ID: 1193826841

View in Genome Browser
Species Human (GRCh38)
Location X:86236734-86236756
Sequence ATGAACAATATGTGGACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193826841 Original CRISPR ATGAACAATATGTGGACTGC AGG Intronic
907825950 1:58017117-58017139 ATGAACAATCAGTGGACTAGAGG - Intronic
909903621 1:81169585-81169607 ATGTACAATATGAGGACTATAGG - Intergenic
913394265 1:118349100-118349122 CTGGACCACATGTGGACTGCAGG - Intergenic
913582944 1:120245218-120245240 GTTAACAATTTCTGGACTGCTGG - Intergenic
913625228 1:120653142-120653164 GTTAACAATTTCTGGACTGCTGG + Intergenic
914564875 1:148856714-148856736 GTTAACAATTTCTGGACTGCTGG - Intronic
914607951 1:149273528-149273550 GTTAACAATTTCTGGACTGCTGG + Intergenic
918180759 1:182084617-182084639 ATGAGCAAGATGTGAATTGCTGG - Intergenic
1063155406 10:3374795-3374817 ATGAAGAATATGTGTAATGTTGG - Intergenic
1063705117 10:8422924-8422946 ATGAAAAATATGTCAACTGTGGG + Intergenic
1066252306 10:33646504-33646526 ATAAACAATATGGAAACTGCTGG + Intergenic
1069269317 10:66505146-66505168 ATAAACAATAAGTAGACTGCAGG - Intronic
1069871810 10:71537609-71537631 AGGAACAGTGTGTGGACCGCAGG + Intronic
1070745069 10:78928717-78928739 ATGAGCATTGGGTGGACTGCAGG + Intergenic
1070971827 10:80573554-80573576 ATAAATAATATGGGGACTACTGG - Intronic
1072507380 10:96082015-96082037 ATGAACAGTATATACACTGCTGG + Intergenic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1073226307 10:101923099-101923121 ATGCACAATATCTGGACTCCAGG + Intronic
1074426021 10:113352177-113352199 ATGAAGAATATGCAGACAGCTGG - Intergenic
1074703320 10:116110867-116110889 ATGACCCATCTGTGGACTGAGGG + Intronic
1074910391 10:117903200-117903222 ATCAACATTATGAGGACTGGTGG - Intergenic
1078357340 11:10642237-10642259 GAGAACAAAATGTGGCCTGCTGG - Intronic
1078619788 11:12896593-12896615 ATGAACAATATGTTTAATGCTGG + Intronic
1082643442 11:55692209-55692231 ATGACCAATATCTGGAATTCTGG - Intergenic
1082710477 11:56548480-56548502 ATGAACAACATGAGGACTAGGGG - Intergenic
1087867637 11:103251600-103251622 ATGTACAACATGAGGACTGTAGG - Intronic
1091352245 11:134906816-134906838 ATGAGCAAAATGTGGGCAGCAGG - Intergenic
1094013640 12:25837366-25837388 ATGAACAGTTTCTGGAGTGCTGG + Intergenic
1095146663 12:38738107-38738129 ATGAACAGTATGTAGACTGGTGG - Intronic
1095751694 12:45719645-45719667 ATGCACAATGTTTGGACAGCTGG + Intergenic
1096569588 12:52514216-52514238 ATGAAGAATATGTTGCCTTCAGG - Intergenic
1098560628 12:71867619-71867641 ATGAACACTTTGTGGATTTCAGG - Intronic
1102217200 12:111169914-111169936 ATGGGCCATATGTGGACAGCAGG + Intronic
1102308997 12:111829115-111829137 AGGATCAATATGTGGGCTACAGG - Intergenic
1102315106 12:111881372-111881394 AGGATCAATATGTGGGCTACAGG - Intronic
