ID: 1193832287

View in Genome Browser
Species Human (GRCh38)
Location X:86304242-86304264
Sequence ACAGAGGAGTAGTCAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 358}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193832287_1193832292 -5 Left 1193832287 X:86304242-86304264 CCTTCCCCTGACTACTCCTCTGT 0: 1
1: 0
2: 3
3: 26
4: 358
Right 1193832292 X:86304260-86304282 TCTGTCTCTCCAGTGAAAAATGG 0: 1
1: 0
2: 0
3: 34
4: 298
1193832287_1193832293 -4 Left 1193832287 X:86304242-86304264 CCTTCCCCTGACTACTCCTCTGT 0: 1
1: 0
2: 3
3: 26
4: 358
Right 1193832293 X:86304261-86304283 CTGTCTCTCCAGTGAAAAATGGG 0: 1
1: 0
2: 1
3: 26
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193832287 Original CRISPR ACAGAGGAGTAGTCAGGGGA AGG (reversed) Intronic
900323389 1:2095823-2095845 AAAGAGGAGAAGGGAGGGGAAGG - Intronic
900719381 1:4165436-4165458 CCAAAGGAGCAGTCAGGGGCAGG - Intergenic
900843397 1:5076331-5076353 GCAGAGTAGGAGTCAGTGGATGG - Intergenic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902601338 1:17541473-17541495 ACTCTGGAGTAGTCTGGGGAGGG + Intronic
902672211 1:17982702-17982724 ACAGAGGAGTTGGCAGAGGCAGG + Intergenic
902801537 1:18833027-18833049 ACAGAGGAGCAGCCTGGGCAAGG - Intergenic
903283051 1:22261258-22261280 ACAGAGCTGTAAGCAGGGGAGGG + Intergenic
904352632 1:29918873-29918895 GATGAGGAGGAGTCAGGGGAAGG + Intergenic
904584416 1:31572008-31572030 ACAGAGGAGCAGGAAGGGGCTGG - Intergenic
905322458 1:37127723-37127745 GCCGAGGAGTAGCAAGGGGAAGG + Intergenic
906859300 1:49341871-49341893 AGAGAGGAGGAGAAAGGGGAGGG - Intronic
907080273 1:51615644-51615666 ACGGAGGTGTGGTCAAGGGAAGG - Intronic
909431605 1:75593831-75593853 TGAGAAGGGTAGTCAGGGGATGG + Intronic
909777554 1:79501494-79501516 ATAGAGGAGGGGTCAGGGTAGGG - Intergenic
910262718 1:85307645-85307667 ACAGAGGAGGAGAGAGGAGAGGG - Intergenic
911930487 1:103896678-103896700 GAAGAGGAGGAGGCAGGGGAAGG - Intergenic
912205804 1:107508162-107508184 AGAGAGGAGAAGTCAGTGCATGG + Intergenic
912723669 1:112040932-112040954 ACACAGGAATAGGCAGGGGGAGG + Intergenic
912812353 1:112803826-112803848 ACAGAGGAGGTGTCCTGGGAAGG - Intergenic
913411798 1:118560464-118560486 ACTGAGCTGTAGTCAGGTGATGG - Intergenic
914462420 1:147897510-147897532 ACAGACGAGTTGTCAGGGTAAGG - Intergenic
914973356 1:152332146-152332168 ACCCAGGTGTAGTTAGGGGAGGG + Intergenic
915535223 1:156531267-156531289 ACAGAGGAGAGGTAAGGGGCAGG + Intronic
915736776 1:158090241-158090263 CCAGAGGAGGAGACAGGGAAGGG - Intronic
915986738 1:160473584-160473606 ACAGAAGAGAAGACAGGGTAGGG + Intergenic
916172384 1:162010735-162010757 ACAGGGGTGTGGTCGGGGGAGGG + Intronic
916457851 1:164989357-164989379 ACAGAGGAGGTGCCTGGGGAGGG - Intergenic
916947371 1:169742368-169742390 ACAGAGGAGAAATGAGGTGAAGG - Intronic
917470782 1:175324173-175324195 ACAGAGTAGAAGCCAGAGGAAGG - Intronic
918437866 1:184534954-184534976 AAAGAGGAGCAGTGAGGGGCTGG + Intronic
919022856 1:192130333-192130355 ACAGAGGAGGAGGCAGGGTGGGG + Intergenic
919632830 1:199975629-199975651 ATAGAGGAGGAGTTAGAGGAAGG + Intergenic
919986903 1:202681777-202681799 TCAGCTGAGCAGTCAGGGGATGG + Intronic
920503671 1:206501395-206501417 ACAGAGGAGGAGACAGGTGGGGG + Intergenic
921567250 1:216735548-216735570 ACAGAGGTGGAGGCAGGGCAGGG - Intronic
922182828 1:223248915-223248937 ACAGAGGAGCACACAGGTGAGGG + Intronic
922480408 1:225936754-225936776 CCAGAGGAGTGGGCAGGGGTAGG + Exonic
922893469 1:229080355-229080377 CCAGAGGCTTAGGCAGGGGATGG - Intergenic
923110902 1:230889240-230889262 AAAGAGCAGAAGCCAGGGGAAGG + Intergenic
1062958613 10:1556777-1556799 ACAGAGCTGTGGTCAGGGGCAGG - Intronic
1063805342 10:9632849-9632871 ACAGCAGAGTAGGCAGCGGAGGG + Intergenic
1064405104 10:15054631-15054653 ACAAAGTAGTAGTCATGGAAGGG - Intronic
1065306862 10:24377373-24377395 ACTGAGGAGGAAGCAGGGGATGG - Intronic
1065487595 10:26249840-26249862 ACAGAGGAGTGGTGGGGGAAAGG + Intronic
1068600137 10:58948189-58948211 GCAGAGGGGAAGTAAGGGGACGG - Intergenic
1068781905 10:60928636-60928658 AAAGGGGAGTAGAAAGGGGATGG + Intronic
1068785394 10:60967167-60967189 AAAGAGTAGTAGTCCGGGCAAGG + Intronic
1069344739 10:67455472-67455494 ACAGGAGAGTAGGAAGGGGAAGG + Intronic
1071732461 10:88262048-88262070 ACAGAGGCGGAGGCAGGAGAGGG + Intergenic
1072208433 10:93224758-93224780 AAAGAGGAGAATTCAGGGAAGGG + Intergenic
1072231200 10:93415271-93415293 GCAGAGGTGAAGTCAGTGGAGGG - Intronic
1072625662 10:97109691-97109713 ACAGAGGAGGGGTGAGGGGCGGG + Intronic
1072862786 10:99023500-99023522 ACATAGGAGTAGCCAGGGAGTGG + Intronic
1073150021 10:101305175-101305197 ACAGGGGTGTCTTCAGGGGAGGG - Intergenic
1073842155 10:107510058-107510080 ACAGAGCAGGTGTAAGGGGATGG + Intergenic
1075851905 10:125595794-125595816 GCAGAGAAGTAAACAGGGGAAGG - Intronic
1076304874 10:129458878-129458900 ACACAGGATTAGGGAGGGGAGGG - Intergenic
1076369809 10:129945083-129945105 AGAGAGGAGAAGGGAGGGGAGGG + Intronic
1076730685 10:132437425-132437447 CCAAAGGAGTAGTCAGGGCCAGG + Intergenic
1078276751 11:9855963-9855985 TCAGAGCAGTAGCCAGAGGACGG + Intronic
1078466419 11:11553559-11553581 GAGGAGGGGTAGTCAGGGGAGGG + Intronic
1079057179 11:17216389-17216411 ACAGAGGACTAGTCAGGGGCTGG - Intronic
1079116371 11:17643134-17643156 ACAGAGGATAAGGGAGGGGAGGG - Intronic
1080063171 11:27979715-27979737 CCAGCGGAGATGTCAGGGGATGG + Intergenic
1080143764 11:28954416-28954438 AGAGAGGAGAAGTCAGTGCATGG + Intergenic
1081471236 11:43372941-43372963 ACAGAGGAATAGAGAGAGGAAGG + Intronic
1081677676 11:44980489-44980511 ACAGAGGAGAAAACAGGGGGCGG + Intergenic
1083431739 11:62616821-62616843 ACAGAGGGGTGGTCCGGGGAAGG + Intronic
1084551238 11:69843382-69843404 GCAAAGGAGTGGGCAGGGGAAGG + Intergenic
1084939291 11:72603772-72603794 ACGGAGAAGTTGTTAGGGGAAGG + Intronic
1084949138 11:72655034-72655056 ACAGTGGGGGAATCAGGGGAAGG + Intronic
1085410353 11:76287205-76287227 TCAGAGGAGGAGCCAGGGGAGGG - Intergenic
1086240360 11:84682848-84682870 TCAGAGGAGTAGTGAGAAGAGGG + Intronic
1087104751 11:94398338-94398360 GCGGAGGAGTGGGCAGGGGAGGG - Intronic
1088278828 11:108116732-108116754 ACAGGGGAGAAGACAGGGGTTGG + Intergenic
1088992537 11:114966285-114966307 ATAGAGGATGTGTCAGGGGATGG + Intergenic
1089305308 11:117522739-117522761 ACACAGGAGCAGTGAGGAGACGG - Intronic
1089332954 11:117702457-117702479 AAAGAGGAGCAGTCAGGGAAAGG - Intronic
1089609367 11:119660896-119660918 ACAGAGGGATAGTGAGGGGAAGG - Intronic
1090277128 11:125428180-125428202 ACAGATGCGTAGTCAGTGCACGG + Intronic
1090782991 11:130023778-130023800 ACAGAGAAGTAGTACTGGGAAGG + Intergenic
1091283963 11:134397784-134397806 AGAGAGGAGCAGGCAGGGCATGG - Intronic
1091636285 12:2199334-2199356 ACTGAGGAGGAGGAAGGGGAGGG - Intronic
1093468073 12:19471052-19471074 AAAGAGGAGGAATCAGGGGTTGG - Intronic
1096266866 12:50130455-50130477 ACAGAAGAGTAGATATGGGAAGG + Exonic
1096899484 12:54860164-54860186 ACAGAGGAGTAGAAACGGTAGGG - Intergenic
1097614069 12:61862751-61862773 CCAGTGGAGTATTCAGGGAAAGG - Intronic
1097979198 12:65719729-65719751 ACAGAGGATGAGGCAGGAGATGG + Intergenic
1099957431 12:89364323-89364345 ACTCTGGAGTAGTGAGGGGAGGG + Intergenic
1101205652 12:102484490-102484512 GCAGAGGAGAAGTCACGGCATGG + Intergenic
1101572092 12:105962982-105963004 ACAGAGGAGAAGTAAAGGCAAGG + Intergenic
1103304223 12:119951696-119951718 AGAGAGGAATAGGAAGGGGAAGG + Intergenic
1103304248 12:119951760-119951782 AGAGAGGAATAGGAAGGGGAAGG + Intergenic
1103304275 12:119951836-119951858 AGAGAGGAATAGGAAGGGGAAGG + Intergenic
1103304298 12:119951900-119951922 AGAGAGGAATAGGAAGGGGAAGG + Intergenic
1103304321 12:119951964-119951986 AGAGAGGAATAGGAAGGGGAAGG + Intergenic
1104134138 12:125921477-125921499 ACAGAGGATGAGACAGGGGTTGG - Intergenic
1104481311 12:129110645-129110667 GCAGAGGAGCTGCCAGGGGAAGG + Intronic
1104752658 12:131249904-131249926 ACCCAGGAGAAGTCAGGTGAAGG + Intergenic
1104975675 12:132550958-132550980 ACAGAGGCGTAGGCAGGTGTGGG + Intronic
1105848951 13:24317828-24317850 ACAGGGGAGCAGCCAGTGGAGGG + Intronic
1106951883 13:34893440-34893462 ACAGAGGAGTAGAAAGTGAATGG + Intergenic
1109514639 13:63426120-63426142 TCAGAAGCGTTGTCAGGGGAAGG + Intergenic
1109889060 13:68583116-68583138 ACAGAGGAGGTGGCAGGGGTGGG - Intergenic
1112108447 13:96267791-96267813 ACAGGGAAGTAGGCAGGGGAAGG + Intronic
1112855408 13:103763502-103763524 AGAAAGAAGTAGTCAAGGGAGGG - Intergenic
1113098935 13:106696160-106696182 ACAGAGGAGAAGTCAGTCCAAGG + Intergenic
1113593710 13:111517669-111517691 ACACAGGAGTAGTCAGGGATGGG - Intergenic
1113692444 13:112321034-112321056 AGAGAGGAGAGGTGAGGGGAGGG + Intergenic
1114127288 14:19743704-19743726 ACAGAGGAGCAGGAAGGGGAGGG - Intronic
1114129993 14:19780478-19780500 ACATAGGAGAAGTCAGATGAGGG - Exonic
1115697828 14:35919780-35919802 ACAGAGGGTTAGTGAGTGGATGG - Intronic
1116750405 14:48876271-48876293 AAAGATGAGAATTCAGGGGAAGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117471920 14:56054882-56054904 ACAGAGGAGAAGGCAGAGAAAGG - Intergenic
1118553907 14:66991468-66991490 ACACAGGATAAGGCAGGGGACGG + Intronic
1119483955 14:74976297-74976319 AGAGAGGAGGAGCAAGGGGAAGG - Intergenic
1121366763 14:93319629-93319651 AAAGGGGAGTTGTCAGGGGCTGG + Intronic
1121467677 14:94126521-94126543 ACAGAGGAGGAGGCAGGCAAAGG - Intergenic
1121542968 14:94742294-94742316 ACAAAGGAGTAGGAAGAGGAGGG + Intergenic
1121729719 14:96178061-96178083 ACAGAGAAACAGGCAGGGGAGGG + Intergenic
1122373410 14:101242185-101242207 ACAGAGGAGAGGGGAGGGGAAGG + Intergenic
1123570744 15:21605343-21605365 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123606857 15:22040696-22040718 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1124204251 15:27703745-27703767 ACAGAAGAGTCTTAAGGGGAAGG - Intergenic
1124845520 15:33285952-33285974 GCAGAGGAATAGACAGGAGAAGG - Intergenic
1125361690 15:38871385-38871407 GCAGAGGAGGAGTGTGGGGAAGG - Intergenic
1126686966 15:51256892-51256914 AAAGAGGTGTAGTCAGATGATGG + Intronic
1127719097 15:61682337-61682359 ACAGAGGAGTTGTAAGGACAGGG - Intergenic
1128128695 15:65211340-65211362 GGAATGGAGTAGTCAGGGGAGGG + Intronic
1128342192 15:66830382-66830404 GCAGAGCTGGAGTCAGGGGAGGG - Intergenic
1128617866 15:69124249-69124271 TCAGAGGAGCAGGCAGGGGCTGG + Intergenic
1128961097 15:72005623-72005645 GCAGAGGAAGAGGCAGGGGAAGG - Intronic
1130018096 15:80202672-80202694 ACAGAGGAATAGACTGAGGAGGG + Intergenic
1130288301 15:82573386-82573408 GGAGGGGAGTAGTCAGGGGTAGG - Intronic
1202979097 15_KI270727v1_random:332466-332488 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1132456849 16:28877-28899 CCAGAGGAGGAGTGAGGGGTGGG - Intergenic
