ID: 1193824965

View in Genome Browser
Species Human (GRCh38)
Location X:86213430-86213452
Sequence TGAAAAATAATCCACCCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193824965_1193824966 16 Left 1193824965 X:86213430-86213452 CCTTTAGGGTGGATTATTTTTCA 0: 1
1: 0
2: 1
3: 33
4: 297
Right 1193824966 X:86213469-86213491 TTTAGATATTAGTGAAAAGCTGG 0: 1
1: 0
2: 0
3: 20
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193824965 Original CRISPR TGAAAAATAATCCACCCTAA AGG (reversed) Intronic
901796555 1:11682795-11682817 TGTAAAATCATCCATCCAAAGGG + Intronic
901886187 1:12224883-12224905 TTGAAAATAATCAAACCTAAGGG - Intergenic
903040920 1:20529717-20529739 TGAAGGATAATCAACCCTAAAGG + Intergenic
908611058 1:65861674-65861696 GGAAAAATATTCCACTCTCATGG - Intronic
911691135 1:100835964-100835986 TGGAAAATAACTCACCTTAAGGG - Intergenic
916215402 1:162389267-162389289 TGATAAATAGTCCAGCCCAAGGG + Intergenic
917219128 1:172708718-172708740 TGAATAATATTCCACCCCCATGG - Intergenic
918166850 1:181957733-181957755 GGAAAAATATTCCATCCTCATGG - Intergenic
918226880 1:182492021-182492043 AGAAAAAAAATCCACTCCAAAGG + Intronic
918336883 1:183524596-183524618 TACAAAATAAGACACCCTAAGGG - Intronic
919311900 1:195920587-195920609 TAAAACATAATCAACCCTAATGG + Intergenic
919368443 1:196695632-196695654 AGAAAAATATTCCATCCTCATGG - Intronic
919586228 1:199443794-199443816 GGAAAAATATTCCATCCTCATGG - Intergenic
921532050 1:216296219-216296241 TAAAAAATAATTCACCCTTTTGG + Intronic
922450903 1:225736533-225736555 TGAAAAATGATCCATCCAAGAGG + Intergenic
922727468 1:227929401-227929423 TTAAAAATAATCCACTGTAGTGG + Intronic
923454922 1:234155808-234155830 TAAAAATTACTCCACCCTATTGG - Intronic
924887544 1:248235626-248235648 GGAAAAATATTCCATGCTAATGG - Intergenic
1063549477 10:7016343-7016365 GGAAAAAAAATTCAGCCTAAGGG - Intergenic
1063844864 10:10115709-10115731 TGAAAAACATTCCACGCTCATGG - Intergenic
1063947279 10:11190470-11190492 TGAAAAAAAATGAACACTAAAGG + Intronic
1065834743 10:29646490-29646512 TGAAAAATAATCCTGCCTTCAGG - Intronic
1066220325 10:33331605-33331627 TGAAAAATAACCCACCACACAGG + Intronic
1067678411 10:48408011-48408033 GGAAAAATAATACACCAGAAAGG - Intronic
1068556139 10:58461175-58461197 GGTAAAATAATTCACACTAAGGG + Intergenic
1068831242 10:61497683-61497705 TAAAAAAAAATCCAGCCAAAAGG + Intergenic
1071040444 10:81302623-81302645 TGAAAAATCTTCCATGCTAATGG + Intergenic
1071139989 10:82498221-82498243 TGAAAAAAAATCCATCATTAAGG + Intronic
1074418933 10:113292340-113292362 AACAACATAATCCACCCTAACGG + Intergenic
1078960752 11:16266168-16266190 TGAAAAGTAATCCCCCAAAAAGG + Intronic
1079437429 11:20471827-20471849 TGAAAAACATTCCATGCTAAGGG - Intronic
1079663615 11:23074490-23074512 TGAAAAATAGTACATCCTGATGG + Intergenic
1081265004 11:41009913-41009935 TGAATTAGAGTCCACCCTAATGG - Intronic
1084367425 11:68711791-68711813 TGAAACAAAATCCACCCACAAGG - Intronic
1085006484 11:73096058-73096080 TCAAAAATAAACCACCATAAAGG + Intronic
1085566210 11:77516230-77516252 TGAAAAATAATCAATAATAATGG - Intronic
1086824537 11:91479547-91479569 GGAAAAAAAATCCATGCTAATGG + Intergenic
1087183157 11:95159169-95159191 TGAAATACACTCCAGCCTAAGGG - Intergenic
1087442428 11:98203410-98203432 GGAAAAATAGTCCATCCTCATGG + Intergenic
1087989442 11:104729970-104729992 GGCAAAATAGTCCACCTTAAGGG + Intergenic
1088129432 11:106469521-106469543 TGATAAATGATTCACACTAAGGG + Intergenic
1088866772 11:113855018-113855040 TGAAAAATGATACACACTAATGG - Intronic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1091175417 11:133553353-133553375 TGAAGAAAAAGCCATCCTAAAGG - Intergenic
1093952534 12:25180303-25180325 GGAAAAATAATCCATGCTCACGG + Intronic
1095319967 12:40815277-40815299 GGAAAAATATTCCATCCTCATGG - Intronic
1098175544 12:67786504-67786526 TGAAGAATAACCTACCCTAAAGG - Intergenic
1098678977 12:73326120-73326142 GGAAAAACATTCCACGCTAATGG + Intergenic
1098880448 12:75911934-75911956 TGAAATATAATACCTCCTAAAGG - Intergenic
1099090148 12:78296367-78296389 GGAAAAATAATCCTGCCTTATGG + Intergenic
1099497800 12:83374265-83374287 TGGAAAACATTCCACCCTCATGG - Intergenic
1099775915 12:87130005-87130027 AGAAAAATAAAACACACTAAAGG + Intergenic
1100112402 12:91261434-91261456 TCAAAAATGATCCACGCTAGAGG - Intergenic
1101977686 12:109375652-109375674 TGAAAAAGCATCAACCATAAAGG - Intronic
1102101722 12:110283308-110283330 AGATAAATATACCACCCTAAAGG - Intronic
1102665181 12:114565752-114565774 TGAAAAATAATAAAGCCTATTGG - Intergenic
1102840814 12:116119131-116119153 TCAAATATAATCACCCCTAACGG + Intronic
1103002387 12:117395236-117395258 TAAAAAATAACCCACCCTCATGG - Intronic
1103141584 12:118553380-118553402 TGTAAAATGACCTACCCTAAGGG - Intergenic
1104548046 12:129730394-129730416 TGAAACAGCATCCACCCTCAGGG - Intronic
1104622107 12:130322652-130322674 TCATAAATAATCCACCCAAGTGG - Intergenic
1105826924 13:24131031-24131053 TGAAATAAAACCCATCCTAAAGG + Intronic
1108418000 13:50220528-50220550 TGACAAATAAACCATACTAAGGG + Intronic
1109372374 13:61440107-61440129 TGAAAAACATTCCATCCTCATGG + Intergenic
1109577894 13:64285755-64285777 TAAAGTATAACCCACCCTAAAGG + Intergenic
1109632350 13:65066496-65066518 TGGAAAAAAATCTATCCTAATGG + Intergenic
1109791262 13:67250916-67250938 TGAAAAAATATCCACCACAATGG - Intergenic
1110883314 13:80600543-80600565 TGAAAAATTATCCAATCAAATGG + Intergenic
1111055317 13:82941299-82941321 TGAAAAATAATCTGCCCTCAGGG - Intergenic
1111092596 13:83466313-83466335 GGAAAAACATTCCATCCTAATGG + Intergenic
1111592334 13:90365893-90365915 TGTAAAGTAATCCACCCTACAGG - Intergenic
1112142449 13:96660283-96660305 TTAAAAATAATACATACTAAAGG + Intronic
1113223643 13:108134525-108134547 TGAAAATTAATTCATCCTGAAGG + Intergenic
1113486685 13:110658175-110658197 TGAAATATAATTCAGCCTAAAGG + Intronic
1113897065 13:113771379-113771401 TGAATAATAATCCACTATATGGG + Intronic
1114136158 14:19853868-19853890 GGAAAAATACTCCACGCTCATGG - Intergenic
1115928442 14:38463682-38463704 GGAAAAATATTCCATCCTCATGG - Intergenic
1116083971 14:40211171-40211193 AGAAAAATAATCCATGCTAAAGG - Intergenic
1116977915 14:51136300-51136322 GGAAAAATATTCCATCCTCATGG + Intergenic
1117196431 14:53344260-53344282 TGAAATATATTCCACCCCAAAGG - Intergenic
1117245119 14:53877000-53877022 GGAAAAATATTCCACGCTCATGG + Intergenic
1117437554 14:55731392-55731414 TGAAAAATAACCCACATTAAAGG - Intergenic
1118940083 14:70326180-70326202 TGACAAATAATCTTCACTAAAGG - Exonic
1119371649 14:74150709-74150731 TGAAAATGAATACACTCTAAGGG + Intronic
1119376938 14:74202263-74202285 TGAAAAGGAACCCACACTAAGGG - Intergenic
1119952131 14:78756061-78756083 TGAAAAAGAGACTACCCTAATGG - Intronic
1120118205 14:80644913-80644935 AGGAAAATAATCCACTCTCATGG + Intronic
1121861686 14:97324658-97324680 TTAAAAAAAATGTACCCTAAAGG + Intergenic
1122033274 14:98929008-98929030 TGAAATATAATCAACCCTGCTGG - Intergenic
1122064818 14:99165547-99165569 TGAGAAATAAGCCACAGTAAAGG + Intergenic
1125235453 15:37507697-37507719 GGAAAAATATTCCATCCTCATGG - Intergenic
1125440813 15:39701317-39701339 TGGAAAAAAATCCACCTTATTGG + Intronic
1126219208 15:46193020-46193042 AGAAAAATATTCCATACTAATGG - Intergenic
1126372084 15:47958131-47958153 GGAAAAATAATCCATGCTCATGG - Intergenic
1126540222 15:49814198-49814220 TGAAAAAAAAAAGACCCTAAAGG - Intergenic
1126871300 15:52991195-52991217 GGAAAAATATTCCATCCTCATGG - Intergenic
1127193004 15:56552337-56552359 TGAAAAATTATACCCACTAATGG - Intergenic
1127653640 15:61034578-61034600 TGGTAAATAATCCTCCCTACTGG - Intronic
1128880568 15:71238639-71238661 TGAATAATAATCCACTCTGTGGG + Intronic
1129563637 15:76597319-76597341 TGAAAAACATTCCATGCTAATGG + Intronic
1130392088 15:83465707-83465729 GAAAAAATAATCCACCCAACTGG - Intronic
1132350169 15:101134352-101134374 TAAAAAATAATTCAGCCCAAAGG - Intergenic
1133309874 16:4838085-4838107 TTAAAAAAAATCCATCCAAAGGG + Intronic
1133956517 16:10448398-10448420 TGGAAAATATTCCATGCTAATGG - Intronic
1136659467 16:31743748-31743770 GGAAAAATATTCCATCCTCATGG - Intronic
1136864696 16:33737499-33737521 TTATAAATTATCTACCCTAAAGG + Intergenic
1137278080 16:46950605-46950627 TGAGATCTAAGCCACCCTAAAGG + Intergenic
1137288049 16:47032451-47032473 TGAGATCTAAGCCACCCTAAAGG - Intergenic
1139019677 16:62732032-62732054 TGAAAAATACACCTTCCTAAGGG + Intergenic
1139070464 16:63375013-63375035 GGAAAAATATTCCACATTAATGG + Intergenic
1139097582 16:63723502-63723524 GGAAAAATATTCCATCCTCATGG - Intergenic
1140413442 16:74755878-74755900 TAAAAAAAAATCAACCGTAAGGG + Intronic
1140656782 16:77149161-77149183 TAAATAATAAAACACCCTAATGG + Intergenic
1140678729 16:77362249-77362271 TGATCAATAATCCTCCCTATGGG + Exonic
1203126191 16_KI270728v1_random:1585635-1585657 TTATAAATTATCTACCCTAAAGG + Intergenic
1144114537 17:12074584-12074606 TGAAGAATAAGCCACCTAAAAGG - Intronic
1148972508 17:51496682-51496704 TAAAAAATAAAACACCCTGAGGG - Intergenic
1150741469 17:67782122-67782144 TGGGAAATAATGCATCCTAAGGG - Intergenic
1153046731 18:862644-862666 TGAAAAAAGAACCACCATAAAGG - Intergenic
1153247278 18:3084702-3084724 CAAAAAATAGTCCACTCTAAAGG - Intronic
1153506172 18:5801353-5801375 GGAAAAATATTCCACACTCATGG - Intergenic
1155162525 18:23207493-23207515 GGAAGAATAACCCAGCCTAAAGG - Intronic
1155503813 18:26513385-26513407 TTAAAAATAATACACCCTGGAGG - Intronic
1155754519 18:29473818-29473840 GGAAAAACATTCCACCCTCATGG - Intergenic
1155832736 18:30538607-30538629 TGAATAAAGGTCCACCCTAATGG - Intergenic
1156652472 18:39240462-39240484 TTGAAAATAATCCTACCTAATGG - Intergenic
1158347848 18:56533831-56533853 TGGATTAGAATCCACCCTAAAGG + Intergenic
1159310336 18:66699333-66699355 TGTAATATAATCCACATTAATGG + Intergenic
1159686113 18:71423059-71423081 AGAAAAATATTCCACGCTCATGG - Intergenic
1160141365 18:76326600-76326622 AGAGAAAGAATCCACCCCAAGGG - Intergenic
1160339314 18:78073974-78073996 TGAAAAATAATCCAGTATTAGGG - Intergenic
1164550160 19:29204062-29204084 TGAAAAATAATACCCGCTCAGGG - Intergenic
1165677686 19:37742190-37742212 GGAAAAAGATTCCATCCTAATGG + Intronic
1167204852 19:48094240-48094262 TGAAAAATAATTCATGGTAAGGG - Intronic
925588702 2:5488603-5488625 TGAAAAATATTCCACGTTCATGG + Intergenic
926135910 2:10336270-10336292 AAAAAGATAATCCACCCAAAAGG - Intronic
926501516 2:13659384-13659406 TGAAAAAAAATTCATCCTCATGG - Intergenic
927320797 2:21743361-21743383 GGAAAAATAATCCATGCTCATGG - Intergenic
928679411 2:33684344-33684366 TGAAAGATAATCCATTCTCATGG - Intergenic
929262125 2:39877338-39877360 GGAAAAACATTCCACCCTCATGG - Intergenic
930057783 2:47265210-47265232 TTAAAAATATTCCTCCCTGAAGG + Intergenic
930368018 2:50467082-50467104 TGCAATATAATCCATCATAAAGG + Intronic
930861653 2:56080465-56080487 GGAAAAACAATCCACCCTCATGG + Intergenic
931966373 2:67540470-67540492 AGAAAAATATTCCACACAAATGG - Intergenic
932588534 2:73047928-73047950 TGAAAAAGAAACCACCCAAATGG + Intronic
934193981 2:89824565-89824587 TGGAATTTAATCCACCCGAATGG - Intergenic
935493541 2:103749911-103749933 TGAAAAATAATCCAAGTAAAAGG + Intergenic
936690872 2:114886974-114886996 TAACAAATAATTCACACTAATGG - Intronic
937081568 2:119144006-119144028 AGAAAAAGAATCCTCTCTAAAGG + Intergenic
938939358 2:136155501-136155523 TGAAAAATCAACCACCCTCATGG + Intergenic
939233853 2:139466403-139466425 TGAAGACTAATCCACACAAATGG - Intergenic
939318085 2:140578868-140578890 TAAAATATAATATACCCTAAGGG + Intronic
939560704 2:143728306-143728328 TGGATTAAAATCCACCCTAATGG + Intronic
940839519 2:158563319-158563341 TGAAAAGTAAGCCACCCTACAGG + Intronic
941135801 2:161716924-161716946 CGAAAAACAATCCACACTCATGG - Intronic
941153924 2:161952116-161952138 TGAAAAATTATCCTCTGTAAGGG + Intronic
943073441 2:183168496-183168518 GGAAAAATAATCCATGCTCATGG - Intergenic
943855784 2:192788280-192788302 GGAAAAATATTACACCCTCATGG - Intergenic
943960969 2:194263486-194263508 TGAAAAATGATCTATGCTAAAGG + Intergenic
944171508 2:196784033-196784055 TAAAACATGATCCATCCTAATGG - Intronic
946036153 2:216744011-216744033 TGAGAAATAATCCACACTCAAGG + Intergenic
1170741550 20:19062886-19062908 TGAATAATAATCCATTCTATGGG - Intergenic
1171098509 20:22357652-22357674 TGAAAAAAAATCCATGCTCATGG + Intergenic
1173343254 20:42174033-42174055 TGAAAAATAATACACTCTCTGGG - Intronic
1177392996 21:20500362-20500384 GGAAAAATATTCCATCCTCATGG - Intergenic
1177781512 21:25626906-25626928 TTAAACATCATCCACCCCAAGGG + Intergenic
1181932720 22:26415648-26415670 TGAAATGTAAGCCTCCCTAATGG - Intergenic
1184636705 22:45838151-45838173 AGAAAAACAATCCACAGTAAGGG - Intronic
952010097 3:28890940-28890962 TGAAATATTATCCACCTTGACGG + Intergenic
952331623 3:32368801-32368823 AGAAAAATAATACACACTTATGG - Intronic
952608335 3:35177075-35177097 TAAAAAATATTCCACACAAATGG - Intergenic
954188420 3:48938543-48938565 TGCAAACTAATCCATCATAAAGG + Intronic
955216808 3:56990871-56990893 GGAACAATAATCCTGCCTAAGGG + Intronic
955598558 3:60618928-60618950 TGAAACAGAATCTCCCCTAAAGG + Intronic
955689488 3:61577122-61577144 TGAGAAACAAGCTACCCTAAAGG - Intronic
956109576 3:65856985-65857007 TGAAAACCAATACACCCTGACGG + Intronic
957731714 3:84147417-84147439 TGAGAATTAATCCACTCTCATGG + Intergenic
958570503 3:95876085-95876107 TGAAAAACATTCCACGCTCATGG + Intergenic
959868561 3:111300226-111300248 AGAAAAATCATCCACCCTAGAGG - Intronic
960415025 3:117374416-117374438 TAAAAGAGAATACACCCTAATGG - Intergenic
960489036 3:118288122-118288144 TGAAAAATAATCCATATTGATGG - Intergenic
963326270 3:143866670-143866692 TGAACAGAAATCCACCGTAAAGG - Intergenic
963412409 3:144947427-144947449 AGAAAAATAATCTCCCCTACTGG - Intergenic
963737829 3:149040508-149040530 TAAAAAAAAATCCATCTTAATGG + Intronic
963794089 3:149613890-149613912 TGAAAGAAAATCCACACTCACGG + Intronic
963877014 3:150487288-150487310 AAAAAAATATTCCACCCAAATGG + Intergenic
964473496 3:157078021-157078043 TGAAAAAAAATAGCCCCTAAGGG + Intergenic
965310343 3:167119074-167119096 TGAGAAATAATTAACCCTAAGGG - Intergenic
965427253 3:168542360-168542382 TTAAAAATAATCCAATATAAAGG - Intergenic
966964706 3:184979071-184979093 TGAAAATTAAACAACCCTACTGG - Intronic
970767645 4:19569378-19569400 TGAAATATAATCCATTCTCACGG - Intergenic
970894890 4:21090522-21090544 TTAAAAACAATTCACACTAAAGG + Intronic
971327742 4:25657891-25657913 GGAAAAATAATCACCCCTATAGG - Intronic
971387838 4:26157668-26157690 TGAGAAATAAACCATCCTAATGG - Intergenic
973401735 4:49642019-49642041 TGGAAAAGAATCAACCCGAATGG + Intergenic
973548594 4:52007636-52007658 TGAACAATCATCCAAACTAATGG - Intronic
973663233 4:53130180-53130202 TTATAAATAATCCATCATAAAGG + Intronic
974880085 4:67745019-67745041 TGAAGAATAATCATCCCTCAAGG + Intronic
975379907 4:73687741-73687763 GGAAAAACATTCCACGCTAATGG + Intergenic
975510402 4:75188571-75188593 TGGAAAACAATCCTCCCTCAGGG - Intergenic
977319457 4:95493814-95493836 TCAACAATATTCCAACCTAAAGG + Intronic
977800151 4:101218460-101218482 GGAAAAAAAATCCACAGTAAGGG - Intronic
979209486 4:118082133-118082155 GGAAAAATAATCACCCCCAAAGG - Intronic
979628123 4:122869462-122869484 GGAAAAATATTCCATCCTCAAGG - Intronic
979735448 4:124077113-124077135 GGAAAAATATTCCACACTCATGG + Intergenic
979775844 4:124587610-124587632 GGAAAAATATTCCATCCTCATGG + Intergenic
979978209 4:127222933-127222955 GGAAAAACATTCCACCCTCATGG - Intergenic
980349116 4:131665015-131665037 TCATAAATCATCCACCCAAATGG + Intergenic
980505806 4:133719388-133719410 TTAAAAATAATCAGCCCCAAAGG + Intergenic
980804806 4:137798080-137798102 TGAAAGAAAACCCACACTAAGGG - Intergenic
980846365 4:138329931-138329953 TGAAAAGGATTCCACCCAAAAGG - Intergenic
982063662 4:151630347-151630369 TGAAAAATACTCCTCCCCAAAGG + Intronic
982454885 4:155597650-155597672 AGAAAAATTGTCCACCCTAAAGG - Intergenic
982700123 4:158651476-158651498 TGAAAAATATTTCTACCTAAAGG + Intronic
983522802 4:168728332-168728354 TGAAAAAACATCCATGCTAATGG - Intronic
984574979 4:181437612-181437634 TCAAAAATATTCCACCTTCAAGG - Intergenic
986511519 5:8511705-8511727 GGAAAAACATTCCACCCTCATGG - Intergenic
986929504 5:12800540-12800562 TAAAAAATAATGCAATCTAAAGG + Intergenic
987099977 5:14582491-14582513 TGAAAAAAAATTCACCCAGACGG + Intronic
987540189 5:19245101-19245123 GGAAAAAAAATCCATCCTCATGG + Intergenic
988330849 5:29837859-29837881 AGAACAACAATCCACCTTAATGG + Intergenic
988917579 5:35910607-35910629 TAAAAAAAAATCCACACTCAAGG + Intronic
989364336 5:40638777-40638799 GGAAAAATATTCCATGCTAATGG + Intergenic
990111951 5:52337244-52337266 GGAAAAATTATCCATACTAATGG - Intergenic
990476589 5:56167081-56167103 TGGAAACTAGTCCACCCTAAAGG - Intronic
990564048 5:57011247-57011269 TGACAAATATACCATCCTAATGG + Intergenic
990938512 5:61176493-61176515 TAAAAACTAATCTACCTTAAAGG - Intergenic
991078664 5:62570571-62570593 TGAACAATCATCTATCCTAAAGG - Intronic
992032467 5:72735905-72735927 AGAAAAATATTCCATGCTAATGG - Intergenic
993206042 5:84879520-84879542 AGAAAAATAATCCAGCTGAAAGG + Intergenic
993286687 5:86008229-86008251 GGAAAAATATTCCACATTAATGG - Intergenic
993450360 5:88066294-88066316 TGAAAAACATTCCATGCTAATGG + Intergenic
993506854 5:88719565-88719587 TGTAAAATAATACTCCCTCAGGG + Exonic
993796853 5:92277798-92277820 TGAAAGATATTCCACTCAAATGG + Intergenic
994199463 5:96956122-96956144 TGACAAATAATCCAATGTAAAGG - Intronic
997154304 5:131536577-131536599 TGAAATATGATCCACCCTTAGGG + Intronic
998191720 5:140031006-140031028 TCCAAAAGAATCCAACCTAAGGG + Intronic
998720338 5:144939170-144939192 TGAAAAATAACCCATGCTCATGG + Intergenic
998922865 5:147089076-147089098 TGAAAAACATTCCACGCTCATGG - Intergenic
1000771942 5:165365627-165365649 GTAAAAATACACCACCCTAAAGG - Intergenic
1000779450 5:165463227-165463249 TTTAATATAATCCACCCTAAAGG - Intergenic
1001789284 5:174441631-174441653 TGAAAAACATTCCATCCTCATGG + Intergenic
1003371309 6:5529671-5529693 TGCAAGATAAGCCACTCTAATGG + Intronic
1003705325 6:8521845-8521867 GGAAAAATATTCCATCCTCATGG + Intergenic
1007273477 6:40656305-40656327 TGAAGAATAAATAACCCTAAAGG + Intergenic
1007546181 6:42696495-42696517 AGAAAAGAAACCCACCCTAAGGG - Intergenic
1008833565 6:55799548-55799570 TGAAAGCTAATCCACTCTATTGG + Intronic
1009536973 6:64899743-64899765 TGAAAAAAATTCCACGCTCATGG + Intronic
1011330784 6:86204000-86204022 TGAAAAATAATCCAAACTGTGGG + Intergenic
1011987918 6:93473600-93473622 TAAAAAATACTCCTCCATAAAGG - Intergenic
1013178624 6:107699381-107699403 AGAAAAAAAATCCACCCTCAAGG + Intergenic
1015774185 6:136796855-136796877 AGAAAAATATTCCACGCTGATGG - Intergenic
1016294145 6:142555833-142555855 TGAGAAAATATCCTCCCTAATGG - Intergenic
1016499354 6:144701841-144701863 AGAAAAAAAATACACCCAAATGG - Intronic
1016596783 6:145812412-145812434 ATAAAAATAATCCACCCAAACGG + Intronic
1017857002 6:158358498-158358520 TGAGAAATACTTCACCCTCAAGG - Intronic
1018325707 6:162665548-162665570 GGAAAAATATTCTACCCTCATGG + Intronic
1019775093 7:2907713-2907735 TGAATAATACTCCACTCTATGGG + Intronic
1020116429 7:5478960-5478982 GGGAAAAGAACCCACCCTAATGG - Intronic
1020362114 7:7338320-7338342 GGAAAAATATTCCATGCTAATGG - Intergenic
1020946051 7:14608933-14608955 TGAAAAAAAATCCATGCTCATGG + Intronic
1021030418 7:15726202-15726224 TGGAAAATTATCCAACCTAGTGG + Intergenic
1021642188 7:22749050-22749072 TGAAAAATAATGCCCCAAAATGG + Intergenic
1021747370 7:23756122-23756144 GGAAAAATATTCCATCCTCATGG - Intronic
1022339513 7:29455338-29455360 TGAAAAATAATCCAATAGAATGG + Intronic
1022434450 7:30367827-30367849 TGAAAAATATTCGTCCCTTAAGG + Intronic
1022827858 7:34034873-34034895 TGAGAGAAAATCCACCCTGAGGG - Intronic
1024828530 7:53420918-53420940 TGAAAAATAATATTCCCTGAGGG + Intergenic
1027598855 7:80212982-80213004 TGATAAATAATACCCCTTAAAGG - Intronic
1027760711 7:82275909-82275931 TTTAAAATATTCCACCATAACGG + Intronic
1028678657 7:93498641-93498663 AGAAAAATAATCCAATCTAAAGG + Intronic
1028699318 7:93758664-93758686 TGAAAAATAAACTACCCTTGAGG - Intronic
1029696289 7:102215623-102215645 TGTAAAATAATGTACCTTAATGG + Intronic
1031270723 7:119645711-119645733 TGAAAAATATTCCATGCTCATGG - Intergenic
1031653150 7:124316672-124316694 TGATCAATTATCTACCCTAACGG - Intergenic
1034090132 7:148356307-148356329 TTAAAAAAAATCCACCATAAAGG + Intronic
1035492095 7:159289034-159289056 TGGAAAATATTCCATCCTCATGG + Intergenic
1036060682 8:5316243-5316265 TGTAAAATAATCTGACCTAATGG - Intergenic
1038298512 8:26319714-26319736 TAAAAAAAAATCCACCCTAATGG - Intronic
1038562701 8:28594430-28594452 TGAAAAATAATACAGCATACGGG - Intergenic
1039402647 8:37283744-37283766 TGAAAAATATTCCATGCTCATGG + Intergenic
1040748315 8:50673303-50673325 GGAAAAATATTCCATCCTCATGG - Intronic
1043135750 8:76521998-76522020 GGAAAAACATTCCACCCTCATGG - Intergenic
1043915413 8:85917305-85917327 TGAATAATAATCCATTGTAAAGG - Intergenic
1044499467 8:92935527-92935549 TGAAAAATAATGAACCAAAAAGG + Intronic
1044511595 8:93086739-93086761 TGTAAAATGATCCACACTCAGGG - Intergenic
1044530787 8:93305044-93305066 GGAAAAATAATTCTCCATAATGG - Intergenic
1045527441 8:102953321-102953343 ATATAAATACTCCACCCTAAAGG + Intronic
1048373107 8:133797313-133797335 TGAAAAATATTCCATCCTCATGG + Intergenic
1048810544 8:138281737-138281759 GATAAAATAAACCACCCTAATGG - Intronic
1049153113 8:141048652-141048674 TGAAAAATAACCCACAATATTGG + Intergenic
1050702084 9:8351978-8352000 GGAAAAATAAAACACCCAAAGGG - Intronic
1050936347 9:11400342-11400364 TGCAAAATAATCCACCCTCGTGG - Intergenic
1051479820 9:17547485-17547507 TGAAAAATATTCCATGCTCATGG + Intergenic
1051852236 9:21522738-21522760 GGAAAAATATTCCATGCTAACGG - Intergenic
1052245093 9:26324768-26324790 CCAGAAATAATCCACCCAAATGG - Intergenic
1055190555 9:73516339-73516361 TGTTAAATAAACCATCCTAATGG - Intergenic
1056031720 9:82560347-82560369 TGAAATATACTCTACCCTAAAGG - Intergenic
1056303309 9:85264341-85264363 TGAAAAATAAACAACACCAAAGG - Intergenic
1056514175 9:87334352-87334374 TGAAAGAAAATCCACCACAAAGG - Intergenic
1056959843 9:91113416-91113438 AGAAAACTAATCCTCCCTATTGG - Intergenic
1057540526 9:95964314-95964336 TGACACAGAAGCCACCCTAATGG - Intronic
1057712196 9:97456189-97456211 GGAAAAATATTCCATCCTCATGG + Intronic
1058460886 9:105181591-105181613 TGACAAATACACCACACTAATGG + Intergenic
1059947569 9:119427333-119427355 GGAAAAACATTCCACCCTCATGG + Intergenic
1061321576 9:129834162-129834184 TGAAAAATATTCCACAATATGGG + Intronic
1185772414 X:2774509-2774531 TCAAAAACAATCCACCCTTGAGG - Intronic
1186697259 X:12049112-12049134 GGAAAAACATTCCACACTAATGG - Intergenic
1186851599 X:13585372-13585394 AGAAACATAATCCAGTCTAAAGG - Intronic
1187849876 X:23581421-23581443 TGAAAAGTAATGGACCCAAACGG + Intergenic
1188240996 X:27789773-27789795 AGAAAAAAAATCCTCCCTAGAGG + Intergenic
1188785803 X:34344949-34344971 GGAAAAACATTCCACCCTCATGG + Intergenic
1191787442 X:64932196-64932218 TAAAAAATATTCCACACAAATGG - Intronic
1192026740 X:67460961-67460983 GGAAAAATATTCCATCCTTATGG + Intergenic
1192578653 X:72262790-72262812 TGCAAAATAATCCACTTTAAGGG - Intronic
1192667176 X:73100244-73100266 AGAAAAATTATCAAACCTAAAGG - Intergenic
1192973972 X:76263398-76263420 TGAAAAATATTCCATGCTCATGG - Intergenic
1193403587 X:81075562-81075584 GGAAAAATATTCCATGCTAATGG - Intergenic
1193623575 X:83788578-83788600 GGAAAAATAATCCATGCTCATGG + Intergenic
1193824965 X:86213430-86213452 TGAAAAATAATCCACCCTAAAGG - Intronic
1195171825 X:102276307-102276329 GGAAAAATATTCCACGCTCATGG - Intergenic
1195187035 X:102410786-102410808 GGAAAAATATTCCACGCTCATGG + Intronic
1195238130 X:102922548-102922570 TGAAAAATATTCCATGCTCATGG - Intergenic
1195926601 X:110032026-110032048 TGAAAAAAAATCCAGCTTGATGG + Intronic
1196569325 X:117247355-117247377 TGGAAAATAAACCAGCCTCAGGG + Intergenic
1196747301 X:119082619-119082641 TTGAAAATAATTCACTCTAAAGG - Intronic
1197272456 X:124440045-124440067 TGAAGAACAGTCTACCCTAAAGG + Intronic
1197586134 X:128350699-128350721 AGAAAAATATTCCATACTAAGGG + Intergenic
1197589503 X:128391020-128391042 GGAAAAATATTCCACGCTCATGG + Intergenic
1197676203 X:129333610-129333632 GGAAAAATAGTCCACACTCATGG + Intergenic
1198960677 X:142179365-142179387 GGAAAAACATTCCATCCTAATGG - Intergenic
1201405747 Y:13648082-13648104 GGAAAAATATTCCACGCTCATGG - Intergenic