1106966369 13:35074876-35074898 ATGTACAACATGAGGACTGTAGG - Intronic
1107094215 13:36517195-36517217 ATGAGAAATATGTAGACTGGAGG - Intergenic
1108043493 13:46360921-46360943 AGGATTAAAATGTGGACTGCTGG + Intronic
1108548733 13:51522132-51522154 ATGAAGGATATCTGTACTGCTGG - Intergenic
1109857390 13:68149458-68149480 GTGAGCAATATGAGTACTGCTGG + Intergenic
1114637781 14:24197942-24197964 AGGAACAATATGAGGCTTGCCGG - Intronic
1115275753 14:31606719-31606741 ATCATAGATATGTGGACTGCAGG + Intronic
1116270498 14:42759204-42759226 ATGAACATTATGTAAACAGCTGG - Intergenic
1117318681 14:54599432-54599454 ATGAAAAATTTGTGGACCTCGGG - Intronic
1118911445 14:70065260-70065282 ATCAACAATATGGACACTGCAGG - Intronic
1124851812 15:33347085-33347107 ATTATCAATATGTTGACTGTTGG + Intronic
1125493420 15:40166634-40166656 ATGAAAATTATGTCTACTGCTGG - Intronic
1126798685 15:52281226-52281248 ATGAACATTATGTTGACAGGTGG + Intronic
1127468942 15:59273240-59273262 CTGAACACTCTGTGGGCTGCAGG + Intronic
1130047488 15:80456948-80456970 AAGAACAAGATGGGGAATGCAGG + Intronic
1139102895 16:63789538-63789560 GTCAACAATATATGGGCTGCTGG + Intergenic
1139124317 16:64059157-64059179 ATGAGCAAAATGTGAACTGAGGG - Intergenic
1143993590 17:10987956-10987978 ATGAACACTGGGTGGTCTGCGGG + Intergenic
1150616176 17:66774006-66774028 ATGGAAAATCTGTGGACTGGTGG + Exonic
1153257640 18:3188300-3188322 ATGAAGAATATGTGGTCTTTTGG - Intronic
1156740025 18:40314212-40314234 AAGCAAAATATGAGGACTGCAGG - Intergenic
925206363 2:2010396-2010418 ATGAACAAGCTGTGAAATGCAGG + Intronic
926439126 2:12869523-12869545 ATGATCAATATGTGGGCTGAAGG - Intergenic
926792482 2:16588402-16588424 GTGAACGAGATATGGACTGCAGG - Intronic
933130195 2:78663004-78663026 TTGAACATTATTTGCACTGCAGG + Intergenic
933798405 2:85940256-85940278 ATGAACAATATGTGAAGTAGGGG - Intergenic
934625964 2:95852391-95852413 ATGAACAATATGCAGACTGAAGG - Intronic
934807611 2:97248927-97248949 ATGAACAATATGCAGACTGAAGG + Intronic
934829899 2:97508260-97508282 ATGAACAATATGCAGACTGAAGG - Intronic
935474253 2:103498922-103498944 AAGAACATTATGTTGACTGAAGG + Intergenic
938150478 2:128878393-128878415 TTGAACATTAGGTGGACTGACGG + Intergenic
938471615 2:131568076-131568098 ATGAACCATATGGAGACAGCAGG + Intergenic
938658144 2:133456895-133456917 ATGAACATTATCAGGACTGTCGG + Intronic
938666283 2:133541562-133541584 ATACATAATATGTGGACTGGAGG + Intronic
939695622 2:145320182-145320204 TTGAACAATATATAGAGTGCAGG + Intergenic
940043121 2:149380963-149380985 ATGAAGAAGATGTGATCTGCTGG + Intronic
941089090 2:161153782-161153804 ATGAACAAGATCTGGCCTACAGG - Intronic
941435565 2:165466882-165466904 ATGTACAACATGAGGACTACAGG - Intergenic
942957952 2:181796153-181796175 ATGAACCACATGTGTACTGGTGG - Intergenic
943512794 2:188846962-188846984 ATGTACAACATGAGGACTACAGG + Intergenic
945397772 2:209341352-209341374 ATGATAAATATGTGAACTGATGG - Intergenic
947464522 2:230329918-230329940 ATGAACAAAATGTGGAATACAGG - Intronic
948242799 2:236452385-236452407 ATGAAAAATATGTGGATGGAGGG + Intronic
948860678 2:240751239-240751261 CTGACCAATATGTGGGCAGCTGG + Intronic
1171989066 20:31681687-31681709 ATGAATTAGATGTGGACTGTGGG + Intronic
1174251119 20:49220385-49220407 ATGAAGTATGTTTGGACTGCAGG - Intronic
1174541210 20:51291176-51291198 ATCAACCACATGTGGCCTGCAGG + Intergenic
1176636598 21:9249572-9249594 ATGTACAACATGAGGACTGTAGG - Intergenic
949093927 3:63333-63355 ATGAATAATCTGTGTTCTGCAGG - Intergenic
949385166 3:3493740-3493762 ATAAACAATAGTTGGACTGCTGG - Intergenic
950898250 3:16473281-16473303 ATGATCAATATGTGGACATTTGG - Intronic
951865870 3:27306592-27306614 ATGAACATTATGGGGACTCATGG - Intronic
955290639 3:57689516-57689538 CTGAACAAGGTGTTGACTGCAGG - Intronic
957104165 3:75865692-75865714 ATGCACAACATGAGGACTGTAGG + Intergenic
957580654 3:82068112-82068134 AAGATCAATATGTGGAGTGAGGG - Intergenic
959676994 3:109047168-109047190 ATGTACAATATGAGGACTGTAGG - Intronic
960407492 3:117279547-117279569 ATAAGCAATTTGTAGACTGCAGG - Intergenic
965482387 3:169234887-169234909 ATGAACAATATTTAGAGAGCTGG - Intronic
965965381 3:174482553-174482575 ATAAACCAGATCTGGACTGCTGG - Intronic
970715523 4:18917735-18917757 TTGAAGAATATGTGGATTGGAGG - Intergenic
971688941 4:29808335-29808357 ATCAAAAATATTTAGACTGCTGG - Intergenic
971811251 4:31430810-31430832 ATGCACACTATGTGGAATACAGG - Intergenic
973624542 4:52758198-52758220 ATGTTCATTATGTGGACTCCAGG + Intergenic
974264543 4:59567522-59567544 ATGTACAACATGAGGACTACAGG + Intergenic
975448300 4:74493912-74493934 ATGAACAACATGAGGACTATAGG - Intergenic
980437948 4:132803117-132803139 ATGAACAATAAGTGTGTTGCTGG - Intergenic
981598634 4:146457577-146457599 ATGAACAAACTGTGGTTTGCAGG - Intronic
981644495 4:146983373-146983395 ATGAACACTATGTAGCCTTCGGG + Intergenic
1202751486 4_GL000008v2_random:8011-8033 ATGTACAACATGAGGACTGTAGG - Intergenic
986473583 5:8100391-8100413 ATGAAAAATATGAGTACTACTGG + Intergenic
986967300 5:13289542-13289564 GTGATGAATATGTGGAGTGCTGG - Intergenic
995044815 5:107633707-107633729 ATGACCAATTTGGGGACAGCAGG + Intronic
996079078 5:119235008-119235030 ATGAATAGTAAGTTGACTGCCGG - Intronic
997968698 5:138382526-138382548 GTGAGGAATATGTGGACAGCTGG - Intronic
999631158 5:153572809-153572831 ATGCACAAAATGTGCTCTGCTGG - Intronic
1005879205 6:30042119-30042141 ATGAACAAGATGGGGGCTGAGGG - Intergenic
1013837828 6:114353575-114353597 ATAAACAAAATGTCTACTGCAGG + Intergenic
