TCCGTGTGTAGAGTGAGCCAGGG - Intergenic
1019631915 7:2053983-2054005 CCCTTCTGCAGAGGGAGGCAGGG + Intronic
1019850702 7:3553828-3553850 TCCCTCAGTAGAAGGAGTGGTGG - Intronic
1020416850 7:7956279-7956301 TCCCTCTGTAGCAAGAGCCAGGG - Intronic
1020706717 7:11552964-11552986 TCCCTCTCTAGAGAGAGAGAAGG - Intronic
1021536766 7:21713961-21713983 TCTCTGTACAGAGGGAGTCAGGG - Intronic
1022136903 7:27457543-27457565 TTCCTATTTAGAGGGAGTCCTGG - Intergenic
1026764845 7:73154178-73154200 TCCCACTGGAGAGGGGGTGATGG - Intergenic
1026926238 7:74195906-74195928 TTCCTATTTAGAGGGAGTCCTGG + Exonic
1027041318 7:74963948-74963970 TCCCACTGGAGAGGGGGTGATGG - Intergenic
1027082322 7:75238428-75238450 TCCCACTGGAGAGGGGGTGATGG + Intergenic
1027602559 7:80257195-80257217 TCCCTGTGCTGAGAGAGTCAAGG + Intergenic
1027968639 7:85046992-85047014 TCTTTGTGTAGAGGGTGTCAAGG - Intronic
1029155634 7:98515688-98515710 TCCCTGTGTAGGGGGAGGCAGGG - Intergenic
1032724788 7:134580724-134580746 TGCCTCTTGAGAGGGAGTCAGGG - Intergenic
1034975922 7:155449301-155449323 TCCCTCTGAAGAGGGGGCCCAGG + Intergenic
1037979927 8:23246243-23246265 TCCCTCTATACAGAGATTCACGG + Exonic
1039626177 8:39056855-39056877 TCCCTCTGTATAGTTAGTTAGGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1045037056 8:98184049-98184071 GCCCTTTTTAGAGGGAGACAAGG - Intergenic
1045276807 8:100713999-100714021 TCCTACTTTAGAGGGAGTTAGGG - Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047120843 8:121902789-121902811 TCCCTTATAAGAGGGAGTCAGGG + Intergenic
1047366770 8:124218382-124218404 TGCTTATGTAGAGGGAGACAGGG - Intergenic
1048493225 8:134913699-134913721 TCCCACTGCAGAGGGTGTCATGG + Intergenic
1049274969 8:141715677-141715699 TCCCTCTGTCTGGGGAGCCACGG - Intergenic
1053414928 9:37941500-37941522 TCCCTCTGTTGGGGGAGTCATGG + Intronic
1054169668 9:61826766-61826788 TCCCTATGTTGAGGGAGCCCTGG + Intergenic
1054667870 9:67754049-67754071 TCCCTATGTTGAGGGAGCCCTGG - Intergenic
1055438871 9:76319640-76319662 TCCTTTTCTTGAGGGAGTCAGGG + Intronic
1055726017 9:79229933-79229955 GCACTCTGTAAAGGGAGTCTTGG + Intergenic
1055834926 9:80428255-80428277 ACCTTGTGTAGAGAGAGTCAAGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193809109 X:86030676-86030698 TCCCTCTGTAGAGGGAGTCATGG + Intronic
1196783234 X:119400775-119400797 TCCCTCTGCAGAGGAAGAGAAGG - Intronic
1196783235 X:119400782-119400804 TTCCTCTGCAGAGGGACTCATGG + Intronic
1197750306 X:129959449-129959471 TCCCCGTGTAGGGGGAGGCAGGG + Intergenic
1198229240 X:134673736-134673758 TCCATCTGTTGAGGGAGGAAAGG + Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic