ID: 1193833359

View in Genome Browser
Species Human (GRCh38)
Location X:86314009-86314031
Sequence TTTTACATGGGCATGGTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 738
Summary {0: 1, 1: 5, 2: 56, 3: 148, 4: 528}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193833359_1193833364 11 Left 1193833359 X:86314009-86314031 CCACAAACCATGCCCATGTAAAA 0: 1
1: 5
2: 56
3: 148
4: 528
Right 1193833364 X:86314043-86314065 ATAAACGTGTGTGTTCTCACTGG 0: 1
1: 0
2: 2
3: 12
4: 100
1193833359_1193833365 23 Left 1193833359 X:86314009-86314031 CCACAAACCATGCCCATGTAAAA 0: 1
1: 5
2: 56
3: 148
4: 528
Right 1193833365 X:86314055-86314077 GTTCTCACTGGTCTACTGCTTGG 0: 1
1: 0
2: 0
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193833359 Original CRISPR TTTTACATGGGCATGGTTTG TGG (reversed) Intronic
900410289 1:2509629-2509651 TTACACATGGGCTGGGTTTGGGG - Intronic
901213161 1:7537787-7537809 TTTGAAAAGTGCATGGTTTGGGG - Intronic
901261117 1:7871783-7871805 TCTTATATGGGCACTGTTTGTGG - Intergenic
902165441 1:14567511-14567533 TTTTACAAGTTCAAGGTTTGTGG - Intergenic
903062805 1:20681903-20681925 CGTTTCATGGGCATGCTTTGTGG + Intronic
903529834 1:24021738-24021760 ATTTACCTGGGCATGTTTGGTGG + Intergenic
903636112 1:24817969-24817991 TCTTATATGGGTGTGGTTTGTGG + Intronic
903881121 1:26510190-26510212 TCTTATATGGGCACAGTTTGTGG - Intergenic
904680947 1:32228800-32228822 TCTTACATGGTCATAGTTGGGGG - Exonic
905086213 1:35379884-35379906 TCTTACATTGACGTGGTTTGTGG + Intronic
905260986 1:36719058-36719080 TTTTTTATGGGTATGGTTTCTGG + Intergenic
906208628 1:44000151-44000173 GGTTACATGGGAATGGTGTGTGG + Intronic
907079446 1:51607940-51607962 TTATACATTGGCATGGTTCCAGG + Intronic
907241334 1:53082751-53082773 TTCTGCCTGTGCATGGTTTGTGG - Intronic
907633162 1:56105563-56105585 TCTTATATGGGTATGGTTTGTGG + Intergenic
907685065 1:56602598-56602620 TTTTATACGGGAATGGTTTGTGG - Intronic
908221512 1:62011502-62011524 TTTTATATGGGCACAGTTTATGG + Intronic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909108470 1:71443206-71443228 TAATACATGGGCATATTTTGGGG + Intronic
909468778 1:76003239-76003261 CTTTACATGTGCCTTGTTTGGGG + Intergenic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909844041 1:80367981-80368003 TCTTATGTGGGCATGGCTTGTGG - Intergenic
910078458 1:83309255-83309277 TCTTATGTGAGCATGGTTTGTGG + Intergenic
910365419 1:86460035-86460057 TTATACATTGGCATGGTTCCGGG + Intergenic
910437920 1:87224549-87224571 TTTTGCATGGGCTTGCTGTGAGG + Intergenic
910803782 1:91170654-91170676 ATGGACATGGGCATGGGTTGGGG - Intergenic
911173509 1:94795466-94795488 TCTTAAATTGGCATGGTTTTAGG + Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911706300 1:101016979-101017001 TTTTATATGCGCTTGGTTTGTGG + Intronic
911746330 1:101445543-101445565 TTATACATTGGCATGGTTCTGGG - Intergenic
911968538 1:104399291-104399313 TGTTACATGGGCATACTTTGTGG + Intergenic
912018749 1:105076041-105076063 TTTTACATGTGGTTTGTTTGAGG + Intergenic
912902520 1:113667940-113667962 TTTTATATGGGTGTGATTTGTGG + Intronic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
915305614 1:154975748-154975770 TCTTCCCTGGGCTTGGTTTGGGG + Intronic
916074420 1:161192116-161192138 TTTGACAAGTGCATGGTGTGCGG - Exonic
916553147 1:165869127-165869149 TTTTATATGGGCGTGGTTGGTGG + Intronic
917192301 1:172430951-172430973 TCTTATATGGGTATAGTTTGTGG - Intronic
917216058 1:172679256-172679278 TTATACATTGGCTTGGTTTTGGG + Intergenic
917353277 1:174100698-174100720 TCTTACATAGTCATGGTTTGTGG + Intergenic
917576897 1:176332541-176332563 TTTTACCAGGGTAGGGTTTGGGG - Intergenic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919113295 1:193247301-193247323 TCTTATATGGGTGTGGTTTGTGG - Intronic
919123419 1:193368827-193368849 TCTTATACTGGCATGGTTTGTGG + Intergenic
919204081 1:194397640-194397662 TGTTATCTGGACATGGTTTGTGG + Intergenic
919415207 1:197300018-197300040 TGCCATATGGGCATGGTTTGTGG - Intronic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
921276209 1:213523240-213523262 TCTTACATGGGCACAGTTTGTGG + Intergenic
921282000 1:213576566-213576588 TTTAATATGGGTTTGGTTTGTGG - Intergenic
921576448 1:216840825-216840847 TCTTATATGGGTATGGTTTGTGG + Intronic
922169927 1:223145399-223145421 TTTTACATGGACATGTTTATTGG + Intergenic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922747316 1:228051656-228051678 TTTTATAAGGGCATTGTTTTAGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
923045073 1:230349850-230349872 TTGTGCATAGGCATTGTTTGGGG - Intronic
923131439 1:231078238-231078260 TTTTAGATGGGAAAAGTTTGAGG - Intergenic
923481317 1:234386970-234386992 TCTTACATGGGTACAGTTTGTGG + Intergenic
923976351 1:239268455-239268477 TTTTAAAATGGCATGGTATGTGG - Intergenic
924006810 1:239621175-239621197 TTTTATATGGGAGTGGTTTATGG - Intronic
924079183 1:240375143-240375165 TCTTATGTGGGCATAGTTTGTGG + Intronic
924196676 1:241614925-241614947 TTTTCCTTGGTTATGGTTTGTGG - Intronic
924689442 1:246331898-246331920 TCTTATATGGGGATGGTTTGTGG - Intronic
1062777233 10:162235-162257 TCTTACATAGGTGTGGTTTGTGG + Intronic
1063049472 10:2431064-2431086 TTTTTCTTGGTCATGATTTGGGG - Intergenic
1063598399 10:7458267-7458289 TTTAACATGGTCATGGTTCACGG + Intergenic
1063675684 10:8139265-8139287 TTTCACCTGGGCAAGGTTTGGGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1063813581 10:9743974-9743996 ATTTACATGAGCATGGACTGAGG + Intergenic
1064404978 10:15053586-15053608 TTATACATTGGCATGCTTCGGGG - Intronic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065312570 10:24430448-24430470 TTTTCCATGGACAGGGTTAGGGG + Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1065424152 10:25581807-25581829 ATTTGCATGGGTATTGTTTGGGG - Intronic
1066134965 10:32436374-32436396 TTTTACAAGTGGAGGGTTTGTGG - Intergenic
1066237935 10:33505133-33505155 TCTTAGATGGGCACAGTTTGTGG + Intergenic
1066522616 10:36239280-36239302 TTTTACCTATGCATGGCTTGTGG - Intergenic
1066980625 10:42411036-42411058 TTTAAAATAGGCATGTTTTGTGG - Intergenic
1068243940 10:54340726-54340748 TTCTACATTGGCATGGTTTGGGG + Intronic
1068437089 10:57006306-57006328 TTTTAAATGGGTATGTTGTGTGG + Intergenic
1068952979 10:62795921-62795943 TCATACATTGGCATGGTTCGGGG + Intergenic
1069458119 10:68570014-68570036 TGTTACATGGGCATATTGTGTGG + Intronic
1071400847 10:85269056-85269078 TCTTACATGGGTACAGTTTGTGG + Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1073155326 10:101341888-101341910 TTTAGCATGGGACTGGTTTGGGG - Intergenic
1073501897 10:103947210-103947232 TTTTAAATGACCATGTTTTGGGG + Intergenic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074321181 10:112404188-112404210 TTTCACTTGGTCATGTTTTGTGG + Intronic
1074699027 10:116076840-116076862 TTTGCCATGGGTATGTTTTGAGG - Intronic
1076089243 10:127666612-127666634 TTATACATGTACATGGTTGGTGG - Intergenic
1076856891 10:133121085-133121107 TCTTATACGGGCGTGGTTTGTGG + Intronic
1078193672 11:9115968-9115990 GCTTACATAGGCATGGTTTGTGG + Intronic
1078243260 11:9549978-9550000 TCTTGTATGGGCACGGTTTGTGG - Intergenic
1078516865 11:12029958-12029980 CTTTACATGGCCATGGGCTGGGG + Intergenic
1078784359 11:14473615-14473637 TTTTATATGGGAATGGTTCCTGG + Intronic
1079228414 11:18628211-18628233 TTTTATATAGGCAAGGTCTGGGG - Intronic
1079272452 11:19001004-19001026 TCTTTTATGGGCATAGTTTGTGG - Intergenic
1079343387 11:19631450-19631472 TCTTACATGGGCATTTTATGAGG - Intronic
1080100448 11:28453708-28453730 TTATTCATGGGAATGGTTTTTGG + Intergenic
1080359133 11:31492819-31492841 TCTTACATGGGCACGGTTTCTGG + Intronic
1080842342 11:35996368-35996390 TCTTATATGGGTGTGGTTTGAGG + Intronic
1081261551 11:40967660-40967682 TCTTATATGGGCATGATTTGTGG - Intronic
1081266171 11:41024998-41025020 TCTTATAAGGGCTTGGTTTGTGG - Intronic
1081320652 11:41688214-41688236 CTTTTCTTGGGCATTGTTTGAGG + Intergenic
1081434339 11:43010681-43010703 TTATACATTGGCATGGTTCTGGG + Intergenic
1082554384 11:54543306-54543328 TTGCACATTGGCATGCTTTGAGG + Intergenic
1082761852 11:57134872-57134894 TTGTATACGGGCATGGTTTGTGG + Intergenic
1082861865 11:57864379-57864401 TATTACATTGGCATGGTTCTGGG - Intergenic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1085436516 11:76509019-76509041 TCTTACACGAGCATGGTTTGTGG + Intronic
1085500508 11:77018286-77018308 TCTTCTATGTGCATGGTTTGTGG - Intronic
1085606244 11:77901975-77901997 TGTTCCATGGGCCTGGTCTGAGG + Intronic
1085683050 11:78596025-78596047 TTATACGTTGGCATGGTTTGGGG - Intergenic
1086646991 11:89234740-89234762 TTTAACATTGGCACTGTTTGTGG + Intronic
1087064497 11:94014830-94014852 TTGTATATGAGCATGGCTTGTGG - Intergenic
1087421933 11:97940046-97940068 TCTTTTATGGGCATGATTTGTGG - Intergenic
1087574235 11:99970653-99970675 TTTTACTTGTGCATGTGTTGCGG + Intronic
1087609444 11:100416119-100416141 TCTTACACGGGCTTTGTTTGTGG + Intergenic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1087966118 11:104418105-104418127 TTTCGCATGGGCATGATTTGTGG + Intergenic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1089801433 11:121032239-121032261 ATTTACATGGGCATGTTTCTGGG + Intronic
1090147777 11:124345016-124345038 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1091136159 11:133191891-133191913 TTTTAAATGGGCAAGGCTTTTGG + Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091865186 12:3828019-3828041 TGTTATATGGGCATGTTTTGGGG - Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1092824012 12:12380116-12380138 TTTTCTATGGGTGTGGTTTGTGG + Intronic
1093007617 12:14067657-14067679 TTATACATTGGCATGGTTCTGGG - Intergenic
1093106417 12:15093010-15093032 TTTTACTTGCTCATGTTTTGTGG + Intergenic
1094250416 12:28353683-28353705 TCTGATATGGGCATGGTTTGTGG + Intronic
1095523075 12:43091578-43091600 TCTTATATGAGCATAGTTTGTGG - Intergenic
