ID: 1193824093

View in Genome Browser
Species Human (GRCh38)
Location X:86201274-86201296
Sequence CAGGGTCTTCTTGAGGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1182
Summary {0: 1, 1: 0, 2: 20, 3: 214, 4: 947}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193824093 Original CRISPR CAGGGTCTTCTTGAGGGGGG TGG Intronic
900011207 1:110773-110795 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
900027311 1:287337-287359 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
900041269 1:466781-466803 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
900062700 1:701757-701779 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
900393718 1:2444592-2444614 CAGGGTATTCTTTAGGGAGATGG + Intronic
900734325 1:4286188-4286210 CAGGGTCTACTTGAGAGTGGGGG - Intergenic
900737129 1:4306068-4306090 CTGGGTGGTCTTGAGGTGGGAGG - Intergenic
900737512 1:4308487-4308509 CAGAGTCTGCTTGTGGGGAGTGG + Intergenic
901744547 1:11363795-11363817 CAGGGACTTCCTGAGAAGGGCGG + Intergenic
902458491 1:16553668-16553690 CAGGGTCACCCTGAGAGGGGAGG - Intergenic
902493669 1:16854248-16854270 CAGGGTCACCCTGAGAGGGGAGG + Intronic
902998691 1:20248591-20248613 CTGGGGCTTGTTGAGGGGGTTGG + Intergenic
903151677 1:21414427-21414449 CAGGGTCGCCCTGAGAGGGGAGG - Intergenic
903888226 1:26553553-26553575 CAGGGCCATCCTGAGGTGGGTGG + Intronic
904233002 1:29092705-29092727 CAGGGCCTACTTGAGGGTGGAGG - Intronic
904830536 1:33303722-33303744 GGGGATCTTCTTGAGGAGGGAGG - Intergenic
905523823 1:38621734-38621756 CAGGGACACCTAGAGGGGGGTGG - Intergenic
905848106 1:41251036-41251058 TAGGGTCTACTTGAGCGGGGAGG - Intergenic
906315745 1:44785439-44785461 CAGGGTCACCTTGTTGGGGGTGG + Intronic
906737753 1:48148699-48148721 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
906887916 1:49672328-49672350 TGGGGTCTACTTGAGGGGGGAGG + Intronic
907047554 1:51308966-51308988 CAGGGTGTTCTGGTGGGGGCAGG - Intronic
907603876 1:55796103-55796125 CAGGGTTTTTTTTGGGGGGGGGG - Intergenic
907770213 1:57454492-57454514 CGGGGTCTACTTGAGGATGGAGG + Intronic
908083064 1:60601019-60601041 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
908686720 1:66728941-66728963 TAGGGCCTGCTTGAGGGAGGAGG + Intronic
908905469 1:69003877-69003899 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
909125270 1:71660313-71660335 TGGGGTCTGCTTGAGAGGGGAGG + Intronic
909427569 1:75545010-75545032 CAGGGCCTTTTGGAGGGTGGGGG - Intronic
909442882 1:75717449-75717471 CTGGGGCTACTTGAGGGTGGAGG + Intergenic
909760145 1:79276277-79276299 TAGGTTCTACTTGATGGGGGAGG + Intergenic
909875020 1:80790987-80791009 TAGGGACTACTTGAGGGTGGAGG + Intergenic
909892563 1:81025912-81025934 TAGGGTCTACTTCATGGGGGAGG - Intergenic
909917465 1:81337486-81337508 CACGGTCTTCATGAAGGGGATGG - Intronic
909972836 1:82010647-82010669 CGGGGCCTACTTGAGGGTGGAGG - Intergenic
910139750 1:84014059-84014081 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
910606012 1:89085601-89085623 CAGGGCCTTCTTGAGGGTTGAGG + Intergenic
910610895 1:89141032-89141054 CAGGACCTACTTGAGGGTGGAGG + Intronic
910889897 1:92007391-92007413 TGGGGTCTACTTGAGGGTGGAGG - Intronic
911022423 1:93402112-93402134 CTGGGTCCTGTTGTGGGGGGGGG - Intergenic
911314337 1:96338018-96338040 CAGGGTCTACTTGAGGATGGAGG + Intergenic
911374730 1:97038060-97038082 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
911543928 1:99192702-99192724 TAGGGTCTACTTGAGGGTAGAGG + Intergenic
911702580 1:100971242-100971264 CTCTGTCTTCTTGAGGGAGGGGG + Intronic
911749761 1:101482625-101482647 CAGGGTCTTTTAAAGGGGGCTGG - Intergenic
912121049 1:106472863-106472885 CAGCTTCTTATTGAGGGGGTTGG - Intergenic
912283603 1:108344445-108344467 CAGAGTCTATTTGAGGGTGGAGG + Intergenic
912333204 1:108838320-108838342 CAGGGTTTTTTTTGGGGGGGGGG - Intronic
912530962 1:110321522-110321544 CATTGTCTTCTTGAGGATGGTGG - Intergenic
913607151 1:120476693-120476715 CAGGGTCACCCTGAGAGGGGAGG + Intergenic
913988202 1:143584910-143584932 CAGGGTCACCCTGAGAGGGGAGG - Intergenic
914196011 1:145448480-145448502 CAGGGGCTTCCTGAGGGGCCCGG + Intergenic
914209280 1:145563452-145563474 CAGGGTCACCCTGAGAGGGGAGG - Intergenic
914268200 1:146055820-146055842 CAGGGTCACCCTGAGAGGGGAGG - Intergenic
914440385 1:147700346-147700368 CAGGCCCTTCTAGAGGGCGGAGG + Intergenic
914584042 1:149045145-149045167 CAGGGTCACCCTGAGAGGGGAGG - Intronic
915628871 1:157136920-157136942 CAGGGTATTTTTCAAGGGGGAGG - Intronic
915696211 1:157745162-157745184 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
915946649 1:160157341-160157363 CAAGGCCTACTTGAGGGTGGAGG - Intronic
915975543 1:160384833-160384855 CAGGGGCTTGTTGGGGGGTGAGG - Intergenic
916420572 1:164634235-164634257 CAGAGGCTTCTTGAGGGATGTGG + Intronic
916568240 1:166001588-166001610 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
916646132 1:166786789-166786811 TGGGGTCTACTTGAGCGGGGAGG - Intergenic
916708378 1:167377823-167377845 CAGGGCCTACTTGAGGGTAGAGG - Intronic
916860848 1:168803469-168803491 CAGGGTCTTCTTGAATGTGAAGG - Intergenic
917172797 1:172196061-172196083 CTGGGTCTACTTGAGGGTGGAGG - Intronic
917253563 1:173089340-173089362 TGGGGTCTACTTGAGGGAGGAGG - Intergenic
917820821 1:178762013-178762035 CAGGGCCTACTTGAGGGTGGAGG - Intronic
917863766 1:179173943-179173965 CAGGGTTTTCTTGAGAAGGTAGG - Intronic
917990163 1:180367544-180367566 TGGGGTCTGCTTGAGGGTGGAGG - Intronic
917998424 1:180465992-180466014 TGGAGTCTACTTGAGGGGGGAGG + Intronic
918481209 1:184978668-184978690 CAGGGCCTATTTGAGGGTGGAGG + Intergenic
918539137 1:185608813-185608835 TAGTGTCTACTTGAGAGGGGAGG + Intergenic
918561798 1:185877892-185877914 TAGGGCCTACTTGAGGGAGGAGG - Intronic
918858709 1:189793729-189793751 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
919195393 1:194278519-194278541 CAGGCCCTTCTTGAAGGTGGAGG + Intergenic
919389530 1:196964820-196964842 TGGGGCCTTCTTGAGGGTGGAGG + Intergenic
919965086 1:202515130-202515152 TGGGGTCTACTTGAGGGAGGAGG + Intronic
920763024 1:208804123-208804145 TGGGGTCTACTTGAGGGCGGTGG - Intergenic
921095142 1:211879923-211879945 CAGGGCCTACTTGAAGGTGGGGG - Intergenic
921185458 1:212665922-212665944 CATGGTTTTCTTGATGGGAGAGG - Intergenic
921337014 1:214098377-214098399 CAGGGTCTATTTGAGGGTGAAGG + Intergenic
921372255 1:214436231-214436253 CAGGGCCTACTTGAGGATGGAGG + Intronic
921751360 1:218798036-218798058 CAGTGTCTTCTTGAGGGTGGAGG - Intergenic
922114436 1:222597917-222597939 CACGGGCTACTTGAGGGTGGAGG - Intergenic
922251040 1:223848596-223848618 TAGGGCCTACTTGAGGGTGGAGG - Intergenic
922259649 1:223926775-223926797 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
922972213 1:229752190-229752212 CAGGGTCTTTTTCAGGGAAGAGG - Intergenic
923524284 1:234760255-234760277 CATGGACTTCTTGGGGGTGGCGG - Intergenic
923822031 1:237455405-237455427 CAGGGCCTACTTGAGGGTGGAGG + Intronic
924185107 1:241480481-241480503 TAGGGTCTATTTGAGGGTGGAGG - Intergenic
924340812 1:243029331-243029353 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
924388849 1:243528477-243528499 CAAGGCCTACTTGAGGGTGGAGG - Intronic
1062822892 10:548211-548233 CAGGGCTTTCCTGTGGGGGGGGG - Intronic
1062944154 10:1447732-1447754 CAGGGCCTGCTTGAGGTTGGAGG - Intronic
1063267009 10:4463414-4463436 CTGGGTCTACTAGAGGGGGGAGG - Intergenic
1063448034 10:6132450-6132472 CGGGGCCTCCTTGAGGGTGGAGG + Intergenic
1063526838 10:6795092-6795114 TAAGGTCTGCTTGATGGGGGAGG + Intergenic
1064102367 10:12474751-12474773 CTGGGTCTGCTTGAGGGTAGAGG - Intronic
1064293153 10:14053712-14053734 AAGGGTCTTTTTGATGGAGGTGG - Intronic
1064366568 10:14714016-14714038 CAGGGCCTACTTGAGAGTGGAGG + Intronic
1064808352 10:19163489-19163511 GGGGGTCTACTTTAGGGGGGAGG + Intronic
1064818943 10:19301700-19301722 CGGGACCTTCTTGAGGGTGGAGG + Intronic
1064824650 10:19383206-19383228 CAGGGCTTACTTGAGGGTGGAGG - Intronic
1064874022 10:19972431-19972453 CAGAGTCTACTTGAGGGTGAAGG + Intronic
1064898346 10:20264302-20264324 TGGGGTCTGCTTGAGGGGGAAGG + Intronic
1065194184 10:23246187-23246209 CAGGGCCTATTTGAGGGTGGAGG + Intergenic
1065232785 10:23615611-23615633 TGGGGTCTGCTTGAGTGGGGAGG - Intergenic
1065368369 10:24956293-24956315 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1065602062 10:27379067-27379089 CGGGGCCTACTTGAGGGTGGAGG - Intergenic
1065828240 10:29591314-29591336 CAGGTTCTTCTTGAGGGCATGGG - Intronic
1065949471 10:30638886-30638908 CAGGTTCTTCTTGAGGGCACGGG + Intergenic
1066156343 10:32682176-32682198 CAGGGCTTACTTGAGGGTGGAGG - Intronic
1066161350 10:32734426-32734448 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1066174160 10:32886630-32886652 AGGGGTCTACTTGAGGGGGGAGG + Intergenic
1066218091 10:33308198-33308220 CAGGGTCTACTTGAGGATGGAGG + Intronic
1066462700 10:35625449-35625471 CAGGGCCTACTTGAGGATGGAGG - Intergenic
1066735659 10:38476076-38476098 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1067162651 10:43840380-43840402 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1067654879 10:48183950-48183972 CAGAGCCTACTTGAGGGAGGAGG + Intronic
1067915358 10:50392019-50392041 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1068025266 10:51634927-51634949 CAGGGCATACTTGAGGGAGGTGG + Intronic
1068255181 10:54500283-54500305 AAGGGCCTACTTGAAGGGGGAGG + Intronic
1068370250 10:56103817-56103839 CGGGGTCTCCTGGAGGGTGGTGG - Intergenic
1068825353 10:61431885-61431907 CAGAGACTACTTGAGAGGGGAGG - Intronic
1068952173 10:62788626-62788648 CAGGGGCCTGTTGAGGGGTGGGG + Intergenic
1069849925 10:71397825-71397847 CAGGGACTTGATGAGGGGAGGGG - Intronic
1070539159 10:77403758-77403780 CAGGGTCTTCTGCAGGAGGCTGG - Intronic
1070871124 10:79754445-79754467 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1070872003 10:79763707-79763729 CATGGCCTACTTGAGGGTGGAGG - Intergenic
1071167768 10:82826745-82826767 CTGGGCCTACTTGAGGTGGGAGG + Intronic
1071343546 10:84669928-84669950 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1071380200 10:85051877-85051899 TGGGGTCTACTTGATGGGGGAGG + Intergenic
1071410539 10:85388173-85388195 TGGGGTCTACTTGAGGGGGGAGG + Intergenic
1071638058 10:87276653-87276675 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1071638921 10:87285879-87285901 CATGGCCTACTTGAGGGTGGAGG - Intergenic
1071656317 10:87452073-87452095 CATGGCCTACTTGAGGGTGGAGG + Intergenic
1071657186 10:87461299-87461321 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1072107716 10:92290643-92290665 GAGGTTCTTCTTGAGGGGGCGGG - Intronic
1072573718 10:96680462-96680484 CAGGGCATTCCTGAGGGTGGAGG - Intronic
1073992122 10:109273787-109273809 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1074888611 10:117715795-117715817 CAGGGGCTTGTTGGGGGGTGAGG + Intergenic
1075188095 10:120281575-120281597 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1075543434 10:123335306-123335328 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1075684555 10:124354383-124354405 CAGGGTCTGCTTTAGGAGTGAGG + Intergenic
1075707288 10:124509031-124509053 CAGGGCCTACCTGAGGGTGGAGG - Intronic
1075828212 10:125378880-125378902 CAGGGCCTTCTTGAGAGTGGAGG - Intergenic
1075840556 10:125498729-125498751 CAGGGCCTACTTCAGGGTGGAGG - Intergenic
1076535423 10:131173973-131173995 GAGGGGCTTCTTGAGGGGTTTGG - Intronic
1076769189 10:132653893-132653915 CAGCGGCTTCTTGAGGGGAGGGG - Intronic
1076784487 10:132743074-132743096 CAGGGTCACGTTGAGAGGGGAGG + Intronic
1076967540 11:103011-103033 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1077600104 11:3568720-3568742 CTGGGTTTTCTGGAAGGGGGAGG + Intergenic
1077671589 11:4162628-4162650 CAGGTCCTACTTGAGGGTGGAGG - Intergenic
1078011720 11:7577476-7577498 CTTGGAGTTCTTGAGGGGGGAGG + Intronic
1078694287 11:13614432-13614454 CAGGGCCTGCTTGAGGTTGGAGG - Intergenic
1079663768 11:23076836-23076858 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1079777346 11:24548538-24548560 CAGTGACTACTTGAGGGTGGAGG + Intronic
1079809766 11:24982590-24982612 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1079823896 11:25166178-25166200 CAGGGCATACTTGAGGGTGGAGG - Intergenic
1079879998 11:25915099-25915121 CAGGGCCTACTTGGGGGTGGTGG + Intergenic
1080195907 11:29608461-29608483 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1080500784 11:32869118-32869140 TAGGGTCTACTTGAGGGTGGAGG + Intergenic
1080777373 11:35398498-35398520 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1080870395 11:36231735-36231757 CAGGGTTTTTTTGGGGGGGAGGG + Exonic
1081409339 11:42738227-42738249 CGGGGTCCTGTTGTGGGGGGAGG + Intergenic
1081547565 11:44082642-44082664 CAGGGTGTTCTTTAGGATGGTGG + Intronic
1081868387 11:46372112-46372134 CAGGGGCTTCATGAGCGGGGAGG - Exonic
1082057384 11:47830694-47830716 TAGGGTCTACTTGAGGGTGGAGG + Intronic
1082107829 11:48239924-48239946 TAGGGACTACTTGAGGGGGGAGG - Intergenic
1082193105 11:49270734-49270756 TAGGGCCTACTTGAGGGTGGAGG - Intergenic
1082641806 11:55670010-55670032 AGGGGTCTACTTGAGGGTGGAGG - Intergenic
1082712064 11:56565105-56565127 TGGGGTCTTCTTGAGGGGGGAGG - Intergenic
1082921310 11:58497693-58497715 CAGGGCCTACTTGAGGGTGAAGG + Intergenic
1083820754 11:65170141-65170163 CAGGGCCTTCCTGGGGGGCGAGG - Exonic
1083911634 11:65713310-65713332 CAGGGTCTTCCTTTGGGGCGGGG - Intronic
1084256017 11:67943337-67943359 CTGGGTTTTCTGGAAGGGGGAGG + Intergenic
1084383497 11:68828291-68828313 CAGGGGCTTCTTGGAGAGGGGGG + Intronic
1084450395 11:69233384-69233406 CAGGGTCTGCCTGAGGGAAGGGG + Intergenic
1084816742 11:71651973-71651995 CTGGGTTTTCTGGAAGGGGGAGG - Intergenic
1085006913 11:73100242-73100264 AAGGGTTTTCTTGAGAAGGGAGG - Intronic
1085223226 11:74894248-74894270 CAGGATCTACTTGAGGGTAGAGG + Intronic
1085678902 11:78552148-78552170 TGGTGTCTTCCTGAGGGGGGAGG - Intronic
1086303381 11:85453933-85453955 CAGGGCCTGCTTAAGGGTGGAGG - Intronic
1086673024 11:89570333-89570355 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
1086740328 11:90360054-90360076 TGAGGTCTTCTTGAGGGTGGAGG - Intergenic
1087167111 11:95016003-95016025 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1087360387 11:97151280-97151302 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
1087440360 11:98176222-98176244 CAGGGCGTACTTGAGGGTGGAGG + Intergenic
1087466688 11:98516835-98516857 CAGGGTCTACTTGAAGGCGGAGG - Intergenic
1087873117 11:103324327-103324349 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1088418522 11:109617181-109617203 CAAGGCCTACTTGAGGGTGGAGG + Intergenic
1088418536 11:109617303-109617325 CAAGGCCTACTTGAGGGTGGAGG + Intergenic
1088420362 11:109638366-109638388 TGGGATCTACTTGAGGGGGGAGG - Intergenic
1088453184 11:110004131-110004153 CAGGGCCTATTTGAGGGTGGAGG - Intergenic
1088508285 11:110548348-110548370 CAGGGCCTACTTGAGGGTGAAGG + Intergenic
1088620390 11:111675907-111675929 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1089455162 11:118621604-118621626 GAGGGGCGTCTTGAGGAGGGTGG + Intronic
1089629754 11:119777142-119777164 TAGGGTCTCCTTAAGGGTGGAGG - Intergenic
1089687524 11:120165827-120165849 TGGGGTCTTCTTGAGAGGGAAGG - Intronic
1089884902 11:121810777-121810799 CAGTGCCTACTTGAGGGTGGAGG - Intergenic
1089916158 11:122159051-122159073 CAGGGTCTTTGTGTTGGGGGAGG + Intergenic
1090217067 11:124978008-124978030 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1090538026 11:127667390-127667412 TGGGGTCTGCTTGAGGGTGGAGG + Intergenic
1091786195 12:3244666-3244688 CATGGTCCCCTTTAGGGGGGTGG - Intronic
1091901780 12:4149886-4149908 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1092426247 12:8378080-8378102 CTGGGTTTTCTGGAAGGGGGAGG + Intergenic
1092574124 12:9760543-9760565 CAGGTTCTTCTTCAGGGAAGAGG - Intronic
1093403228 12:18772970-18772992 CAGGGCCTGCTTGAGGGTAGAGG + Intergenic
1093497002 12:19769547-19769569 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1094079598 12:26518356-26518378 CAGGTCCTACTTGAGGGTGGAGG + Intronic
1094171121 12:27493166-27493188 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1094255537 12:28421363-28421385 CAGGGCCTACCTGAGGGTGGAGG - Intronic
1094407462 12:30132726-30132748 CAGGGTCTACTCGAGGGTGGAGG + Intergenic
1094485051 12:30918709-30918731 TGGGGTCTTCTTGAGGGTGGAGG - Intergenic
1094722591 12:33079591-33079613 GAGGGTCTACTTGAGGGTAGAGG - Intergenic
1095099846 12:38169142-38169164 TGGGGTCTACTTGATGGGGGAGG - Intergenic
1095426291 12:42077888-42077910 CAGGGTCTTGTCGTGGGGTGGGG + Intergenic
1095515792 12:43003845-43003867 TGGGGTCTACTTGAGGTGGGTGG + Intergenic
1095575094 12:43727670-43727692 CATGGCCTACTTGAGGGTGGAGG + Intergenic
1095617370 12:44206800-44206822 AAGGGCCTACTTGAGTGGGGAGG + Intronic
1095620068 12:44242294-44242316 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1095836380 12:46643870-46643892 TGGGGTCTTCTTGAGGGTAGAGG + Intergenic
1096048606 12:48586516-48586538 CAGTGTCTCCTGGAGGGGGATGG - Intergenic
1096362643 12:51001373-51001395 TGGGGTCTACTTGATGGGGGAGG + Intronic
1096611359 12:52804078-52804100 GAGGGTCTTGGTGAGGTGGGAGG + Intergenic
1096953569 12:55502181-55502203 CAGAGCCTGCTTGAGGGTGGAGG + Intergenic
1097292887 12:57934069-57934091 TGGGGTCTGCTTGAGGGTGGAGG - Intergenic
1097340479 12:58431661-58431683 CAGGGACTTGTTGAGGGGTGGGG + Intergenic
1097557644 12:61159598-61159620 TGGGGTCTACTTGATGGGGGAGG + Intergenic
1098399750 12:70061911-70061933 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1098603055 12:72356370-72356392 CGGGGTCTACTTGAGGGTGGAGG + Intronic
1098785258 12:74745303-74745325 CAGGGCCTGCTTGAGGGAGGAGG - Intergenic
1098888423 12:75983588-75983610 CAAGGTTTTTTTGAGGGGTGGGG - Intergenic
1098938896 12:76512127-76512149 TGGGGTCTACTTGAGCGGGGAGG - Intronic
1098989910 12:77054061-77054083 CAGGGCCTACTTGAGGGTAGAGG + Intronic
1099372035 12:81846099-81846121 TGGGGCCTTCTTGAGGGTGGAGG - Intergenic
1099404177 12:82239675-82239697 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1099634145 12:85192161-85192183 CAGGGCCTACTTGAGGGTGAAGG - Intronic
1099663197 12:85593162-85593184 CTGGGGCTACTTGAGGGTGGAGG - Intergenic
1100001771 12:89845186-89845208 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1100129091 12:91468235-91468257 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1100344007 12:93709415-93709437 TCGGGTCTACTTGAGGGGAGAGG - Intronic
1100454507 12:94739384-94739406 CCGGGTCTACTTGAGGGTGGCGG - Intergenic
1100660986 12:96698665-96698687 CAGGGCCTGCTTGAGGGTGCAGG + Intronic
1101039786 12:100743868-100743890 CAAGGCCTACTTGAGGGTGGAGG - Intronic
1101916564 12:108900554-108900576 AAGGGAGTTCTTGTGGGGGGAGG - Exonic
1102135290 12:110569034-110569056 CTGGCTTTTTTTGAGGGGGGGGG - Intronic
1102150611 12:110687320-110687342 CGGGGTCTCCTTAAGTGGGGTGG + Intronic
1102216812 12:111167387-111167409 CATGGGCTTCTCGAGGGGGAGGG + Intronic
1102649557 12:114429523-114429545 CAGGGCTTACTTGAGGGTGGAGG + Intergenic
1103032970 12:117632692-117632714 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1103051778 12:117786486-117786508 TAGGGTCTGCTTAAGGGTGGAGG - Intronic
1103511557 12:121478341-121478363 AAGGATCTACTTGAGGGTGGAGG - Intronic
1104155787 12:126130401-126130423 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1104240773 12:126986908-126986930 CAGGGTCGACTTGAGGGTGGAGG + Intergenic
1105008626 12:132739092-132739114 CAGGGCCTGGTTGAGGGTGGAGG + Intronic
1105313443 13:19234960-19234982 CAGGGCCTACTTGAGGCTGGAGG + Intergenic
1106716238 13:32391345-32391367 CAGGGACTTCTGGAGCTGGGTGG + Intronic
1106742030 13:32654689-32654711 CAGCATCTTCTTGACGGTGGAGG - Intronic
1106749850 13:32751034-32751056 CAAAGCCTTCTTGAGGGTGGAGG - Intronic
1107330311 13:39292639-39292661 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1107787238 13:43969292-43969314 CAGGGGCTTCATGAGGGGGGAGG - Intergenic
1108141778 13:47431035-47431057 TAGGGCCTACTTGAGGGTGGAGG - Intergenic
1108866035 13:54923736-54923758 CTGGGTCTTGTTGGGGGGGTGGG + Intergenic
1108982574 13:56537339-56537361 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1108983728 13:56556172-56556194 CAGGGTTTTTTTGGGGGCGGGGG + Intergenic
1109760010 13:66815748-66815770 CAGGGCCTACTTGAGGCTGGAGG + Intronic
1110020704 13:70466745-70466767 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1110779876 13:79452664-79452686 CTGGGGCTTCTTGTGGGAGGAGG - Intergenic
1110829989 13:80019603-80019625 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
1110866469 13:80401647-80401669 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1110875242 13:80501558-80501580 CAGGACCTACTTGAGGGCGGAGG + Intergenic
1110992054 13:82054572-82054594 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1111064262 13:83070418-83070440 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1111179405 13:84642208-84642230 CAGGTCCTACTTGAGGGTGGCGG + Intergenic
1111224683 13:85253883-85253905 CAGGGGCCTGTTGAGGGGTGGGG + Intergenic
1111278175 13:85980370-85980392 CAGGTACTTCTTAAGGGTGGAGG + Intergenic
1111288672 13:86131499-86131521 CTGGGACTACTTGAGGGTGGAGG - Intergenic
1111350154 13:87017829-87017851 GGGGGTCTACTTGAGGGTGGAGG - Intergenic
1111604256 13:90517703-90517725 GAGTGTCTTATTGAGGGAGGTGG + Intergenic
1111972399 13:94930418-94930440 CAGGGCCTACTTGAGGGTGGCGG - Intergenic
1112783229 13:102924987-102925009 CAGGGCTTACTTGAGGGTGGAGG + Intergenic
1112840598 13:103572994-103573016 CAGAGTCTTGTTGGGTGGGGTGG + Intergenic
1113059744 13:106309430-106309452 CAGGGCCTGCTGGAGGGTGGGGG + Intergenic
1113178505 13:107596659-107596681 CGGGGCCCTGTTGAGGGGGGTGG + Intronic
1113363255 13:109651538-109651560 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1113394559 13:109934513-109934535 TATGGTCTACTTGAGTGGGGAGG - Intergenic
1113433242 13:110268347-110268369 CAGGGATTTCTTGGGTGGGGAGG + Intronic
1113552519 13:111204202-111204224 CAGGGTCTGCTAGAGGTGTGGGG + Intronic
1113988250 13:114336818-114336840 TGGGGTCTACTTGAGGGGGGAGG + Intergenic
1114008469 14:18340337-18340359 CAGGAGCTTCTTGAGGGCAGGGG - Intergenic
1114046446 14:18880524-18880546 CAGGGGCCTCTGGAGGGGGCGGG + Intergenic
1114117766 14:19638926-19638948 CAGGGGCCTCTGGAGGGGGCGGG - Intergenic
1114594845 14:23902841-23902863 CAGAGTCTACTTGAGGGCGGAGG - Intergenic
1114760268 14:25306544-25306566 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
1115391757 14:32861978-32862000 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1115735717 14:36327114-36327136 CAGGGTCTGCTGGAGGGAGGAGG - Intergenic
1116358735 14:43965696-43965718 CAGGGACTACTGGAGGGTGGAGG - Intergenic
1116496962 14:45572682-45572704 TGGGGTCTACTTGAGAGGGGAGG - Intergenic
1116553710 14:46275671-46275693 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1116568597 14:46485522-46485544 CAAGGCCTACTTGAGGGTGGAGG - Intergenic
1116737874 14:48717179-48717201 CAGGGCCTACCTGAGGGTGGAGG - Intergenic
1116816606 14:49590023-49590045 CAGGGCCTACTTGAGGGTAGAGG + Intronic
1117693298 14:58331997-58332019 CAGGGTTTTTTGGGGGGGGGGGG - Intronic
1117719873 14:58618951-58618973 GAGGGTCTTATGGAGGGAGGAGG + Intergenic
1117838638 14:59833688-59833710 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1118598819 14:67457115-67457137 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1118633723 14:67728690-67728712 CAGGGATATCTTGTGGGGGGGGG + Intronic
1118680428 14:68236045-68236067 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1118815537 14:69311024-69311046 CATGGTCTTATTGAGGGGACAGG + Intronic
1119115984 14:72021932-72021954 TGGGGTCTACTTGAGGGTGGGGG - Intronic
1119276496 14:73361616-73361638 AGGGGTCTACTTGAGTGGGGAGG - Intronic
1119489862 14:75022151-75022173 CTGGGCCTACTTGAGGGTGGAGG + Intronic
1119906590 14:78309458-78309480 CAGGGACTACTTGAGGGTGGAGG - Intronic
1120377852 14:83732320-83732342 TGGGGTCTACTTGAGGAGGGAGG + Intergenic
1121068262 14:90990863-90990885 TAGGGCCTACTTGAGGGGAGAGG + Intronic
1121133758 14:91475090-91475112 CAGGTCCTTCTTAAGGGAGGAGG - Intronic
1121163790 14:91771921-91771943 CAGAGCCTACTTGAGGGTGGAGG + Intronic
1121572020 14:94953349-94953371 CAGGGTCTACTTGATGGAGTGGG - Intergenic
1121798022 14:96751870-96751892 CAGGGCCTACTTGGGGGTGGAGG + Intergenic
1122229264 14:100297379-100297401 CAGGGGCTGCCTGAGGGGGCCGG + Intronic
1122898582 14:104772637-104772659 CAGGGGCTTCCTGAGTGGGTGGG + Intronic
1202939746 14_KI270725v1_random:136110-136132 CAGGGTCCTGTCGGGGGGGGTGG - Intergenic
1123769664 15:23516097-23516119 GAGGATCTACTTGAGGGTGGAGG - Intergenic
1124170358 15:27367191-27367213 CAGGGTGTCCTTGTAGGGGGAGG - Intronic
1124178496 15:27450158-27450180 CAGGTTTTTCTTGTGTGGGGAGG - Intronic
1124447850 15:29754356-29754378 TGGGGTCTACTTGAGGGGGGAGG + Intronic
1124510025 15:30316011-30316033 CAGGGGCTTCATGAAGAGGGTGG - Intergenic
1124634480 15:31356181-31356203 CAGGTCCTACTTGAGCGGGGAGG - Intronic
1124732865 15:32214542-32214564 CAGGGGCTTCATGAAGAGGGTGG + Intergenic
1124864739 15:33478088-33478110 CAGTGTCCACTTGAGGGGGTTGG + Intronic
1125780755 15:42264858-42264880 CTGGGCCTACTTGAGGGTGGAGG - Intronic
1125984172 15:44033227-44033249 CTGGGTCTACTTGAAGGGGGAGG + Intronic
1126213590 15:46128818-46128840 CAGGGCCTATTTGAGGGTGGAGG - Intergenic
1126223767 15:46245490-46245512 TGGGGTCTGCTTGATGGGGGAGG - Intergenic
1126280845 15:46947747-46947769 CAAGGTCTTCTTGAGAATGGAGG - Intergenic
1126467916 15:48977254-48977276 CAGGGCCTGCCTGAGGGTGGAGG - Intergenic
1126502485 15:49361401-49361423 CAGGACCTACTTGAGGGAGGAGG - Intronic
1126639494 15:50810987-50811009 TGGGGTCTTCTTGAGAAGGGTGG + Intergenic
1127058520 15:55157513-55157535 CTGGGCCTACTTGATGGGGGAGG + Intergenic
1127320647 15:57841867-57841889 CAGGGCCTTCTTGAGGGTGGAGG - Intergenic
1127751361 15:62048254-62048276 CAGGGGCCTGTTGGGGGGGGTGG - Intronic
1128444136 15:67741640-67741662 CACGGGCTTCTTGGGGGTGGGGG + Intronic
1129585425 15:76858621-76858643 CAGGGCCTACTTGAGGGTAGAGG - Intronic
1129956597 15:79642773-79642795 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1129965684 15:79733419-79733441 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1131062937 15:89415414-89415436 CAGGCTCTTAGTGAGGGGAGTGG + Intergenic
1131956177 15:97738678-97738700 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1132697115 16:1206965-1206987 CAGGGGCGTGTTGAGGGTGGAGG - Intronic
1133372086 16:5252836-5252858 CTGGGTTTTCTGGAAGGGGGAGG - Intergenic
1133657310 16:7878315-7878337 CAGGATCTACTTGAGGGAGGAGG + Intergenic
1133710909 16:8400359-8400381 TGGGGTCCACTTGAGGGGGGAGG + Intergenic
1133876640 16:9741011-9741033 CAGGGTCAGCTTGAGTGGGTGGG - Intergenic
1134338216 16:13320824-13320846 CAGGGAGGTCTAGAGGGGGGTGG - Intergenic
1134793724 16:17014733-17014755 CAGGGCCTACTTGAGCAGGGAGG - Intergenic
1134812458 16:17179223-17179245 CAGGGTCTCCTTGAGGAGGCAGG + Intronic
1134955761 16:18381500-18381522 CAGGGGCTAGGTGAGGGGGGAGG + Intergenic
1135469305 16:22715194-22715216 CAGGGCCTACTTGTGGGTGGAGG + Intergenic
1135469636 16:22718601-22718623 CTGGGGCCTCTTGAGGGGTGAGG - Intergenic
1136601380 16:31292417-31292439 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1136678016 16:31931959-31931981 CAGGACCTACTTGAGGGTGGAGG + Intergenic
1137463315 16:48685759-48685781 CAGGGCCTGCTTGGGGGTGGAGG + Intergenic
1137896215 16:52215821-52215843 CGGGGTCTTTTGGAGGGTGGAGG - Intergenic
1138760688 16:59540305-59540327 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1139154189 16:64421303-64421325 CAGGGTCTACTTGAGGGTGTAGG - Intergenic
1139949690 16:70663025-70663047 CAGGGGCTGCTTGGGGGGGGGGG - Exonic
1140740139 16:77934308-77934330 CAGGGTCATCTTGGGGGTGTGGG - Intronic
1140942129 16:79731983-79732005 CAGGGCCCACTTGAGGGTGGAGG + Intergenic
1141348719 16:83273338-83273360 CAGGGCCTACTTGAGGGTGAAGG - Intronic
1141881721 16:86864587-86864609 CAGGGCCTCCTGGAGGGTGGAGG - Intergenic
1141950525 16:87336380-87336402 CAGGGCCCTCTTGGTGGGGGAGG + Intronic
1142180753 16:88668394-88668416 GGGGGTCCACTTGAGGGGGGAGG - Intergenic
1142317839 16:89360059-89360081 GGGGGTCTACTTGAGGGGAGAGG - Intronic
1142453142 16:90196132-90196154 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1142686023 17:1577415-1577437 CAGGGTCTGAGGGAGGGGGGCGG - Intronic
1142789965 17:2256227-2256249 TAGGGTTTTTTTGAGGGGTGAGG + Intronic
1144007140 17:11111000-11111022 CTGGGACTTTTTGAGGGGTGGGG + Intergenic
1144428057 17:15163650-15163672 CAGGGTCTACTTGAGGATTGAGG + Intergenic
1145242776 17:21249429-21249451 CAGGGTCCTCTGGGGAGGGGAGG - Intronic
1146532171 17:33617486-33617508 CAGGGACTACTGGAGGGTGGAGG + Intronic
1146934113 17:36800654-36800676 CAGGATCTTCCTGAGGCAGGAGG - Intergenic
1147028296 17:37608990-37609012 GAGGGTCCTCTTGGGGTGGGGGG - Intronic
1147645999 17:42034267-42034289 CAGCTTCTTCTTCAGAGGGGAGG + Exonic
1148487905 17:48003205-48003227 CAGCGTCTCCTGGAAGGGGGAGG + Intergenic
1148609095 17:48952107-48952129 CATGGTCTTTTTGCGGGGAGGGG + Intergenic
1149133943 17:53342165-53342187 CAGGGCCTACTTGAGGTTGGAGG + Intergenic
1149907710 17:60541834-60541856 GAGGGTCTTCTTGCTGGTGGGGG - Intergenic
1149940429 17:60859348-60859370 CGGGGCCTACTTGAGGGAGGAGG - Intronic
1150048469 17:61936152-61936174 TAGGGTCTACTTGAGGGTGGAGG + Intergenic
1150057147 17:62028380-62028402 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1150171462 17:63000067-63000089 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1150634194 17:66901447-66901469 GAGTGGCTTCTGGAGGGGGGTGG - Intergenic
1150846777 17:68666471-68666493 TGGGGTCTACTTGAGGGGGGAGG - Intergenic
1150871806 17:68920238-68920260 TGGGGTCTACTTGATGGGGGAGG + Intronic
1151021241 17:70619758-70619780 TAGGGCCTACTTGAGGGTGGAGG - Intergenic
1151060714 17:71090576-71090598 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1151069811 17:71196040-71196062 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1151129551 17:71882237-71882259 CAAGGTTTTCTTTTGGGGGGGGG + Intergenic
1151530118 17:74698693-74698715 CAGGGCCTACTTGAGGATGGAGG + Intronic
1151535530 17:74737065-74737087 CAGGGTCTGCGTGAAGGGGCGGG - Exonic
1151622846 17:75257279-75257301 CAGGTTTTTTTTGGGGGGGGGGG - Intronic
1151899233 17:77000864-77000886 CAGGGTCTATTTGAGGGTGGCGG + Intergenic
1152161998 17:78674694-78674716 CAGGGTCCTGTGGAGGGGCGGGG + Exonic
1152260063 17:79261922-79261944 CTGGGGCTTGTGGAGGGGGGAGG + Intronic
1152506693 17:80754158-80754180 CAGGGCGATCTTGATGGGGGTGG - Exonic
1152575144 17:81136612-81136634 CTGGGCCTTCTAGAGGGGAGGGG - Intronic
1152722395 17:81929333-81929355 CAGAATCTTCTTGGGGTGGGTGG + Intergenic
1152738437 17:82008703-82008725 CAGGGTCTCCATGGGGGGGAGGG - Intronic
1153227707 18:2910627-2910649 CAGGGCCTCCTGGAGGGGGGTGG + Intronic
1153672361 18:7424045-7424067 CTGGGTCTACTTGACGGGAGAGG - Intergenic
1153723794 18:7935823-7935845 CAGGGTCTACTTTAGGGTGGAGG - Intronic
1153785921 18:8535351-8535373 CTGGGTCTACTTGATGGGGGAGG + Intergenic
1155257174 18:24009037-24009059 CAGGGTCTGCTTGAGGGTAGAGG + Intronic
1155262509 18:24058148-24058170 CAGGGTCTACTTGAGGGTGGAGG + Intronic
1155576917 18:27258618-27258640 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1155777870 18:29791158-29791180 TAGGGTCTGCTTGAGGAAGGAGG - Intergenic
1155931282 18:31711411-31711433 CTGGGTCTACTTGAGGATGGAGG - Intergenic
1156032713 18:32731473-32731495 TGGGGTCTACTTGAGGGGGAGGG + Intronic
1156067872 18:33166933-33166955 CAAGGCCTACTTGAGGGTGGAGG - Intronic
1156618736 18:38822346-38822368 CAGGGCCTACTTGAAGGTGGAGG + Intergenic
1156928491 18:42612258-42612280 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1157084341 18:44563632-44563654 CGGGGCCTGCTTGAGGGAGGAGG + Intergenic
1157168857 18:45383879-45383901 CAGGGGCTTCTTGGGGGTGCAGG - Intronic
1157170193 18:45396824-45396846 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1157778238 18:50414109-50414131 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1158313434 18:56184314-56184336 CGGGGCCTGCTTGAGGGTGGAGG - Intergenic
1158566860 18:58561470-58561492 CAGGGTCTGCTTTTGGGGGCGGG - Intronic
1158960470 18:62583910-62583932 CAGGGTCATCTGAAGGGGCGAGG - Intronic
1159501413 18:69275626-69275648 CTGGGTCTAGTTGAGGGCGGAGG - Intergenic
1159905538 18:74087390-74087412 CAGGTCCTACTTGAGGGTGGAGG - Intronic
1160122217 18:76140766-76140788 CAGGGTAATCTTGAGGGATGGGG + Intergenic
1160280905 18:77489764-77489786 CAGGGCCTACTGGAGGGTGGAGG + Intergenic
1160319657 18:77878414-77878436 CAGGGCCTACTGGAGGGTGGAGG - Intergenic
1160507962 18:79437708-79437730 CAGGCTCTGCCTGAGGGGGAGGG + Intronic
1160644344 19:172634-172656 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1161482438 19:4517693-4517715 CAGGGTCTGCATGGGGGCGGGGG + Exonic
1161575061 19:5050508-5050530 CAGGGTCTTCCTGGGTGGGGTGG + Intronic
1162554704 19:11379602-11379624 CAGGGCCTTCTGCAGGGTGGTGG - Intronic
1163003913 19:14385602-14385624 CAGCGTCTTCCTGTGGGAGGGGG + Intronic
1163181040 19:15602176-15602198 CAAGGCCTACTTGAGGGTGGAGG - Intergenic
1163965836 19:20746450-20746472 CAGGGTCTACTTGAGAGTAGAGG - Intronic
1164425215 19:28135318-28135340 CAGGGGCCTATTGAGGGGTGGGG - Intergenic
1164989576 19:32674677-32674699 TAGGGTCTGCTGGAGGGGAGCGG - Intronic
1165658499 19:37554148-37554170 CAGGGCCTGCTTGAGAGTGGAGG - Intronic
1165782432 19:38442208-38442230 CAGGGCCTTCCTGTGGGGTGGGG + Intronic
1165992764 19:39825777-39825799 CAGGGTCATCAGGAGGCGGGAGG + Exonic
1166266289 19:41686562-41686584 CAGGGTCTTTTTCAGGGGGAGGG + Intronic
1166369657 19:42293800-42293822 AAAGGTCTTCTTCAGGGGCGGGG - Exonic
1166551723 19:43670009-43670031 CAGGGTCTAATTGAGGGGGTTGG - Intronic
1167254666 19:48419890-48419912 GAGGGGATTCTTGCGGGGGGCGG + Intronic
1167293886 19:48638363-48638385 GAAGGTCTTCATGGGGGGGGGGG + Intronic
1167471121 19:49677038-49677060 CCGGGTCGACTTGAGGGGGCGGG + Intronic
1167517621 19:49932548-49932570 CAGCTCCTTCTTGAGGAGGGAGG - Exonic
1167989166 19:53343159-53343181 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1168516169 19:57011876-57011898 CGGGGACTTCTAGAGGGGAGAGG - Intergenic
1202709040 1_KI270714v1_random:6438-6460 CAGGGTCACCCTGAGAGGGGAGG + Intergenic
924959622 2:22255-22277 TGGGGTCTGCTTGAGGGGGGAGG - Intergenic
924966461 2:81007-81029 CAGAGTCTCCTTCAGGTGGGGGG - Intergenic
925322512 2:2985423-2985445 CAGGGACTACTAGAGGAGGGAGG + Intergenic
925565728 2:5252191-5252213 TGGGGTCTACTTGAGGGCGGAGG - Intergenic
925810920 2:7699660-7699682 CAGGGCCTACTGGAGGGTGGAGG - Intergenic
926006075 2:9374382-9374404 CAGGGCCTTCCTGGGGGAGGAGG + Intronic
926072056 2:9904261-9904283 AAGGGCCTACTTGAGGGTGGAGG - Intronic
926557231 2:14373279-14373301 CAGGGAGTACTTGAGGGTGGAGG + Intergenic
926981864 2:18580925-18580947 TAGGGCCTACTTGAGGGTGGAGG + Intronic
927381964 2:22489596-22489618 CAGGATCTACTTGAGGGTAGAGG + Intergenic
927384966 2:22522207-22522229 TGGGGTCTGCTTGACGGGGGAGG + Intergenic
928057965 2:28077568-28077590 TAGGGTTTTTTTGAGGGGAGGGG + Intronic
928142722 2:28744607-28744629 TAAGGTCTACTTGAGGCGGGAGG + Intergenic
928470649 2:31572290-31572312 TGGGGTCTACTTGAGGGTGGAGG + Intronic
928669140 2:33582527-33582549 AGGGGTCTACTTGAGGGTGGAGG + Intergenic
930211299 2:48640515-48640537 CTGGGTCTACTTAAGGGTGGAGG + Intronic
930235644 2:48886529-48886551 TGGGGTCTACTTGAGTGGGGAGG + Intergenic
930365613 2:50435790-50435812 TGGGGCCTTCTTGAGGGTGGAGG + Intronic
930450496 2:51530623-51530645 TGGGGTCTTCTTGAGGGTGGAGG - Intergenic
930558218 2:52927224-52927246 CAGGGCCTATTTGAGGGTGGAGG + Intergenic
930563801 2:52994685-52994707 TGGGGTCTACTTGAGGGGGAAGG + Intergenic
930944077 2:57050116-57050138 TAGGGCCTTTTTGAGGGAGGAGG - Intergenic
930954645 2:57192473-57192495 AAGAATCTTCTTGAGGGTGGAGG - Intergenic
930954759 2:57193236-57193258 AAGAATCTTCTTGAGGGTGGAGG - Intergenic
931425749 2:62169476-62169498 CTGGGTCTACTTGAGGGTGGAGG - Intergenic
931441605 2:62294143-62294165 CAGGGTCTTCTTTTGTGGGAAGG - Intergenic
931543778 2:63358071-63358093 TGGGGTCTACTTGAGGGTGGAGG + Intronic
931547309 2:63403260-63403282 TGGGGTCTACTTGAGGGAGGAGG + Intronic
931577921 2:63739180-63739202 TGGGGTCTACTTGAGGTGGGAGG - Intronic
931627607 2:64271033-64271055 CAGGGTCTTGTTGAGGGTGATGG + Intergenic
931766881 2:65464711-65464733 CAGAGGCTTCTGGAGGGGAGTGG + Intergenic
931921672 2:67023785-67023807 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
932371487 2:71192596-71192618 TGGGGTCTACTTGACGGGGGTGG - Intronic
932506318 2:72235392-72235414 CAGGGCCTACTTGAAGGTGGAGG + Intronic
932532987 2:72557635-72557657 TAAGGTCTACTTGAGGGTGGAGG + Intronic
932743853 2:74314800-74314822 CAGTGTCTCCTTGAGGCTGGTGG - Intronic
932913304 2:75828318-75828340 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
933143779 2:78825757-78825779 CAGGGCCTACCTGAGGGAGGAGG + Intergenic
933355489 2:81205264-81205286 CAGGGCCTACTTGAGGGGAAAGG - Intergenic
933439321 2:82291405-82291427 TAGGGTCTACTTGAAGGTGGAGG - Intergenic
933451783 2:82463141-82463163 CAGGGTCTATTTGAGGGTGAAGG - Intergenic
933512683 2:83261232-83261254 CAGGGTCTACTTGAAGGTGGAGG + Intergenic
933598140 2:84303230-84303252 CAGGGTGTTCTTGAGGCAAGGGG + Intergenic
933761613 2:85676112-85676134 CAGGCTCTACTTGAAGGGGCAGG - Intergenic
934501234 2:94861761-94861783 CAGGCTCCTCTTCAGGGGCGGGG - Intergenic
934689340 2:96346351-96346373 TAGGGTCTACTTGAGGGTGGTGG + Intronic
935651758 2:105388092-105388114 TGGGGTCTACTTGAGCGGGGAGG + Intronic
936403084 2:112181172-112181194 CTGGGTCTACTTGAGGGGTTGGG + Intronic
936752767 2:115666050-115666072 CAAGGTCTACTTGAGGGTGGAGG - Intronic
936857124 2:116972054-116972076 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
937441953 2:121923277-121923299 GAGGGCCTACTTGAGGGTGGAGG - Intergenic
937521551 2:122718943-122718965 TAGGGTCTTCTTGAGGGTGGCGG + Intergenic
937731356 2:125234592-125234614 TGGGGTCTACTTGAGTGGGGAGG - Intergenic
937752881 2:125499231-125499253 CAGGGTCTACTTGAGAGGAGAGG - Intergenic
938095839 2:128462711-128462733 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
938215975 2:129515634-129515656 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
938623412 2:133082039-133082061 CAGGGCCTACTTGAGGGTGGAGG - Intronic
938850246 2:135252181-135252203 TAGGGTCTACTTGAGAGGGGAGG + Intronic
939341750 2:140905220-140905242 CAGGGGCTTGGGGAGGGGGGCGG - Intronic
939770465 2:146309445-146309467 CAGGGGCTTGTTGTGGGGTGGGG + Intergenic
940063614 2:149600574-149600596 CAGGGTCTATTTGAGGGTGGAGG + Intergenic
940527047 2:154829283-154829305 CAGGGCCTACTTGAGGGTAGCGG - Intronic
940535054 2:154930710-154930732 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
940628665 2:156209594-156209616 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
940674398 2:156711060-156711082 TGGGGGCTACTTGAGGGGGGAGG - Intergenic
941148683 2:161886945-161886967 CTGGGGCTTGTTGAGGGGTGGGG - Intronic
941653830 2:168122188-168122210 GAGGGCCTACTTGAGGGTGGAGG - Intronic
942719523 2:178935277-178935299 TGGGGTCTTCTTGAGGGTGGAGG - Intronic
942884276 2:180903308-180903330 TGGGGTCTGCTTGAGGTGGGAGG + Intergenic
942963990 2:181867147-181867169 TGGGGTCTCCTTGATGGGGGAGG + Intergenic
943155564 2:184170508-184170530 CAGGGACTACTAGAGGGGAGAGG + Intergenic
943205483 2:184887959-184887981 CAGGGCCTACTTGAGAGTGGAGG + Intronic
943316325 2:186392781-186392803 CAGGGCCTACTTGAAGGGGAAGG + Intergenic
943433397 2:187832284-187832306 TAGGGTTTTCTTTGGGGGGGGGG + Intergenic
943611476 2:190039675-190039697 CGGGGTCTACTTGAGGGGAGAGG - Intronic
943947472 2:194086629-194086651 TGGGGTCTACTTGAGGTGGGAGG - Intergenic
944021298 2:195107696-195107718 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
944269538 2:197765848-197765870 TGGGGTCTACTTGAGGGTGGAGG - Intronic
944304531 2:198164504-198164526 CAGGGTTTTTTTGGCGGGGGTGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944755180 2:202754360-202754382 CAGGGCCTGTTTGAGGTGGGAGG + Intronic
945020655 2:205567742-205567764 CAGAGTCTTCTTCTCGGGGGTGG - Intronic
945342723 2:208676388-208676410 CAGGGCCTACTTGAGGGTGGAGG - Intronic
945543944 2:211125344-211125366 TGGGGTTTTCTTGCGGGGGGTGG + Intergenic
945798588 2:214395683-214395705 CAGGGCCTACTTGAGGGTGGAGG - Intronic
945829593 2:214766978-214767000 CAGAGTCTACTTGAGTGTGGAGG - Intronic
946135067 2:217639226-217639248 CAGGGCCTACTTGAGGGTGCAGG + Intronic
946537370 2:220646508-220646530 CAGGGCCTGCTGGAGGGGAGTGG + Intergenic
946587850 2:221210382-221210404 TAGGGTCTACCTGAAGGGGGAGG + Intergenic
946591307 2:221251096-221251118 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
947060388 2:226157890-226157912 CAGGGTCTACTTGAGGGTAGAGG - Intergenic
947090212 2:226501492-226501514 TCGGGTCTACTTGAGTGGGGAGG - Intergenic
947427145 2:229994288-229994310 AAGGGCCTTCTTGGGGGGTGAGG - Intronic
947438440 2:230094248-230094270 TAGGGTCTACTTGAGGGTGGAGG + Intergenic
947485567 2:230545413-230545435 TAGGGTCTACTTGAGGGTGGAGG + Intergenic
947526042 2:230877300-230877322 CAGGGGCCTCTGGAGGAGGGAGG + Intronic
947928407 2:233941735-233941757 CAGGGTTTTATTGCGGCGGGGGG - Intronic
948043467 2:234923867-234923889 CAATGTCTACTTGAGGGTGGAGG - Intergenic
948118010 2:235507955-235507977 CAAGGCCTGCTTGAGGGTGGAGG - Intronic
948376753 2:237525821-237525843 CAGGGTCTTCCTGATGGGCTCGG + Intronic
948534445 2:238635554-238635576 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
948552282 2:238781615-238781637 CAGGGCCTGCTTGAGGGTGGAGG + Intergenic
949084580 2:242140797-242140819 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1169024641 20:2358861-2358883 CAGGGCCTACTTGGGGGTGGAGG - Intergenic
1170053002 20:12167328-12167350 TAGAGTCTACTTGAGGGTGGAGG - Intergenic
1170515407 20:17124433-17124455 TAGGGTCTACTTGAGGTTGGAGG + Intergenic
1170521195 20:17187313-17187335 CTGGATCTACTTGAGGGTGGAGG + Intergenic
1170653227 20:18261868-18261890 ACGGGTCTACTTGATGGGGGAGG + Intergenic
1171281557 20:23903692-23903714 TAGGGTCTACTTGAAAGGGGAGG + Intergenic
1171546118 20:26002907-26002929 TGGGGTCTGCTTGAGTGGGGAGG - Intergenic
1171892439 20:30728559-30728581 CAGGTTCCTCTTCAGGGGTGGGG - Intergenic
1172333949 20:34098425-34098447 CCTGGTCTCCTTGATGGGGGTGG - Intronic
1172402469 20:34661366-34661388 CTGGGCCTACTTGAGGGTGGAGG - Intronic
1172761213 20:37323794-37323816 TGGGGTCTACTTGAAGGGGGAGG + Intergenic
1172863860 20:38079415-38079437 CCGGGACTACTTGAGGGTGGAGG - Intronic
1173517653 20:43676274-43676296 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1174404796 20:50296148-50296170 CAGGGTGTTTTGGAGGGGGCGGG + Intergenic
1174936126 20:54871021-54871043 CAGGGTCTACTTGAGTGGGGAGG + Intergenic
1175673365 20:60926078-60926100 TAGGGACTACTTGAGGGGGAAGG - Intergenic
1175917822 20:62435222-62435244 CAGGGTCTCCTTTTGGGGGCAGG - Intergenic
1176281160 20:64313291-64313313 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1176583444 21:8550975-8550997 CAGGGTCCTGTGGGGGGGGGTGG + Intergenic
1176864774 21:14041012-14041034 TGGGGTCTACTTGATGGGGGAGG - Intergenic
1177850442 21:26340738-26340760 CAGGGCCTACTTGAGCAGGGAGG - Intergenic
1178489521 21:33040235-33040257 CAGGACCTACTTGAGGGTGGAGG - Intergenic
1178546257 21:33495405-33495427 TGGGGTCTGCTTGAGGTGGGAGG + Intergenic
1178795139 21:35737049-35737071 TGGGGTCTACTTGAGGGGGAGGG + Intronic
1179092174 21:38276543-38276565 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1179121854 21:38554659-38554681 CAGGGGCTGCTTGAGGGTGGAGG + Intronic
1179174510 21:38997959-38997981 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1179463288 21:41552273-41552295 TAGAGTCTACTTGAGGGTGGAGG - Intergenic
1180235762 21:46458678-46458700 CTGGGCCTGCTTGAGGGTGGCGG - Intergenic
1180432973 22:15271154-15271176 CAGGAGCTTCTTGAGGGCAGGGG - Intergenic
1180464982 22:15603160-15603182 CAGGGGCCTCTGGAGGGGGCGGG + Intergenic
1180783616 22:18535120-18535142 TTGGGTCTTCATGAGAGGGGCGG + Intergenic
1181084388 22:20432563-20432585 GAGGGGCTTCTGGAGGGAGGTGG + Intronic
1181127183 22:20709171-20709193 TTGGGTCTTCATGAGAGGGGCGG + Intronic
1181240518 22:21474472-21474494 TTGGGTCTTCATGAGAGGGGCGG + Intergenic
1181518943 22:23434382-23434404 CAGGGTCTGGTTGAGGGCTGGGG + Intergenic
1181668920 22:24416746-24416768 CAGGATCTTCTGGAGGAAGGTGG + Exonic
1182263122 22:29090368-29090390 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1183025202 22:35060027-35060049 CAGGGCCTGCTTGAGAGTGGAGG + Intergenic
1183135086 22:35879511-35879533 CATGGTATTCATGAGGGGGTTGG - Intronic
1183532226 22:38364676-38364698 TGGGGTCTACTTGAGTGGGGAGG + Intronic
1183758354 22:39791890-39791912 TAGGGCCTACTTGAGGGAGGAGG - Intronic
1183906232 22:41042510-41042532 TGTGGTCTACTTGAGGGGGGAGG - Intergenic
1184156534 22:42671206-42671228 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1184647621 22:45904678-45904700 CGGGGCCTACTTGAGGGTGGAGG - Intergenic
1184741303 22:46430460-46430482 AAGGGTGATCTTGAGGGTGGTGG - Intronic
1184808206 22:46810109-46810131 CTGGGTGTTCTGGAGGAGGGAGG + Intronic
1184913721 22:47552708-47552730 TTGGGTCTTCTCCAGGGGGGTGG - Intergenic
949376384 3:3394596-3394618 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
950360528 3:12446364-12446386 CAGGGTCTGCTTGTTGGAGGAGG + Intergenic
951287384 3:20830934-20830956 CAGGGCCTACTTGAGGGCAGAGG - Intergenic
951517912 3:23582058-23582080 CATGGCCTACTTGAGGGTGGAGG - Intronic
951732810 3:25829365-25829387 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
952121947 3:30255709-30255731 TGGGGTCTACTTGAGGGGGAGGG + Intergenic
952643143 3:35622462-35622484 CAGGGCCTGCTTGAAGGTGGAGG - Intergenic
953551651 3:43908154-43908176 CAGGGTCTGCTTTTGGGGTGGGG - Intergenic
954462221 3:50633878-50633900 CAGGGTTTACTTGTGGGTGGAGG - Intronic
954847314 3:53571110-53571132 CAGGGGGTTCTTAAGTGGGGAGG + Intronic
955149138 3:56349565-56349587 CAGGGCCTACTTGAGGGTTGAGG + Intronic
955442140 3:58967864-58967886 TGGGGTCTACTTGAGGGTGGAGG - Intronic
955584170 3:60458425-60458447 CAGGGGCTTGTTGTGGGGTGGGG + Intronic
955660179 3:61290491-61290513 CAGGGTTTTTTTGCGGGGTGGGG - Intergenic
955886246 3:63601500-63601522 CAGGGTCTACTTGAGAGTGGAGG - Intronic
956232443 3:67031785-67031807 TGGGGCCTACTTGAGGGGGGAGG + Intergenic
956724674 3:72147011-72147033 CAGCGCCTACTTGAGGGTGGAGG - Intergenic
956846088 3:73184131-73184153 CAGGGACTACTTGAGGTGGAGGG - Intergenic
956943266 3:74189552-74189574 AGGGGTCTACTTGAGGGTGGAGG - Intergenic
957065497 3:75518731-75518753 CAGGGTTTTTTTGGGGGGGGCGG - Intergenic
957070927 3:75567370-75567392 CTGGGTTTTCTGGAAGGGGGAGG + Intergenic
957746488 3:84349518-84349540 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
957763239 3:84587278-84587300 TGGGGTCTTGTTGAGGGTGGAGG - Intergenic
958589782 3:96141017-96141039 CTGGGCCTACTTGAGGGTGGAGG + Intergenic
958998464 3:100934135-100934157 CAGGGCCTTTTTGGGGGTGGGGG - Intronic
959098335 3:101981838-101981860 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
959166236 3:102782060-102782082 CTGGGTCTACTTGAGGGTGGAGG + Intergenic
959392820 3:105797430-105797452 CAGGGGCTACTTGAGGGTGAAGG + Intronic
959451392 3:106507401-106507423 CAGGGCCTACTTGAGGGCAGAGG - Intergenic
959605342 3:108236010-108236032 AGGGGTCTACTTGAGGTGGGAGG - Intergenic
960627976 3:119700222-119700244 CAGGGTCTTGTAGTTGGGGGAGG + Intergenic
960782680 3:121337083-121337105 TGGGGTCTACTTGAGGGTGGTGG + Intronic
960815763 3:121670742-121670764 TAGGGTTTTCTTTTGGGGGGGGG + Intronic
961283192 3:125779353-125779375 CTGGGTTTTCTGGAAGGGGGAGG - Intergenic
962451726 3:135524357-135524379 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
962472623 3:135725858-135725880 CAGGGCCTGCTTGAGGGTGGAGG - Intergenic
962513042 3:136121420-136121442 CAGGGCCTGCTTGAGGGTAGAGG + Intronic
962691675 3:137905406-137905428 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
962781669 3:138724520-138724542 CCGGGACTTCTGGAGTGGGGAGG - Intronic
962881883 3:139586211-139586233 TGGGGTCTACTTGAGGGTGGAGG + Intronic
963075077 3:141338631-141338653 CAGGGTCTACTTGACAGTGGAGG + Intronic
963674400 3:148290945-148290967 TGGGGTCTCCTTGAGGGTGGAGG + Intergenic
964366336 3:155954420-155954442 CAGGGCCTACTTGAGGGTAGAGG - Intergenic
964474008 3:157082614-157082636 CAGGGTATTCTAGAGGTGTGTGG - Intergenic
964487053 3:157196923-157196945 TGGGGTCTACTTGATGGGGGAGG + Intergenic
964529865 3:157655853-157655875 TGGGGTCTACTTGAGGGTGGAGG - Intronic
964687694 3:159415452-159415474 CAGGGTGTACTTGAGGGTAGAGG - Intronic
965043869 3:163550005-163550027 CAGGGTCTCCTGGAGGGTTGAGG - Intergenic
965058814 3:163755872-163755894 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
965065823 3:163847354-163847376 CAGGGTCTACTTGAGGGTGGAGG + Intergenic
965193265 3:165559430-165559452 CAGAGTCTACTTGAGGGTGGAGG - Intergenic
965295371 3:166938568-166938590 CAGGGTCTATTTGAAGGTGGAGG - Intergenic
965563232 3:170081728-170081750 TGGGGTCTACTTGAGGGAGGAGG - Intronic
965686285 3:171306200-171306222 TAGGGCCTACTTGAGGGAGGAGG + Intronic
965725925 3:171715923-171715945 TAGGGCCTACTTGAGGGTGGGGG - Intronic
965948011 3:174266211-174266233 CAGGGCCTACTTCAGGGTGGAGG - Intronic
966145351 3:176805584-176805606 TAGAGCCTACTTGAGGGGGGAGG + Intergenic
966442718 3:179964157-179964179 CAGGGCCTGCTTGAAGGTGGAGG - Intronic
966453539 3:180089843-180089865 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
966632628 3:182095442-182095464 CTGGGGCCTCTTGAGGGGTGGGG - Intergenic
966671779 3:182535330-182535352 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
966771172 3:183504860-183504882 CAGGGCCTACTTGAGGGTAGAGG - Intronic
967682352 3:192378913-192378935 TAGGGCCTTCTTGAGGGTGGAGG - Intronic
967693454 3:192504176-192504198 CAGGGCCTACTTGAGAGTGGAGG + Intronic
968158253 3:196401599-196401621 CAGGGCCTGGTTGAGGGTGGAGG + Intronic
968420486 4:479779-479801 CAGTGTCTTCCTGAGAGTGGAGG + Intronic
968832413 4:2939859-2939881 CACTGTCTTCTTGAAGAGGGAGG + Intronic
968926397 4:3550851-3550873 CAGGGTCTTCTGTGGTGGGGTGG + Intergenic
969014532 4:4095061-4095083 CTGGGTTTTCTGGAAGGGGGAGG + Intergenic
969739420 4:9013378-9013400 CTGGGTTTTCTGGAAGGGGGAGG - Intergenic
969798601 4:9544893-9544915 CTGGGTTTTCTGGAAGGGGGAGG - Intergenic
970043182 4:11819967-11819989 CAGGGACTTCCTCAGGAGGGAGG + Intergenic
970327177 4:14938195-14938217 CTGGGTCTACTTGAGAGTGGGGG - Intergenic
970624706 4:17863984-17864006 CAGGGCCTACTTGAGGGCAGAGG + Intronic
971004916 4:22362523-22362545 CAGGGTCTTTTTGAAAGGGAGGG - Intronic
971106486 4:23530355-23530377 CAGGGTCTACTTGAAGGTGGAGG + Intergenic
971306793 4:25490070-25490092 TAGGGTGTACTTGAGGGGGATGG + Intergenic
971461727 4:26906262-26906284 CTGGGTCAACTTGAGGGTGGAGG + Intronic
971542696 4:27840866-27840888 TGGGGTCTACTTGAGGGGAGAGG - Intergenic
971967154 4:33574744-33574766 CTGGGTCTACTTGATGGGGGAGG - Intergenic
972143379 4:35989669-35989691 CAGGGTCTACTTGAGGGTGAAGG + Intronic
972147131 4:36042010-36042032 TGGGGTCTACTTGAGGGGAGAGG + Intronic
972175577 4:36401822-36401844 CAGGGACTACTTGAGTGTGGAGG - Intergenic
972724645 4:41736100-41736122 CAGGGCCTACCTGAGGGTGGAGG - Intergenic
973139373 4:46747208-46747230 TAGGGTCTTTTGGAGGGTGGAGG - Intronic
973694167 4:53473640-53473662 CAGGGCCTACTTGAGGGTGGAGG + Intronic
973740368 4:53913854-53913876 CGGGGCCTACTTGAGGGTGGAGG + Intronic
973743602 4:53942051-53942073 CGGGGTCTACTGGAGGGTGGAGG + Intronic
973914102 4:55615786-55615808 CAGGGCCTGCTAGAGGGTGGAGG - Intronic
974063875 4:57059582-57059604 CTGGGTCTACTTGAGGGTGGAGG + Intronic
974159847 4:58124515-58124537 CAACGTCTACTTGAGGGTGGAGG + Intergenic
974444612 4:61963417-61963439 TAGGGCCTTCTTGAGAGTGGAGG - Intronic
974683175 4:65191345-65191367 CAGGGCCTACTTGAGGGTGCAGG - Intergenic
974944192 4:68506183-68506205 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
974954740 4:68623496-68623518 TGGGGTCTACTTGAGGGTGGAGG + Intronic
975385054 4:73747469-73747491 CAGGGTCTGCTTCATGGGTGTGG - Intergenic
975499242 4:75066967-75066989 CAGGGACTACTGGAGGGGGAGGG + Intergenic
976001812 4:80383168-80383190 TAGGGCCTACTTGAGGGTGGAGG + Intronic
976015840 4:80553155-80553177 TGGGGTCTACTTGAGGGTGGAGG - Intronic
976025858 4:80687663-80687685 CAGGGCATTCTGGAGGGAGGAGG + Intronic
976059968 4:81116188-81116210 CAGGACCTACTTGAGGGTGGAGG - Intronic
976318353 4:83683595-83683617 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
976481327 4:85549763-85549785 CAGGGCCTACTTGAGGGTAGAGG - Intronic
976721280 4:88171104-88171126 ACGGGTCTACTTGAGGGTGGAGG + Intronic
977205440 4:94160377-94160399 CAGGTTTTTTTTGGGGGGGGGGG + Intergenic
977403486 4:96564649-96564671 CAGGGCCTACTTGAGGGTAGAGG - Intergenic
977508183 4:97929037-97929059 CTGGGTCTACTTGAGGGTGGAGG - Intronic
977729833 4:100338039-100338061 TGGGGTCTACTTGAGTGGGGAGG + Intergenic
977734744 4:100399917-100399939 CTGGGACTTCTTGAGGGTAGAGG - Intronic
977800736 4:101227720-101227742 CAGGGCCTACTTGAAGGTGGTGG - Intronic
977973248 4:103234570-103234592 CAGGTTCTACTTAAGGGTGGAGG + Intergenic
977987034 4:103395042-103395064 CAGGTTCTACTTAAGGGTGGAGG - Intergenic
978063499 4:104367215-104367237 CAGGGCCTACTTAAGGGTGGAGG + Intergenic
978099890 4:104825671-104825693 CAGAGTCTACTTGAGGGTGAGGG - Intergenic
978390136 4:108216555-108216577 CAGGGTCTACTTGAGGGTGGAGG - Intergenic
978590701 4:110321972-110321994 CAGGGTCCTGTTGTGGGGTGGGG - Intergenic
978683255 4:111409168-111409190 TGGGGTCTACTTGATGGGGGAGG - Intergenic
979048437 4:115898957-115898979 CAGGGTCTTGTTCAAGTGGGAGG + Intergenic
979262010 4:118659029-118659051 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
979281907 4:118878193-118878215 CAGGGCCTACTTGAGGGTGGAGG + Intronic
979741929 4:124161793-124161815 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
979854613 4:125616296-125616318 TGGGGTCTACTTGATGGGGGAGG - Intergenic
979929861 4:126617173-126617195 CAGGCTGGTCTTGAGAGGGGAGG - Intergenic
979996811 4:127441056-127441078 TAGGGTCTACTTGCGAGGGGAGG + Intergenic
980089597 4:128428583-128428605 CTGGGCCTACTTGAGGGTGGAGG - Intergenic
980215754 4:129851002-129851024 TAGGGTCTACTTGAGGGTGAAGG + Intergenic
980398204 4:132243663-132243685 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
981253719 4:142635694-142635716 TTGGGTCTACTTGAGGGTGGAGG + Intronic
981275197 4:142891357-142891379 CAGGGCCTACTTGAGAGTGGAGG - Intergenic
981394209 4:144227979-144228001 CGAGGTCTACTTGAGGGTGGAGG + Intergenic
981834182 4:149036184-149036206 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
982156359 4:152525463-152525485 TGGGGTCTACTTGAGGGGGAGGG - Intronic
983155637 4:164344211-164344233 CAGGACCTACTTGAGGGTGGAGG + Intronic
983293158 4:165831991-165832013 CGGGGCCTACTTGAGGGTGGAGG - Intergenic
983404952 4:167316027-167316049 CAGGGCCTACTTGAGGGTTGAGG - Intergenic
983447287 4:167869497-167869519 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
983853081 4:172607297-172607319 CAGGGTCTACTTGAGGGTGGAGG - Intronic
984070981 4:175111867-175111889 CAGGGCCTACTTGAGGGTAGAGG + Intergenic
984516634 4:180749495-180749517 CAGGGCCTACTTGAGGGTAGAGG - Intergenic
984861963 4:184248711-184248733 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
984870682 4:184322344-184322366 CAGGGCCTTCTGGAGGGTGGAGG - Intergenic
985085749 4:186310654-186310676 CAGGGTCTACTTGAGACTGGGGG - Intergenic
985100995 4:186458498-186458520 CAGGATCTACTTGTGGGGGGAGG - Intronic
985235185 4:187865118-187865140 CAGGGCCTGCTGGAGGGTGGGGG - Intergenic
985305186 4:188531660-188531682 TGGGGACTGCTTGAGGGGGGAGG + Intergenic
985469123 5:26892-26914 GGGGGTCTACTTGAGGGGGGAGG - Intergenic
985839218 5:2293515-2293537 CCGGGCCTACTTGAGGGTGGAGG + Intergenic
985844364 5:2333362-2333384 CAGGGTCTCCTTTAGGGGAGGGG + Intergenic
986522925 5:8641222-8641244 CAGGGACTACTAGAGGAGGGAGG + Intergenic
986549955 5:8941576-8941598 CAGGGCCTACTTGAAGGAGGTGG + Intergenic
986896659 5:12379169-12379191 CAGGGCCTACTTGAGGGTGAAGG - Intergenic
986998211 5:13631736-13631758 CAGGGTCTACTTGAAGGTAGGGG + Intergenic
987018557 5:13846288-13846310 TGGGGTCTACTTGAGGGTGGAGG - Intronic
987024182 5:13907433-13907455 CAGGTTCTTTTTTTGGGGGGTGG - Intronic
987039333 5:14046951-14046973 CAGGGACGTCTTGGGGGAGGAGG + Intergenic
987159519 5:15126716-15126738 CAGGGCCTACTTGATGGTGGGGG - Intergenic
987388967 5:17357507-17357529 CAGAGTCTACTTGATGGTGGAGG - Intergenic
987394525 5:17409699-17409721 CAGGGCCTGCTTGAGGGTGGAGG - Intergenic
987416635 5:17669419-17669441 CGGGGTCTTATTCAGGGAGGTGG - Intergenic
987702992 5:21425972-21425994 CAGGGCCCACTTGAGTGGGGAGG - Intergenic
988043788 5:25921505-25921527 TAGGGTCTCCTTGAGGGTGGAGG + Intergenic
988321372 5:29701478-29701500 CAGGTCCTACTTGAGGGTGGAGG - Intergenic
988782042 5:34531069-34531091 TGGGGTCTACTTGATGGGGGAGG + Intergenic
989153243 5:38320542-38320564 CAGTTTCTCCTTGAGGTGGGAGG + Intronic
989461345 5:41702640-41702662 CAGGGTCTACTTGAGGGTGGAGG - Intergenic
989531981 5:42518334-42518356 CATGGTCTTCTTGAGGTGTAGGG + Intronic
989567477 5:42915679-42915701 CTGTGTCTTCTTGAGGGGACTGG - Intergenic
989715867 5:44462299-44462321 CAGGGACTACTTGAGGGTGAAGG - Intergenic
990024501 5:51168906-51168928 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
990091544 5:52057201-52057223 CAGGGCCTAGTTGAGGGTGGAGG - Intronic
990134099 5:52624299-52624321 CAGAGTCTACTTGAGGGTGGAGG - Intergenic
990354077 5:54948497-54948519 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
991552825 5:67860906-67860928 TAGGGTCTACTTGAAGGGGAAGG + Intergenic
992434432 5:76741703-76741725 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
992558629 5:77928442-77928464 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
992936046 5:81706319-81706341 TGGGGTCTTCTAGAGGGGAGAGG + Intronic
993568703 5:89508709-89508731 TAGGGTCTACTTGAGGTGGGAGG + Intergenic
994228413 5:97282774-97282796 TAGAGTCTACTTGAGGGTGGAGG - Intergenic
994242989 5:97446103-97446125 TAGGTTCTACTTGAGGGTGGAGG + Intergenic
994330254 5:98496610-98496632 CAGGGCCTACTTGAGGGCAGAGG + Intergenic
994467418 5:100155619-100155641 TGGGGTCTACTTGAGGGAGGAGG - Intergenic
994471298 5:100211539-100211561 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
994574400 5:101557542-101557564 CAGGGGCCTCTTGTGGGGTGGGG + Intergenic
994595888 5:101834409-101834431 CAGGGTCTACTTGCGGTTGGGGG - Intergenic
994601434 5:101910443-101910465 TAGGGTTCTCTTGAGGGTGGAGG - Intergenic
994618870 5:102138808-102138830 TGGGGTCTGCTTGAGTGGGGAGG - Intergenic
994638241 5:102370039-102370061 CAGGGCCTACTTGAAGGTGGAGG + Intergenic
994672039 5:102773871-102773893 TGGGGTCTACTTGAGTGGGGAGG - Intronic
994679844 5:102872905-102872927 CGGGGCCTACTTGAGGGTGGAGG + Intronic
994718327 5:103350510-103350532 TAGGGTCTTTTGGAGGGTGGAGG + Intergenic
994765099 5:103905505-103905527 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
995717979 5:115099176-115099198 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
995775058 5:115716213-115716235 CGGGGCCTACTTGAGGGGGAGGG - Intergenic
995943249 5:117610595-117610617 CAGGGCCTACCTGAGGGTGGAGG - Intergenic
996180579 5:120414354-120414376 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
996469403 5:123842727-123842749 CAGGGCCTACTTGAGGATGGAGG + Intergenic
996681416 5:126231457-126231479 TGGGGTCTACTTGAGGGGTGGGG + Intergenic
996768312 5:127058194-127058216 CAGGGCCTAATTGAGGGTGGAGG - Intronic
997046252 5:130321647-130321669 CAAGGCCTACTTGAGGGTGGAGG + Intergenic
997609466 5:135204812-135204834 TGGGGTCTACTTGAGGGTGGAGG - Intronic
997641859 5:135454510-135454532 TGGGGTCTACTTGAGGGTGGGGG - Intergenic
998259535 5:140618650-140618672 TGGGGTCTACTTGAGTGGGGAGG - Intergenic
998776065 5:145604248-145604270 TAGGGCCTACTTGAGGGTGGAGG - Intronic
999056039 5:148577805-148577827 TGGGGTCTACTTGAGGGTGGAGG + Intronic
999380357 5:151117161-151117183 CAGGGGCATCGTGAGGAGGGAGG - Exonic
999429479 5:151513581-151513603 CAGGGCCTACTTGAGGGCAGAGG + Intronic
999737240 5:154521929-154521951 CAGGGTTTGAATGAGGGGGGAGG + Intergenic
1000162718 5:158615500-158615522 TAGGGTCTACTTGTGGGTGGAGG - Intergenic
1000189616 5:158897402-158897424 TAGGGCCTTCTAGAGGGTGGAGG + Intronic
1000276492 5:159740815-159740837 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1000678440 5:164152918-164152940 TAGGATCTACTTGAGGGTGGAGG + Intergenic
1000686139 5:164252191-164252213 CAGAGTCTACTTGAGAGAGGAGG + Intergenic
1000698190 5:164415608-164415630 CAGGGCATACTTGAGAGGGGAGG - Intergenic
1001891188 5:175340493-175340515 CAGGGCCTACTTGAGGGTTGAGG + Intergenic
1002096323 5:176833307-176833329 CAGGGCTTACTTGAGGGTGGAGG - Intronic
1002448170 5:179302712-179302734 CAGAGTATTGTTGAGGGGGGCGG + Intronic
1002671356 5:180870338-180870360 CCGTGTCTTCCTGAGGGGAGTGG + Intergenic
1002732577 5:181352147-181352169 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1002751960 6:121960-121982 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1002794473 6:461019-461041 CAGGCTCTTCATTAGGGTGGAGG + Intergenic
1002907284 6:1459887-1459909 CAGGGCCTGCTTGAGGGTGGAGG - Intergenic
1004148124 6:13089195-13089217 CAGGGGCTTCTTGTGGTGGAGGG - Intronic
1004813316 6:19284743-19284765 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1005687199 6:28266058-28266080 CAAGGACTTCTTGAGGGTGGAGG - Intergenic
1005909682 6:30297543-30297565 CAGGACCTACTTGAGGGTGGAGG - Intergenic
1006037189 6:31222993-31223015 CAGGCTCTGCTGGAGGGGGTGGG + Intergenic
1006303642 6:33206993-33207015 CCGGGTCTTTTTGAAGGGAGGGG + Intergenic
1006522984 6:34582790-34582812 CAGGGGCTCCTGGAGAGGGGTGG - Intergenic
1006627761 6:35409712-35409734 CGGGGCCTACTTGAGGGTGGAGG - Intronic
1006802898 6:36770683-36770705 TAGGGTCTCCAGGAGGGGGGTGG - Intronic
1007216244 6:40241518-40241540 CTGGATCTACTTGAGGGTGGAGG + Intergenic
1007502448 6:42308772-42308794 TGAGGTCTACTTGAGGGGGGAGG + Intronic
1008070000 6:47089834-47089856 CAGGGTCTGTTGGAGGTGGGGGG + Intergenic
1009302055 6:62036378-62036400 CAGGGCCTATTTGAGGGTGGAGG + Intronic
1009333424 6:62455097-62455119 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1009656473 6:66552560-66552582 CAAGGTCTCCATGAGGGTGGAGG + Intergenic
1009753625 6:67905117-67905139 TGGGGTCTACTTGAGGGGGGAGG + Intergenic
1009822926 6:68827654-68827676 CAGGGTTTTTTTTGGGGGGGAGG + Intronic
1009889351 6:69661582-69661604 TGGTGTCTACTTGAGGGGGGAGG + Intergenic
1010096809 6:72056249-72056271 CAGGGCCTACTTGAGGATGGAGG + Intronic
1010500836 6:76597726-76597748 CAGGGCCTTCTTGAGGGTGGAGG - Intergenic
1010695071 6:78962678-78962700 GAGGATCTTCTTAAGGGGAGAGG - Intronic
1010749478 6:79601926-79601948 CTGGGTTTTTTTGTGGGGGGTGG - Intergenic
1010954653 6:82076226-82076248 CAGGGCATACTTGAGGGTGGAGG + Intergenic
1011281459 6:85681929-85681951 TAGGGCCTCCTTGAGGGTGGAGG - Intergenic
1011911585 6:92447488-92447510 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1012337473 6:98078972-98078994 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1012339301 6:98099686-98099708 CTGGGTCTTCCTGAGGGGGAAGG - Intergenic
1012345589 6:98181396-98181418 TGGGGTCTACTTGAGGGGCGAGG + Intergenic
1012440704 6:99259818-99259840 CAGGGCCTACTTGGGGGTGGAGG + Intergenic
1012604616 6:101142778-101142800 CAAGACCTTCTTGAGGGTGGAGG - Intergenic
1012834553 6:104248827-104248849 CAGAGTCTACTTGAGTGTGGAGG + Intergenic
1012991810 6:105933830-105933852 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1013314794 6:108931077-108931099 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1013693873 6:112677259-112677281 CAGGGCCTTTTTGGGGGTGGGGG + Intergenic
1013864452 6:114678472-114678494 TGGGGTCTACTTGATGGGGGAGG + Intergenic
1014124890 6:117765531-117765553 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1014194075 6:118532342-118532364 CAGGGCCTACTTGATGAGGGGGG + Intronic
1014195701 6:118555804-118555826 TGGGGTCTACTTGAGCGGGGAGG - Intronic
1014207346 6:118670384-118670406 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1014264738 6:119263489-119263511 CGGGGCCTTCTTGAGAGTGGTGG + Intronic
1014356103 6:120411997-120412019 TAGGGCCTGCTTGAGGGTGGAGG - Intergenic
1014466675 6:121764407-121764429 CAGGGCCTACTTGAGGAAGGAGG + Intergenic
1014961208 6:127687479-127687501 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1015272476 6:131351372-131351394 CAGAGTCTCCTTTAGAGGGGAGG + Intergenic
1015288849 6:131515017-131515039 TGGGGTCTACTTGATGGGGGAGG - Intergenic
1015567679 6:134590436-134590458 CGGGGCCTACTTGAGGGTGGAGG - Intergenic
1015658254 6:135544306-135544328 TGGGGTCTACTTGAAGGGGGAGG + Intergenic
1015743392 6:136483346-136483368 CAGGGCCTTCTTGAGGGTGAAGG + Intronic
1016238085 6:141892171-141892193 CAGAGCCTACTTGAGGGTGGAGG + Intergenic
1016339292 6:143044383-143044405 CAGGAGCTTGTTGAGGGGGCAGG - Intergenic
1016545784 6:145221849-145221871 CAGGGCTTACTTGAGGGTGGAGG + Intergenic
1017070088 6:150568330-150568352 CAGGGCCTCCTTGTGTGGGGAGG + Intergenic
1017276852 6:152579674-152579696 CAGGGTCTACTTGAGGGTAGAGG - Intronic
1017556245 6:155573592-155573614 CAGAGTCTTGTTGGGGGTGGGGG + Intergenic
1017945883 6:159095890-159095912 CAGGCTCTTCCTGAGGGCGGGGG + Intergenic
1018684386 6:166292339-166292361 TGGGGTCTACTTGAAGGGGGAGG + Intergenic
1018771538 6:166975311-166975333 TGGGGTCTACTTGATGGGGGAGG - Intergenic
1019099326 6:169615380-169615402 TGGGGTCTGCTTGAGGGTGGAGG - Intronic
1019236832 6:170624465-170624487 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1019318918 7:406038-406060 CAGGGTGGTCTGGAGGAGGGAGG - Intergenic
1019432531 7:1005863-1005885 CTGGGTCTGCTCGAGGCGGGAGG - Intronic
1020491359 7:8788286-8788308 CAGGTCCTACTTGAGGGTGGAGG - Intergenic
1020651005 7:10876127-10876149 CAGGGACTACTTGAGGGTAGAGG - Intergenic
1020861367 7:13495990-13496012 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1020968465 7:14902794-14902816 CCGGGTGTTCTGGAAGGGGGTGG - Intronic
1020985944 7:15134456-15134478 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1021185888 7:17564277-17564299 CAGGGTCTGTTGGAGGGTGGGGG + Intergenic
1021407476 7:20289093-20289115 CAGGGCCTGCTTAAGGGTGGAGG + Intergenic
1021419438 7:20428892-20428914 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1021618480 7:22527091-22527113 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1021734155 7:23626661-23626683 CTGGGTCTACTTGAGTGGGGAGG - Intronic
1021750235 7:23791452-23791474 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1022687194 7:32608227-32608249 CCGGGCCTACTTGAGGGTGGAGG + Intergenic
1022694895 7:32695026-32695048 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1022795432 7:33727897-33727919 CAGGCTCTCCTTGTGGGGGTGGG + Exonic
1022928075 7:35076544-35076566 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1023571334 7:41575602-41575624 CGGGGCCTACTTGAGGGTGGAGG - Intergenic
1023872945 7:44272527-44272549 CAGGTGCTTCTTGCGGGTGGTGG - Intronic
1024254590 7:47531093-47531115 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1024726281 7:52200025-52200047 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
1024788156 7:52931916-52931938 CAGGGTCTGCTTTTGGGAGGAGG - Intergenic
1026161868 7:67876503-67876525 TGGGGTCTCCTTGAGGGAGGAGG - Intergenic
1026968504 7:74454446-74454468 CCGGCTCTTCTGGAGGTGGGGGG + Intronic
1027356850 7:77365389-77365411 TGGGGTCTTCTTGAGAGTGGAGG - Intronic
1027409007 7:77893259-77893281 TAGGGCCTACTTGAGGGAGGAGG - Intronic
1027875362 7:83761627-83761649 CAAGGCCTACTTGAGGGTGGAGG - Intergenic
1028374202 7:90129044-90129066 CAGGGCCTATTTGAGGGTGGAGG - Intergenic
1029054429 7:97726365-97726387 TGGTGTCTGCTTGAGGGGGGAGG - Intergenic
1029073209 7:97916692-97916714 CTGGGTTTTCTGGAAGGGGGAGG + Intergenic
1029334949 7:99890707-99890729 CAGGGACTACTTGAGGGTAGAGG + Exonic
1029808720 7:103023962-103023984 CAGGATCTACTTGAGGGTGGAGG + Intronic
1030349216 7:108464475-108464497 TGGGGTCTACTTGATGGGGGAGG + Intergenic
1030416676 7:109252751-109252773 CGGGGTCTACTTCAGTGGGGAGG + Intergenic
1030421772 7:109315534-109315556 CAGGGCTTTCTTGAGGGTGGTGG + Intergenic
1030689237 7:112515875-112515897 CAGGGTCTATTTGAGGGTGGAGG + Intergenic
1030732436 7:113006010-113006032 CAGGGCCTACTTGAGGGTGAAGG + Intergenic
1030912730 7:115272142-115272164 CAGGTTTTTTTTGGGGGGGGGGG + Intergenic
1030959623 7:115900582-115900604 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
1031255564 7:119443422-119443444 TAGGGCCTACTTGAGTGGGGAGG - Intergenic
1031258221 7:119483391-119483413 CAGGGCCTACTTGAGGGTGCAGG - Intergenic
1031288086 7:119898081-119898103 TGGGGTCTTCTTGATGGAGGAGG - Intergenic
1031465459 7:122104763-122104785 CAGGGTATACTTGAGGGTGGAGG + Intronic
1031546993 7:123063135-123063157 CAGGGTCTACTTGAGGGTGGAGG - Intergenic
1032625385 7:133586240-133586262 CAGGGCCTGCTTGAGGGTGGAGG - Intronic
1032960936 7:137033331-137033353 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
1033493433 7:141868097-141868119 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1033818971 7:145110258-145110280 TGGGGTCTGCTTGAGGGAGGAGG - Intergenic
1034204943 7:149307243-149307265 CAGGTTCTACTGGAGGGTGGAGG + Intergenic
1034359192 7:150479150-150479172 CAGGGTATACTTGAGGGTGGAGG + Exonic
1034426443 7:151016643-151016665 CAGGGGCATGTGGAGGGGGGTGG - Intronic
1035422651 7:158742294-158742316 GAGGGTCAGCTTCAGGGGGGTGG - Intronic
1035510940 8:182145-182167 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1036256255 8:7209138-7209160 CTGGGTTTTCTGGAAGGGGGAGG + Intergenic
1036308305 8:7667722-7667744 CTGGGTTTTCTGGAAGGGGGAGG + Intergenic
1036889746 8:12588647-12588669 CTGGGTTTTCTGGAAGGGGGAGG + Intergenic
1036897349 8:12646799-12646821 CTGGGTTTTCTGGAAGGGGGAGG + Intergenic
1037061504 8:14516302-14516324 CAGGTCCTCCTTGAGGGTGGAGG - Intronic
1037177079 8:15960544-15960566 CAGGACCTACTTGAGGGTGGAGG - Intergenic
1037300942 8:17451369-17451391 TGGGGCCTTCTTGAGGGTGGAGG - Intergenic
1038750428 8:30290011-30290033 CAGGGCCTAGTTGAGGGTGGAGG - Intergenic
1038817561 8:30920791-30920813 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1038990820 8:32865840-32865862 CAGTGCCTACTTGAGGGTGGAGG + Intergenic
1039198101 8:35054950-35054972 CAGAGCCTACTTGAGGGTGGAGG - Intergenic
1040093869 8:43423864-43423886 CAGGGTTTTTTTTGGGGGGGTGG - Intergenic
1040407612 8:47121795-47121817 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1040533623 8:48286604-48286626 TAGGGCCTACTTGAGGGAGGAGG + Intergenic
1040792289 8:51246271-51246293 CAGGGTCTTCTTGAGAGCAGAGG + Intergenic
1040935649 8:52779063-52779085 TGGGGCCTTCTTGAGGTGGGAGG - Intergenic
1041013494 8:53567921-53567943 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1041521435 8:58760852-58760874 CAGAGTCTACTTGAGGGTGGAGG - Intergenic
1041625471 8:60020936-60020958 CTGGGGCTTGTTGAGGGGTGGGG - Intergenic
1041695244 8:60728972-60728994 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1041749707 8:61246961-61246983 TGGGGTCTGCTTGAGTGGGGAGG - Intronic
1042046299 8:64655997-64656019 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1042464172 8:69107971-69107993 CAGGGCCTACTTAAGGGTGGAGG - Intergenic
1042629172 8:70797707-70797729 CAGGGCCTCATTGAGGGTGGAGG - Intergenic
1042795258 8:72655283-72655305 GAGGGCCTACTTGAGGGTGGGGG + Intronic
1043067202 8:75589946-75589968 CTGGGCCTACTTGAGGGTGGAGG - Intergenic
1043294314 8:78645108-78645130 GAAGGTCTTCTTAAGGGTGGAGG - Intergenic
1043407819 8:79956635-79956657 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1043569438 8:81585997-81586019 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1043587152 8:81782590-81782612 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
1043732188 8:83696163-83696185 CAGGGTCTACTCGAGGTTGGTGG - Intergenic
1043737959 8:83770530-83770552 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1043989687 8:86737738-86737760 CAGGATCTACTTGAGGGTGGAGG - Intronic
1043994610 8:86797563-86797585 TGGGGTCTACTTGAGGTGGGAGG + Intergenic
1044126241 8:88461155-88461177 CAGGGCCTACTTGAGGTTGGTGG - Intergenic
1044803245 8:95978562-95978584 CAGGGTCTGGTTGAGGGCTGAGG - Intergenic
1044960847 8:97529288-97529310 TAGGGTCTACTTGAGGGTGGAGG + Intergenic
1045089649 8:98728209-98728231 AAGTCTCTTCTTTAGGGGGGTGG - Intronic
1045127463 8:99108001-99108023 CAAGGCCTACTTGAGGGTGGAGG - Intronic
1045619549 8:103958391-103958413 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1045636885 8:104201134-104201156 CAGGGCCTACTTGAGGGGAGAGG - Intronic
1045691751 8:104766462-104766484 CAGGGTCTACTGGAGGGTAGAGG + Intronic
1045813250 8:106249331-106249353 GAGGGTCTACCTGAGGGGAGAGG + Intergenic
1045819905 8:106324347-106324369 TGGGGTCTACTTGAGGGAGGAGG + Intronic
1045945863 8:107795193-107795215 CAGGGCTTACTTGAGGGTGGAGG + Intergenic
1046072036 8:109267279-109267301 CAGAGCCTACTTGAGGGTGGAGG - Intronic
1046166399 8:110442133-110442155 TGGGGTCTACTTGAGTGGGGAGG + Intergenic
1046255217 8:111687883-111687905 CAGGGATTACTTGAGGGTGGAGG - Intergenic
1046865358 8:119143437-119143459 CATGGCCTACTTGAGGGTGGAGG + Intergenic
1046975475 8:120271211-120271233 CAGGGCCTACTTGTGGGTGGAGG + Intronic
1047162978 8:122402304-122402326 TGGGCTCTTCTTGAGGGTGGAGG + Intergenic
1047171099 8:122492975-122492997 TGGGGTCTACTTGATGGGGGAGG - Intergenic
1047264887 8:123297232-123297254 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1047438529 8:124856351-124856373 CGGGGTCTACTTGAGGGTGGAGG + Intergenic
1047595020 8:126369664-126369686 TGGGATCTTCTTGAGGGTGGAGG - Intergenic
1047609537 8:126507624-126507646 CAGGGCCTACTGGAGGGTGGGGG + Intergenic
1047641937 8:126829954-126829976 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1048145422 8:131837092-131837114 CAGGGTTTACTTGAGGGTGGAGG - Intergenic
1048169840 8:132095669-132095691 CTGGCTCTTCTTGATGGTGGTGG - Intronic
1048375474 8:133818928-133818950 CAGGGTCAGCTTGGGGTGGGGGG + Intergenic
1048723043 8:137348937-137348959 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1049129723 8:140827530-140827552 GAGGGTTTTTTTTAGGGGGGTGG + Intronic
1049652674 8:143780478-143780500 TAGGATCTACTTGAGGGTGGAGG - Intergenic
1049823587 8:144652745-144652767 TAGGGTCTACCTGAGGGTGGAGG + Intergenic
1050181714 9:2930137-2930159 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1050498078 9:6265531-6265553 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1050728314 9:8677509-8677531 CAGGGCCTAATTGAGGGTGGAGG + Intronic
1050971954 9:11889023-11889045 CAGGCTCTTTTTTTGGGGGGTGG + Intergenic
1051267861 9:15326097-15326119 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1051725152 9:20081465-20081487 CTGGGGCTTGTTGAGGGGTGGGG + Intergenic
1051861775 9:21633416-21633438 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
1051930829 9:22383378-22383400 CAGGGCCTACTTGAGGGTTGAGG + Intergenic
1052071454 9:24086775-24086797 TGGGGTCTACTTGAGGGTGGAGG + Intergenic
1052203415 9:25809600-25809622 CTGGGGCTTGTTGAGGGGTGGGG - Intergenic
1052618770 9:30877964-30877986 CAGAGTCTACTTGAGAGTGGAGG - Intergenic
1052669208 9:31534100-31534122 AGGGGTCTACTTGAGGGTGGAGG - Intergenic
1052703662 9:31968193-31968215 TAGGGTCTACTTGAGGTGGTAGG + Intergenic
1052996128 9:34552435-34552457 CAGGATCTGCCTGATGGGGGAGG - Intronic
1053679706 9:40476832-40476854 TAGGGTGTGCTTGAGGGAGGAGG + Intergenic
1053798685 9:41749264-41749286 CAGGGTCTGCTTGAGTGGGGAGG + Intergenic
1053801324 9:41766232-41766254 CAGGGTCTTCTGTAGTGGGGTGG + Intergenic
1053929699 9:43105160-43105182 TAGGGTGTGCTTGAGGGAGGAGG + Intergenic
1054143876 9:61548591-61548613 CAGGGTCTTCTGTGGTGGGGTGG - Intergenic
1054146517 9:61565697-61565719 CAGGGTCTGCTTGAGTGGGGAGG - Intergenic
1054187100 9:61961309-61961331 CAGGGTCTGCTTGAGTGGGGAGG + Intergenic
1054189754 9:61978386-61978408 CAGGGTCTTCTGTAGTGGGGTGG + Intergenic
1054284014 9:63148113-63148135 TAGGGTGTGCTTGAGGGAGGAGG - Intergenic
1054356384 9:64067176-64067198 CAGGTTCCTCTTCAGGGGTGGGG + Intergenic
1054390806 9:64616843-64616865 TAGGGTGTGCTTGAGGGAGGAGG + Intergenic
1054463654 9:65479930-65479952 CAGGGTCTTCTGTGGTGGGGTGG - Intergenic
1054466254 9:65496765-65496787 CAGGGTCTGCTTGAGTGGGGAGG - Intergenic
1054504916 9:65899466-65899488 TAGGGTGTGCTTGAGGGAGGAGG - Intergenic
1054651408 9:67627213-67627235 CAGGGTCTGCTTGAGTGGGGAGG - Intergenic
1054706519 9:68468184-68468206 CCGGGTCTTCTTGAGGAGTAGGG - Intronic
1054750482 9:68899921-68899943 AAGGGCCTACTTGAGGGTGGAGG - Intronic
1055034395 9:71802792-71802814 TAGGTTCTACTTGATGGGGGAGG + Intronic
1055133159 9:72798671-72798693 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1055225782 9:73993017-73993039 TAAGGTCTTCTTGAGGGAGGAGG + Intergenic
1055361959 9:75501144-75501166 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
1055369884 9:75586212-75586234 CAGGGCCTCCCTGAGGGTGGAGG + Intergenic
1055472946 9:76631825-76631847 CAGGGACTACTAGAGGGTGGAGG - Intronic
1055531395 9:77187867-77187889 CAAGGCCTACTTGAGGGTGGAGG - Intronic
1055702131 9:78956489-78956511 CAGGGTCTTCTTGTGGTGACAGG + Intergenic
1055990989 9:82105352-82105374 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1056127396 9:83549107-83549129 TGGGGTCTTCTTGAGGGGGCAGG - Intergenic
1056181373 9:84086162-84086184 TGGGGTCTACTTGATGGGGGAGG - Intergenic
1056669181 9:88609313-88609335 CAGGGCTTACTTGAGGGTGGAGG - Intergenic
1057096218 9:92312486-92312508 TGGGGTCTACTTGAGGGTGGAGG + Intronic
1057408037 9:94791327-94791349 CAGGGCCTGCTTGAGGGTGGAGG + Intronic
1058019357 9:100070848-100070870 CAGAGTCTACTTCTGGGGGGAGG - Intronic
1058087364 9:100763070-100763092 GGGGTTCTTCTTGAGGGTGGAGG - Intergenic
1058178028 9:101760971-101760993 CAGGGCCTACTTGACGGTGGAGG - Intergenic
1058199028 9:102015428-102015450 TGGGGTCTACTTGAGGGTGGCGG + Intergenic
1058238337 9:102522547-102522569 CAGAGCCTACTTGAGGGTGGAGG - Intergenic
1058318734 9:103602446-103602468 AGGGGACTTCTTGAGGGTGGGGG + Intergenic
1058669954 9:107352426-107352448 TGGGGTCTGCTTGAGGGTGGAGG - Intergenic
1058770641 9:108227940-108227962 TAGGGACTTTTTGAGTGGGGGGG - Intergenic
1058831359 9:108820205-108820227 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1059839764 9:118200769-118200791 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1060122015 9:121000834-121000856 CAGGGCCTGCTTGAGGGTGGAGG - Intronic
1060340701 9:122773990-122774012 CAGGGTCTACTTGAGAGTGGAGG + Intergenic
1061170188 9:128947931-128947953 AAGAGTCTTCTTCAGGAGGGGGG + Intronic
1061399375 9:130360035-130360057 CGGGGTCTTCTGGTAGGGGGAGG + Intronic
1061899595 9:133666147-133666169 CAGGGTCACCTGGAGGGGGTGGG + Intronic
1062101041 9:134728752-134728774 CACGGGCTTCTTGCTGGGGGTGG - Exonic
1062299165 9:135854924-135854946 TGGGGTCTCCTTGAGGGTGGAGG - Intronic
1062698723 9:137888355-137888377 CAGGGGCTTCCTGAGGGGCCCGG - Intronic
1062756982 9:138304471-138304493 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1203561803 Un_KI270744v1:64079-64101 CAGGTTCCTCTTCAGGGGCGGGG - Intergenic
1185775413 X:2799245-2799267 CAGGGCCTACTTGAGGGCAGAGG - Intronic
1185843946 X:3419541-3419563 CGGGGTCTGCTTGAAGGGGGAGG - Intergenic
1185881352 X:3744241-3744263 TGGGGTCTACTTGAGCGGGGCGG + Intergenic
1185881974 X:3749410-3749432 TAGGGCCTACTTGAGGGTGGAGG - Intergenic
1185930558 X:4198398-4198420 AAGGGTCTACTTGAGGGTGAAGG - Intergenic
1186052091 X:5607581-5607603 CAGGGCCTACTTGAGGATGGAGG + Intergenic
1186334509 X:8572287-8572309 CAGGGCCTGCTTGGGGGAGGTGG - Intronic
1186378203 X:9031608-9031630 CTGGGCCTACTTGAGGGTGGAGG + Intronic
1186632395 X:11364190-11364212 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1187217826 X:17294245-17294267 CAGGTCCTACTTGAGGGTGGAGG + Intergenic
1187600285 X:20821732-20821754 CAGGGTCTACTTGAGGGTGGAGG + Intergenic
1187636538 X:21235462-21235484 CAGGGCCTACTTGAGGGGGTAGG + Intergenic
1187746425 X:22414214-22414236 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1188147093 X:26627659-26627681 CAGGGCCTCCCTGAGGGAGGAGG - Intergenic
1188172573 X:26945978-26946000 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1188362311 X:29271016-29271038 CAAGGTCTACTTGAGGGTGGAGG - Intronic
1188516581 X:30994021-30994043 CAGAGGCTACTTGAGGGTGGAGG - Intergenic
1188661108 X:32759832-32759854 CAGGTTTTTCTTGGGGGGGGGGG + Intronic
1188738658 X:33749960-33749982 CAGGGCCTACTTGAGGATGGAGG - Intergenic
1189052858 X:37664720-37664742 CAGGGCCTACTTGAGGAGGGAGG - Intronic
1189095665 X:38136395-38136417 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1189132062 X:38509900-38509922 CAGAGCCTACTTGAGGGTGGAGG + Intronic
1189388331 X:40555563-40555585 CAGGGCCTACTCGAGGGTGGAGG + Intergenic
1189611231 X:42738341-42738363 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1189653600 X:43217066-43217088 CAGGGTGTACTTGAGGGTGGAGG + Intergenic
1190167925 X:48088550-48088572 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1190259658 X:48789971-48789993 CAGACTCTTCTAGAGGGGGAGGG + Intronic
1190324339 X:49197626-49197648 CAGGAGCTACTTGCGGGGGGAGG + Intronic
1191176726 X:57511070-57511092 TAAGGTCTACTTGAGGGTGGAGG - Intergenic
1191219287 X:57969684-57969706 CAGGACCTACTTGAGGGTGGAGG - Intergenic
1191629567 X:63307396-63307418 TAGGGTCTCCTTGAAGGAGGAGG + Intergenic
1191763805 X:64673679-64673701 CAGGGCCTACTTGAGGGTTGAGG + Intergenic
1191818752 X:65278804-65278826 TGGGGTCTACTTGAGGGGGGAGG - Intergenic
1191850700 X:65583820-65583842 CAGGGCCTACTTGAGGGTGAAGG - Intergenic
1191919796 X:66243325-66243347 CAGGGTGTACTTGAGGGTGGAGG + Intronic
1191927719 X:66331880-66331902 CAGGGTGTACTTGAGGGTGGAGG - Intergenic
1192042108 X:67633290-67633312 CAGGGCCTACTTGATGGTGGAGG - Intronic
1192072032 X:67951113-67951135 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1192338997 X:70246741-70246763 CAGGGCCTACTTGAGAGTGGAGG + Intergenic
1192354825 X:70391773-70391795 CAGGGCCTACTTGAGGGTGGAGG - Intronic
1192616195 X:72625257-72625279 CAGGACCTTCTTGAGGATGGAGG - Intronic
1192849326 X:74937719-74937741 CAGGGTCTACTTAAGGGTGGAGG - Intergenic
1192922939 X:75726675-75726697 CTGGGCCTTCCTGAGGGTGGAGG - Intergenic
1193085167 X:77442409-77442431 CAGGGCCTACTTGAAGGTGGAGG - Intergenic
1193340534 X:80343954-80343976 CAGGGCCTACTTGAGGGAGGAGG - Intronic
1193467051 X:81862273-81862295 CTGGGTGTACTTGAGGGTGGAGG + Intergenic
1193472960 X:81928807-81928829 CAGGGTCTATTTGAGGGTGGAGG + Intergenic
1193482073 X:82039015-82039037 CAGGGCCTACCTGAGGGTGGAGG + Intergenic
1193824093 X:86201274-86201296 CAGGGTCTTCTTGAGGGGGGTGG + Intronic
1193825378 X:86219464-86219486 TGGGGTCTACTTGAGGGTGGAGG - Intronic
1193851738 X:86545389-86545411 CAGGGCCTACTTGAGGGTGGAGG + Intronic
1194091918 X:89587780-89587802 CAGGGGCTACTTGAGGGTGGAGG + Intergenic
1194167431 X:90536271-90536293 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
1194234428 X:91364692-91364714 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1194260964 X:91695153-91695175 CAGGGCCTATTTGAGGGTGGAGG - Intergenic
1194290021 X:92060487-92060509 CAGGGTCTACTTCAGGGTGGAGG - Intronic
1194338053 X:92673664-92673686 CAGGGACTACTAGAGGGTGGAGG + Intergenic
1194407193 X:93511274-93511296 CAAGGCCTACTTGAGGGTGGAGG - Intergenic
1194545910 X:95233169-95233191 CAGGGTCTACTTGAGGGTGGAGG + Intergenic
1194593455 X:95830021-95830043 TGGGGTCTGCTTGAGGGTGGAGG - Intergenic
1194780858 X:98024040-98024062 TGGGGTCTACTTGAGGGAGGAGG - Intergenic
1194842417 X:98760433-98760455 CAGGGTCTACTTGTGTGGGGAGG - Intergenic
1194982973 X:100459415-100459437 CAGGGCCTACTTAAGGGTGGAGG + Intergenic
1195142170 X:101972704-101972726 CAGGGTCTTGTGGTGGAGGGTGG - Intergenic
1195280252 X:103326530-103326552 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1195448494 X:104981287-104981309 CAGGGCCTACTTGAGGGTGAAGG - Intronic
1195602268 X:106762859-106762881 CGGGGCCTACTTGAGGGTGGAGG + Intronic
1195833092 X:109082350-109082372 CAGGGCATACTTGAGGGTGGAGG - Intergenic
1195979720 X:110564351-110564373 TAGGGCCTACTTGAGGGTGGAGG + Intergenic
1195994121 X:110714166-110714188 TGGGGTCTTCTTGAGGATGGAGG - Intronic
1196010554 X:110882986-110883008 CAGGACCTTCTTGAAGGTGGAGG - Intergenic
1196080694 X:111627620-111627642 CTGGGTCTACTTGAGGGCGGAGG + Intergenic
1196357626 X:114812101-114812123 CTGGGTCCTGTTGTGGGGGGTGG - Intronic
1196365220 X:114916106-114916128 CAGGGTTCTCTAGAGGGGAGAGG + Intergenic
1196541023 X:116908383-116908405 CTGCTTCTTCTTGGGGGGGGCGG + Intergenic
1196575607 X:117314813-117314835 CTGGGACTACTTGAGGGGGGAGG - Intergenic
1197107797 X:122736421-122736443 CAGGGCCTACTTGAGGGTGGAGG + Intergenic
1197132101 X:123017439-123017461 TGGGGTGTTCTTGAGGGTGGAGG - Intergenic
1197367236 X:125579158-125579180 CAGGACCTACTTGAGGGTGGAGG - Intergenic
1197567997 X:128112326-128112348 CAGGGCTTACTTGAGGGTGGTGG + Intergenic
1197621326 X:128752976-128752998 TGGGGTCTACTTGAGGAGGGAGG - Intergenic
1197791069 X:130254746-130254768 GAGGGCCTACTTGAGGGTGGAGG + Intronic
1197913175 X:131507561-131507583 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1198054481 X:132980407-132980429 CAGGGCCTACTTGAGGGAGGAGG + Intergenic
1198063204 X:133068239-133068261 CAGGGCCTACTTGAGGGTAGAGG + Intronic
1198068437 X:133123369-133123391 CTGGGCCTTCTTGAGGGTGGAGG - Intergenic
1198076578 X:133199058-133199080 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1198195313 X:134354792-134354814 TGGGGTCTACTTGAGGAGGGAGG - Intergenic
1198245071 X:134822756-134822778 TAGGGTCTACTTGAGCGGGGAGG + Intronic
1198383842 X:136108917-136108939 TGGGGTCTACTTGAGGGTGGAGG - Intergenic
1198528114 X:137522499-137522521 CAGGGCCTACTTGAGGGTAGAGG - Intergenic
1198722299 X:139635878-139635900 ACGGGTCTACTTGAGGGTGGAGG - Intronic
1198837722 X:140821837-140821859 CAGGGCCTACTTGAGGATGGAGG - Intergenic
1198945463 X:142008166-142008188 CAGGGCCTACTTGAGGGTGGAGG - Intergenic
1199262701 X:145794209-145794231 CTGGGTCTACTTGAGGGTGGGGG + Intergenic
1199788382 X:151126532-151126554 CAGGGCCTACTTGAGGGTGAAGG + Intergenic
1199877003 X:151940782-151940804 CAGGACCTGCTTGAGGGTGGAGG - Intergenic
1200058159 X:153472321-153472343 CAGGTTCTCCATGAGGGGGATGG - Intronic
1200330065 X:155286134-155286156 TGGGGTGTTCTTGAGGGTGGAGG - Intronic
1200444558 Y:3243842-3243864 CAGGGACTACTTGAGGGTGGAGG + Intergenic
1200483471 Y:3737104-3737126 CGGGGTCTACTTGAGGGGGCAGG + Intergenic
1200513694 Y:4114049-4114071 CGGGGCCTACTTGAGGGTGGAGG + Intergenic
1200579615 Y:4933955-4933977 CAGGGCCTATTTGAGGGTGGAGG - Intergenic
1200607533 Y:5285061-5285083 CAGGATCTACTTCAGGGTGGAGG - Intronic
1200819573 Y:7568637-7568659 TGGGGTCTACTTGAAGGGGGAGG + Intergenic
1201248258 Y:12028713-12028735 TGGGTTCTACTTGAGGGGGGAGG + Intergenic
1201713502 Y:17017794-17017816 CAGGGCCTACTTGAGGTTGGAGG + Intergenic
1201967769 Y:19756794-19756816 CAGGATCTACTTCAGGGTGGAGG - Intergenic
1202186860 Y:22194695-22194717 CAGGGTCCTGTTGTGGGGTGGGG + Intergenic
1202204500 Y:22391701-22391723 CAGGGTCCTGTTGTGGGGTGGGG - Intronic
1202384094 Y:24307505-24307527 TAGGGTCTACTTGAGGGTGGAGG - Intergenic
1202486689 Y:25362615-25362637 TAGGGTCTACTTGAGGGTGGAGG + Intergenic