1017035240 6:150261343-150261365 AGGGATAATATGTGGATTGCTGG - Intergenic
1018946523 6:168350315-168350337 GTGTACAACATGAGGACTGCGGG - Intergenic
1019948062 7:4345906-4345928 ATGTGCAATATGTTTACTGCGGG - Intergenic
1021191106 7:17620613-17620635 ATAAATAACATGTGGACTGAAGG - Intergenic
1021893263 7:25208650-25208672 ATGTACAACATGAGGACTGTAGG - Intergenic
1024556851 7:50611149-50611171 ATGAACATTGTGTGAGCTGCAGG - Intronic
1024838152 7:53548936-53548958 ATTGACATTAAGTGGACTGCTGG + Intergenic
1029963659 7:104715040-104715062 ATTAACAATATGTGCACTTTGGG + Intronic
1030077621 7:105750093-105750115 TTGAACCATGTGTAGACTGCAGG + Intronic
1030485360 7:110159429-110159451 GTGAAAAACATGTGGCCTGCTGG - Intergenic
1031734302 7:125337923-125337945 GTGAAGAATATGTGGATTACAGG - Intergenic
1033573846 7:142660607-142660629 ATGCACAATAATGGGACTGCTGG + Intergenic
1037247145 8:16847761-16847783 ATAGACAATATGTGGATTGAAGG + Intergenic
1040421844 8:47247742-47247764 ATGTACAACATGAGGACTACAGG - Intergenic
1041931851 8:63295651-63295673 ATGAACAATGAGGGGACAGCTGG - Intergenic
1042447528 8:68903858-68903880 ATGAACTAGATTTGGCCTGCAGG + Intergenic
1042712527 8:71734233-71734255 TTGAACAAAATGTGGAGTACAGG - Intergenic
1042839768 8:73111914-73111936 CTGGAAAATATGTGGCCTGCAGG + Intronic
1043472216 8:80574176-80574198 AGGCTCAATATGAGGACTGCAGG + Intergenic
1044274942 8:90288133-90288155 GTGCACAATATCTGGATTGCTGG + Intergenic
1046236112 8:111425305-111425327 GTGATGAAAATGTGGACTGCTGG + Intergenic
1046686905 8:117237925-117237947 ATGAACAAGATGTGGAATCCTGG - Intergenic
1048641003 8:136361474-136361496 ATGAACAAATTGAAGACTGCAGG - Intergenic
1051436606 9:17040323-17040345 ATGAACAACATGAGGACTACAGG - Intergenic
1055515111 9:77025607-77025629 ATGAGCAAAATGGGGAATGCTGG - Intergenic
1059308933 9:113375393-113375415 ATGAACGATATCTTGGCTGCTGG + Intronic
1059916167 9:119104295-119104317 ATGAACAATGTGTGGGCTAAGGG + Intergenic
1203718937 Un_KI270742v1:185540-185562 ATGTACAACATGAGGACTGTAGG + Intergenic
1203653171 Un_KI270751v1:149215-149237 ATGTACAACATGAGGACTGTAGG + Intergenic
1187912017 X:24119912-24119934 ATGAGAACTATGTGGACTGTGGG - Intergenic
1188870591 X:35366004-35366026 ATTAACAATATGTGTAATACAGG + Intergenic
1189506865 X:41619900-41619922 ATGAAAAATACGTGAACTGATGG - Intronic
1189760403 X:44316147-44316169 ATGAACAAATTGTGGAATTCTGG - Intronic
1193580816 X:83260382-83260404 ATGTACACTCTGTGCACTGCAGG - Intergenic
1193826841 X:86236734-86236756 ATGAACAATATGTGGACTGCAGG + Intronic
1196068720 X:111495489-111495511 GTGAACAATTTGTGGTCTGGGGG + Intergenic
1199621761 X:149707488-149707510 GTAAACAATTTGTGGAATGCAGG - Intronic
1200428129 Y:3045250-3045272 AGGAACAAGCTGTGCACTGCAGG + Intergenic