1132602304 16:778769-778791 AGAGAGGAGGAGACAGGGGCAGG + Intronic
1133335526 16:5004469-5004491 GCAGAGGTGTGGGCAGGGGAAGG + Intronic
1133517599 16:6524813-6524835 ACAGAGAAGGAGCCAGGTGATGG - Intronic
1133926935 16:10200862-10200884 ACTGAGGAGCAGCCAGAGGAGGG + Intergenic
1134110985 16:11515562-11515584 AAAGAGGAGAAGGGAGGGGAAGG + Intronic
1136349734 16:29698993-29699015 ACAGAGCAGAAGTGAGGAGAGGG + Intergenic
1137011044 16:35320430-35320452 AAACAGGAGTTGTCCGGGGAAGG + Intergenic
1138093211 16:54193505-54193527 ACGCAGGAGTCGTAAGGGGAGGG + Intergenic
1138149685 16:54644626-54644648 ACAGCCGAGTAGTGAGGGAAGGG - Intergenic
1139668875 16:68478200-68478222 ACAGAGGTGTAGTGGGGAGAGGG - Intergenic
1141578517 16:84981463-84981485 CCAGAGCAGGAGTGAGGGGAAGG + Intronic
1142059485 16:88020247-88020269 ACAGACGAGGAGTCAGCGCATGG + Intronic
1143586027 17:7850931-7850953 CCAGAGGAGTAGGAAGGGAAAGG + Intronic
1143724897 17:8838013-8838035 ATAGAGGAGTGGGGAGGGGAGGG + Intronic
1143767585 17:9147757-9147779 ACAGAGGATAAGACAGGGGATGG - Intronic
1146529105 17:33592785-33592807 ACAGAGGAGAGGGCAGTGGAAGG - Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146757928 17:35449378-35449400 TCAGAGGAGGGGTCCGGGGAAGG - Intergenic
1147386991 17:40088811-40088833 ACAGAGGAGGGATGAGGGGATGG - Intronic
1148757552 17:49981592-49981614 TCAGAGAAGAAGTTAGGGGATGG - Intergenic
1149427565 17:56569824-56569846 ATAGAGGTGGTGTCAGGGGAAGG + Intergenic
1149979351 17:61297273-61297295 ACAGAGGAAGAGGCTGGGGATGG + Intronic
1150613754 17:66753371-66753393 CCAGTGGAGGAGTCAGTGGATGG + Intronic
1150833291 17:68542182-68542204 AGAGAGGAGGAGTAAGTGGAGGG + Intronic
1151718708 17:75844085-75844107 AGGGTGGAGTAGGCAGGGGAGGG + Intronic
1151814651 17:76465766-76465788 ACAGGAGAGGAGACAGGGGAGGG - Intronic
1152290740 17:79438634-79438656 ACATAGGTGAAGTCAGGGGCTGG + Intronic
1153485755 18:5596098-5596120 ACAGAGAAATATTCAGAGGATGG - Intronic
1154143870 18:11849994-11850016 ACAGAGGAGGAGTCCTGGGGAGG + Intronic
1154949913 18:21199905-21199927 GCAGAGGAGTGGTGAGGTGAAGG - Intergenic
1155249433 18:23940842-23940864 ACCAAGGAGTAGCCAGGGGAGGG - Intronic
1156486267 18:37467561-37467583 ACAGGGGAGCAGGCAGAGGAGGG + Intronic
1156650854 18:39225862-39225884 ACAGAGGAGGAGACAAGGAAAGG + Intergenic
1158548238 18:58413892-58413914 ACAGAGCAGTCCTCAGGAGAAGG + Intergenic
1160632046 18:80253612-80253634 ACAGAGGAGCAGTCCTTGGACGG - Intergenic
1161017680 19:1991345-1991367 ACAGAGGCTTAGTTAGTGGAAGG + Intronic
1161608033 19:5225525-5225547 ACAAAGGAGGAGGCAGGGGCGGG + Intronic
1162796585 19:13090425-13090447 CCAGGGGAGTAGTCAGGGTTGGG + Intronic
1163664487 19:18596860-18596882 ACAGGGGCGGAGTCAGGGAAGGG + Intronic
1163672288 19:18636435-18636457 AGAGAGGAGGAATCTGGGGATGG - Intergenic
1164934634 19:32201421-32201443 AGAGCGGAGTAGCCAGGGGCTGG + Intergenic
1165117438 19:33537384-33537406 CCAGAGGGGCAGTCAGGAGAAGG - Intergenic
1165327506 19:35122886-35122908 AGAGCTGAGTGGTCAGGGGAGGG - Intronic
1166259198 19:41626269-41626291 CTAGAGGAGGTGTCAGGGGAGGG - Intronic
1166281500 19:41797299-41797321 CTAGAGGAGGTGTCAGGGGAGGG + Intronic
1166411906 19:42561101-42561123 CTAGAGGAGGTGTCAGGGGAAGG - Intronic
1166427863 19:42696033-42696055 ACAGTTGAGAAGTCAGGGAAGGG - Intronic
1167044424 19:47041315-47041337 AGAGAGGAGTCGCCAGGGGGAGG + Intronic
925420856 2:3710349-3710371 AGAGAGGAGGAATGAGGGGAGGG - Intronic
926113032 2:10194790-10194812 ACAGATGAGGACGCAGGGGAGGG - Intronic
926913448 2:17872238-17872260 AGAGAGGAGTAGGCAAGAGAGGG - Intergenic
927433763 2:23049381-23049403 ACCGAGGAGCGGCCAGGGGAAGG - Intergenic
927450539 2:23205900-23205922 TCAGAGGAGTGTGCAGGGGAGGG - Intergenic
927805322 2:26141708-26141730 CCAGAGGAGTTGTAGGGGGAGGG - Intergenic
927969952 2:27299220-27299242 AGAGAGGAGTGGGCAGGGGGAGG - Intronic
928413524 2:31072426-31072448 AGAGAGGAGAGGTCAGGCGAAGG - Intronic
929087778 2:38185371-38185393 ACGGAGGAATACTCAGGAGAAGG - Intergenic
929624546 2:43393141-43393163 AGAGATGAGTAGAGAGGGGAGGG + Intronic
931058114 2:58495438-58495460 ATAAAGGAGAAGTCAGGGGTAGG + Intergenic
932072283 2:68633339-68633361 ACGGGGGACTACTCAGGGGAAGG - Intergenic
932400264 2:71475612-71475634 ACAGAGGGGAGGGCAGGGGAAGG + Intronic
932468740 2:71940198-71940220 AGAGAGGAGGAGGCAGGGGCTGG - Intergenic
934539462 2:95161952-95161974 ACAGAGCAGTGGTCACGGGTTGG - Intronic
938090251 2:128426529-128426551 AAAGGAGAGTGGTCAGGGGATGG - Intergenic
938374442 2:130796528-130796550 ACAGAGGAGAAGGCTGTGGAAGG - Intergenic
939617785 2:144379964-144379986 ACAGCGGCGGAGCCAGGGGAGGG - Intergenic
940163643 2:150742938-150742960 GCAGAGGGGTGGTCAGGTGAGGG - Intergenic
940372465 2:152918359-152918381 TCAATGGAGTTGTCAGGGGAAGG + Intergenic
941274456 2:163473084-163473106 AGTGAGGAGTGGTAAGGGGATGG + Intergenic
941428111 2:165375525-165375547 ATATAGAAGTAGTCAGGGAAGGG + Intronic
942115505 2:172725623-172725645 TCAGAGGAGAAGTCAGAGGAGGG - Intergenic
942371149 2:175286740-175286762 ACAGAGGACTCTTCAGGTGAAGG - Intergenic
945346635 2:208725561-208725583 AAGGAAAAGTAGTCAGGGGAAGG + Intronic
945821559 2:214671893-214671915 AGAGAGGAGTGGTGAGGGGAGGG - Intergenic
946307003 2:218861718-218861740 ACAGAGGGGGAGGGAGGGGAAGG - Intronic
946620805 2:221560531-221560553 ATCAAGGAGTGGTCAGGGGATGG + Intronic
948066454 2:235084413-235084435 GCAGAGGGGAAGTCAGAGGAAGG - Intergenic
948332159 2:237178219-237178241 GCAGAGGAGGAGTGAGGCGAGGG - Intergenic
948783396 2:240338606-240338628 AGAGCAGAGCAGTCAGGGGATGG + Intergenic
948944338 2:241211832-241211854 ACGGGTGAGTGGTCAGGGGATGG - Intronic
1172304664 20:33872343-33872365 ACAGAGGAGGAGTTGGGGGTGGG + Intergenic
1173791146 20:45828542-45828564 AGTAAGGAGTAGGCAGGGGAAGG + Intronic
1174112456 20:48205862-48205884 ACAGAGGAGGAGACAAGGGAAGG - Intergenic
1174168780 20:48603657-48603679 GCAGAGGAGGAGACAAGGGAAGG + Intergenic
1174435270 20:50502060-50502082 GCAAAGGAGGAGTCTGGGGAGGG - Intergenic
1174748385 20:53086961-53086983 GTAGAGGAAGAGTCAGGGGATGG + Intronic
1175186738 20:57183943-57183965 ACAGAAGAGTAGTTACAGGAGGG + Intronic
1175497192 20:59423266-59423288 ACAGAGAAGTCTTCAGGAGAAGG + Intergenic
1175627183 20:60499334-60499356 ACAGAGCAATGGTGAGGGGAGGG + Intergenic
1176258244 20:64165011-64165033 ACAGAGGAGACATTAGGGGAAGG + Intronic
1177776106 21:25568093-25568115 ACAGAGGAGGCGTCATGGAAGGG + Intergenic
1177836313 21:26189644-26189666 TCAGAGGAGTGGTCAGGGTAAGG + Intergenic
1178606598 21:34042205-34042227 ACAGAGGAATAGTCGGGTGCAGG - Intergenic
1178981684 21:37269812-37269834 AGAGAGGAGTAGCCACGGGGTGG - Intergenic
1179799253 21:43803243-43803265 ACAGAGGAGTAGGCAGGACTGGG - Intronic
1182668272 22:31974501-31974523 AAAGAGGAGGAGCCATGGGATGG + Intergenic
1183860548 22:40666773-40666795 AAAGAGGATTAATCAGGAGAGGG - Intergenic
1184212363 22:43043564-43043586 ACAGAGGGTGAGTCTGGGGATGG - Intronic
1184842186 22:47058531-47058553 AGAGAAGAGTAGACAAGGGAGGG - Intronic
1185330489 22:50250028-50250050 ACGGAGGAGCAGCCAGGGGAAGG + Intronic
949113957 3:297034-297056 ACAGAGAATTAGTTAGAGGATGG + Intronic
949954051 3:9252734-9252756 ACAGAGGAGGAGTCACAGGAGGG - Intronic
950116178 3:10451439-10451461 ACTGGGAAGTAGTCAGGGGTAGG - Intronic
950530274 3:13549052-13549074 GCGGAGGCGGAGTCAGGGGAGGG + Intergenic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951667157 3:25139767-25139789 AAAGAGGAGAAGTCAGTGCATGG + Intergenic
952305859 3:32145502-32145524 ACTGAGGAATGGGCAGGGGAAGG - Intronic
952983523 3:38757375-38757397 ACAGGGGAGTGGCCTGGGGAAGG + Intronic
953233219 3:41083084-41083106 GCAAAGGAGAAGTCAGGGAAAGG + Intergenic
953985583 3:47440014-47440036 ACAGAGCAGTACTGGGGGGATGG - Intronic
953989232 3:47471193-47471215 ACAGAAGAGGAGGCAGGGAAAGG + Intronic
955748887 3:62167944-62167966 ACAGAGGACCAGAGAGGGGAGGG - Intronic
956620612 3:71217990-71218012 GCAGAGGTGGAGCCAGGGGAGGG - Intronic
957303189 3:78420371-78420393 ACCGGGGAGTAGGCAGGGCATGG - Intergenic
957808032 3:85176690-85176712 ACAGAGCATTAGTCAGGGACAGG - Intronic
959640250 3:108623970-108623992 ACATAGCTGTAGTCAGGGGATGG + Intronic
961183456 3:124894768-124894790 ATAAAGGAGTAGGCAGGAGATGG + Intronic
961352793 3:126314705-126314727 ACAGAGGCGAAGTCCAGGGAGGG + Intergenic
961914745 3:130361980-130362002 ACAGATTGGTAGGCAGGGGAAGG - Intronic
962485563 3:135839249-135839271 ACACAGGTATAGTGAGGGGAGGG - Intergenic
964495163 3:157280998-157281020 ACAGAAGTGTAGGCAGAGGATGG + Intronic
965629268 3:170714308-170714330 ACAGAGAAGCAGTCAGCGGATGG - Intronic
966133682 3:176673902-176673924 ACAGGGGAAGAGTCGGGGGAGGG - Intergenic
966386514 3:179404773-179404795 GCAGAGGAGGACTCAGGGTATGG + Intronic
968286676 3:197513049-197513071 ACAGAGCAGCAGGCAGGGGCAGG + Intronic
970590848 4:17559609-17559631 ATGGTGGAGTAGACAGGGGAGGG - Intergenic
971899943 4:32646479-32646501 ACAGGTGAGTAGTCAGTGTATGG + Intergenic
974074305 4:57154863-57154885 AGAGAGGAGGAGGCAAGGGAAGG - Intergenic
976187549 4:82457662-82457684 TTAGAGGAGTTGTCATGGGAAGG + Intronic
981176174 4:141686480-141686502 ACAGAGGAGTAGGCAGTGTCAGG - Intronic
981226002 4:142294938-142294960 AAAGAGGAGTGGTGTGGGGAAGG + Intronic
981573603 4:146179150-146179172 CCTGAGTAGGAGTCAGGGGAGGG + Intronic
984304474 4:177969981-177970003 AGGGAGTAGTACTCAGGGGAAGG - Intronic
984477416 4:180254904-180254926 AGAGATGAGGAGTCAGGGGCGGG - Intergenic
984760743 4:183360649-183360671 ACAGAGGAGTGGCCGTGGGAGGG + Intergenic
985520905 5:373619-373641 ACAGAGGAGGAGACTGGGGCTGG + Intronic
985610939 5:888175-888197 GCAGTGGAGTCTTCAGGGGAGGG - Intronic
985835892 5:2271683-2271705 GCAGGGGAGTGGTGAGGGGAGGG + Intergenic
985835918 5:2271752-2271774 GGAGGGGAGTGGTCAGGGGAGGG + Intergenic
986613878 5:9597110-9597132 ACAGAGGAGGAGGAAGGGGAAGG - Intergenic
988986225 5:36621448-36621470 TGAGAGGAGGAGTCAGTGGAGGG + Intronic
989122895 5:38021760-38021782 ATAGAGGAGAAGGAAGGGGAAGG - Intergenic
989142211 5:38212713-38212735 ACAGAGGAGAGGTGAGGAGATGG + Intergenic
989179687 5:38564198-38564220 GCAGAAGAGTAGTGTGGGGAAGG - Intronic
991339588 5:65593615-65593637 GCAGAGGAGATGTCATGGGAGGG - Intronic
992487863 5:77212375-77212397 ACAGTGGAGGAGTGAGGAGAAGG + Intronic
992900729 5:81292450-81292472 AGAGAGGAGCAGTTAGGGGCTGG - Intergenic
994278950 5:97876741-97876763 ACAGAGAAGGAGTCAGGTGCTGG + Intergenic
997001104 5:129763147-129763169 ACAGAGGACTGGGTAGGGGAGGG - Intronic
997953193 5:138258147-138258169 AAAGAGGAGTAGGGTGGGGAAGG - Intronic
999799217 5:155017737-155017759 AGAGAGCAGTAGTCTGGGGATGG - Exonic
1000387944 5:160693454-160693476 ACAGTGGTATAGTCAGGGAAGGG + Intronic
1000990682 5:167908469-167908491 AGAGAGGAGAAGAGAGGGGAGGG - Intronic
1000990699 5:167908516-167908538 AGAGAGGAGAAGAGAGGGGAGGG - Intronic
1001204912 5:169753364-169753386 ACAGGGGAGCTGTCAGGGGGTGG - Intronic
1001288908 5:170442776-170442798 ACAGAGGAGAACTCAGGACAGGG + Intronic
1002018059 5:176341575-176341597 ACAGTGGAGAAGGCAGTGGATGG + Intronic
1002352691 5:178594233-178594255 ACAGAGGAGAGGACAGGAGAGGG + Intergenic
1002381075 5:178830782-178830804 ACGGAGGCGTAGCCAGGGCAAGG - Intergenic
1004092462 6:12517985-12518007 CCAGAGGGGTAGTGAGGGGCTGG + Intergenic
1005221749 6:23595526-23595548 AAAGAGGAGTGGTCTGAGGAAGG - Intergenic
1006380460 6:33694400-33694422 ACAGAGGAGTCGGGGGGGGAGGG - Intronic
1006635803 6:35460410-35460432 ACAAAGGGGTAGTCAGGGGTGGG - Intronic
1007602226 6:43089712-43089734 CCGGAGGAGTACTGAGGGGAGGG + Intronic
1008099528 6:47376517-47376539 AGAGAGGAGTAGAAAGGGCATGG - Intergenic
1008912208 6:56746946-56746968 AAAGGGGAGAAGACAGGGGAGGG + Intronic
1010809818 6:80288625-80288647 ACAGAAGATCACTCAGGGGAGGG - Intronic
1013478368 6:110530444-110530466 ACGGAGGAGTACTTTGGGGAGGG + Intergenic
1014648685 6:124008083-124008105 ACCGAGGAGGAGTCAGGCCAGGG + Intronic
1014997520 6:128168712-128168734 ACTGAGGAGGTGGCAGGGGATGG - Intronic
1016390606 6:143570831-143570853 GAAGAGGAGGAGTCCGGGGAGGG - Intronic
1017125560 6:151060960-151060982 CCTGAGGTGTAGGCAGGGGATGG + Intronic
1018626354 6:165782587-165782609 CCAGAGGAAATGTCAGGGGAGGG - Intronic
1019288853 7:237286-237308 TCAGAGGAGTAGGCAGGGGAAGG + Intronic
1022214734 7:28247470-28247492 ACAGAGGTTTAGTAATGGGATGG - Intergenic
1022566975 7:31413499-31413521 CCTGAGGATTAGTCAAGGGAAGG - Intergenic
1023576682 7:41635529-41635551 ACAGAGTAGTAATCAGGTCAGGG - Intergenic
1023623454 7:42094957-42094979 GCAGAGGACTAGGTAGGGGAAGG + Intronic
1024178085 7:46861494-46861516 ACAGAGGAGGAGCCAGAGGTTGG - Intergenic
1025001242 7:55316679-55316701 TCAGAGGAGGGGTCAGGGGCTGG - Intergenic
1026234714 7:68516889-68516911 ACAAAGGAGAAGCAAGGGGAAGG + Intergenic
1028655969 7:93207450-93207472 AAAGAGGAGTAGGGAGGGAAAGG + Intronic
1030224470 7:107133840-107133862 ACAAAAGAGTAGTCAGTGAAAGG + Intronic
1030587653 7:111440735-111440757 ACAGAGGAGAGGTCAGTGCATGG - Intronic
1031307189 7:120144134-120144156 AAAAAGGAGAAGTCAGGGGCAGG - Intergenic
1031978185 7:128106918-128106940 ACAGAGGAGGAGTTTGGGGTGGG + Intergenic
1032558557 7:132863597-132863619 AGAGAGGAGAAGTCAGGGCCTGG - Intronic
1033080266 7:138290014-138290036 ACACAGGACAAGTGAGGGGAAGG - Intergenic
1034122163 7:148637847-148637869 ATACAGGAGTAGTCAGAGAAGGG - Intergenic
1035436172 7:158861508-158861530 ACAGATGAGAAGTGTGGGGAGGG - Intronic
1035783949 8:2248246-2248268 CAGGAGGAGGAGTCAGGGGAAGG + Intergenic
1035923883 8:3707030-3707052 CCAGAGGGGTAGTCAGAGTATGG + Intronic
1036726422 8:11224787-11224809 CCAGAGCAGTAGGCTGGGGATGG - Intergenic
1037738521 8:21586051-21586073 TCAGGGGAGAGGTCAGGGGAAGG + Intergenic
1038034217 8:23673575-23673597 ATAGATGAGTTGTCAGGGAAGGG + Intergenic
1038734226 8:30154925-30154947 AGAGAGAAGTAGGCAGGGGCTGG + Intronic
1038898324 8:31812667-31812689 AGAGAGGAGCAGCGAGGGGAGGG - Intronic
1038972032 8:32647022-32647044 AAAGAGGAGTAGTCGGGGGTGGG + Intronic
1039560390 8:38507939-38507961 AGAGAGGAGAAGAGAGGGGAAGG - Intergenic
1039601297 8:38840416-38840438 ACAGATGAGATGTCTGGGGAGGG + Intronic
1039794821 8:40903877-40903899 AGACAGGAGTAGTGAGGGAAGGG - Intergenic
1039923661 8:41910266-41910288 GAAGGGGAGAAGTCAGGGGAGGG + Intergenic
1040830176 8:51667212-51667234 ACAGAATAGTAGCCAAGGGAGGG - Intronic
1041375282 8:57205569-57205591 ACTGAGCACTTGTCAGGGGAAGG + Intergenic
1042003939 8:64159567-64159589 ACAGATGAATAGGCAGTGGAGGG + Intergenic
1042857728 8:73285172-73285194 ACACAGGGGTAGGCAAGGGAAGG + Intergenic
1043660420 8:82734405-82734427 ATAGAGGATTTGTCAGAGGAAGG + Intergenic
1044248932 8:89984258-89984280 AGGGAGGGGGAGTCAGGGGAGGG + Intronic
1044329928 8:90906434-90906456 ACAGAGGATGAGTCAAGGTAGGG - Intronic
1045167009 8:99617879-99617901 AAAGAGGAGTGGACAGGGAATGG - Intronic
1045866481 8:106871579-106871601 TCAGAGGAGTAGGCAGTGGCCGG - Intergenic
1047294438 8:123558827-123558849 ACAGTGGAATAGGCAGGGCAAGG + Intergenic
1047430742 8:124789580-124789602 ACAGAGGTGTGGTCAGGGTTAGG + Intergenic
1048045439 8:130768318-130768340 ACAGAGGAATAGGCAGGGTGAGG + Intergenic
1048182451 8:132208602-132208624 AAAGAGGGGTAGTAAGGGAAAGG + Intronic
1050941820 9:11470514-11470536 GCAGAGGAGGGGTTAGGGGAGGG + Intergenic
1052762062 9:32602757-32602779 GCAGAGGAGTAGGCAGGGCCGGG - Intergenic
1052978313 9:34428545-34428567 ACAGTGCAGGACTCAGGGGAGGG - Intronic
1053611219 9:39714923-39714945 ACAGAAGAGAAGGGAGGGGAAGG - Intergenic
1053869258 9:42472971-42472993 ACAGAAGAGAAGGGAGGGGAAGG - Intergenic
1054087035 9:60756235-60756257 ACAGAAGAGAAGGGAGGGGAAGG + Intergenic
1054242301 9:62627467-62627489 ACAGAAGAGAAGGGAGGGGAAGG + Intergenic
1054556427 9:66661985-66662007 ACAGAAGAGAAGGGAGGGGAAGG + Intergenic
1056202035 9:84286141-84286163 ACCAAGGAGTTGTCAGGGGATGG + Intronic
1056800901 9:89690840-89690862 ACAGAGGGGAAGGGAGGGGAGGG - Intergenic
1058644301 9:107116337-107116359 ACAGATGAGTGGTGAAGGGAAGG + Intergenic
1059067692 9:111102759-111102781 ACAGGGGAGCAGACTGGGGAGGG + Intergenic
1059336771 9:113573901-113573923 ACAGAGGAGTAGAAAGAGCAGGG + Intronic
1059360412 9:113737752-113737774 ACAGGGCAGTAGTCAGGGCTCGG + Intergenic
1059405356 9:114095720-114095742 ACTGAGGCCTAGTAAGGGGAAGG - Intronic
1059409726 9:114124365-114124387 AGAGAGGAGGAGGCAGAGGAGGG + Intergenic
1060225616 9:121788602-121788624 GCAGAGGAGGAGTCGGGGGGTGG + Intergenic
1061690333 9:132322398-132322420 GATGAGTAGTAGTCAGGGGAAGG - Intronic
1186528300 X:10269790-10269812 ACAGAGACGTGGTCAGGAGATGG - Intergenic
1187397380 X:18930482-18930504 AGAGAGGAGAAAGCAGGGGAGGG + Intronic
1188355705 X:29188152-29188174 ACAGAGGAGTAGTCTGTGGAAGG - Intronic
1188628328 X:32315680-32315702 ACAGATGAGAAGCCAGGGTATGG - Intronic
1189320085 X:40082574-40082596 GCAGAGGACTCTTCAGGGGAGGG + Intronic
1189690925 X:43616207-43616229 AGAGAGCAGGAGTCGGGGGAAGG + Intergenic
1189877761 X:45454485-45454507 GCGGAGGAGAAGGCAGGGGAGGG + Intergenic
1193212935 X:78828971-78828993 AAAGAGAGGTAGTCAAGGGAAGG - Intergenic
1193832287 X:86304242-86304264 ACAGAGGAGTAGTCAGGGGAAGG - Intronic
1194671141 X:96734008-96734030 AAAGAAGAGTACTGAGGGGAAGG + Intronic
1195116743 X:101706961-101706983 ATAGAGTAGTAGCCAGGGGCGGG + Intergenic
1195718945 X:107847364-107847386 ACAGTGGAGGGGTCAGGGAAAGG + Intronic
1196056637 X:111363211-111363233 ACAGAAGAGGTGTCAGGGAAAGG - Intronic
1197317900 X:124991306-124991328 AAAGAGGAGTAGCCAGTAGAGGG + Intergenic
1198441835 X:136670931-136670953 ACAGAGGACTAGTAAGTGGCAGG - Intronic
1200399511 X:156010846-156010868 CCAGAGGAGGAGTGAGGGGTGGG + Intergenic
1200585284 Y:5000222-5000244 ACAGAGGGGGAGAAAGGGGAAGG - Intronic