1096061563 12:48704956-48704978 TTTTACATGGACAGGGGGTGGGG - Intronic
1096886082 12:54720714-54720736 TTATACATTGGCATGGTTCTGGG + Intergenic
1098427399 12:70380289-70380311 CCTCATATGGGCATGGTTTGTGG + Intronic
1098800728 12:74953985-74954007 TCTTATATGGGCATGTTTTCTGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100100933 12:91104771-91104793 TTTATCATGGTCATGGTATGTGG - Intronic
1100451991 12:94716002-94716024 TGTTAAATGGACATGTTTTGCGG - Intergenic
1100516446 12:95332860-95332882 TTTTATATGGGCTTGGTTTGTGG + Intergenic
1101606394 12:106249828-106249850 CTGTACATGGGCAGGCTTTGGGG + Intronic
1101872347 12:108576467-108576489 TCTTACATGGGCACAGTTCGTGG + Intergenic
1101934972 12:109049937-109049959 TTTTACAAGTTCAAGGTTTGTGG - Intronic
1102849571 12:116227604-116227626 TTTTATATGGGTGTGGTTTGTGG - Intronic
1103048118 12:117755493-117755515 TGTCATATGGGCACGGTTTGTGG - Intronic
1103303210 12:119943805-119943827 TTCCCCATAGGCATGGTTTGGGG - Intergenic
1103316905 12:120063589-120063611 TTTTACTTGTGCAAGTTTTGGGG - Intronic
1104096522 12:125563063-125563085 TCTCACATAGGCATCGTTTGTGG + Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1105356109 13:19661396-19661418 TTTTACAAAGGGAAGGTTTGTGG - Intronic
1105393001 13:19999452-19999474 TCTCATATGGGTATGGTTTGTGG - Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107068731 13:36245992-36246014 TTTTATATGGGCTTGGTTTATGG - Intronic
1107233239 13:38136907-38136929 TGTTACATGGGTATGTTGTGTGG + Intergenic
1107806385 13:44157608-44157630 TTTTACATGGTCATGGTGAGGGG - Intronic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109254706 13:60065019-60065041 TCTAACATGGGTGTGGTTTGTGG + Intronic
1109735411 13:66478185-66478207 TCTAATATGGGCATGGCTTGTGG - Intronic
1109771241 13:66976388-66976410 TTTCATATGGGTATGGTTTGAGG + Intronic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1109853886 13:68103396-68103418 TCTTATATGGGTATGGATTGTGG + Intergenic
1109893451 13:68650827-68650849 ATTTATATGAGCATGATTTGTGG - Intergenic
1109953251 13:69530410-69530432 TTTTATATGGTCATGGTTTGTGG - Intergenic
1110022023 13:70486875-70486897 TCTTACATTGCCATGGTTTGTGG + Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110101328 13:71608869-71608891 GAATACATGGGCATAGTTTGAGG + Intronic
1110521576 13:76485337-76485359 TTTTATATGAGCATAGTCTGTGG - Intergenic
1110766480 13:79285069-79285091 CCTTACATGGGTGTGGTTTGTGG - Intergenic
1111065257 13:83082696-83082718 TACTACATGGGTGTGGTTTGTGG + Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111571735 13:90096810-90096832 TTTTATATGGGCACAATTTGTGG + Intergenic
1111795001 13:92908112-92908134 TTTTACATAGACCTGATTTGGGG + Intergenic
1111839941 13:93437102-93437124 TTTTATATGGGCATGATTCATGG - Intronic
1111860825 13:93703490-93703512 TTTTACATAGTTAAGGTTTGTGG - Intronic
1111936641 13:94564462-94564484 TCTTACATGGGCATGATATGCGG + Intergenic
1112543864 13:100344963-100344985 CCTTACACGTGCATGGTTTGTGG - Intronic
1112556245 13:100471263-100471285 TCGTACATGGGCACAGTTTGTGG + Intronic
1112606818 13:100914470-100914492 TTTTACATGGATATGTTGTGTGG + Intergenic
1112728795 13:102335905-102335927 TCTTACATGGGCACAGTTTGGGG - Intronic
1113535878 13:111065976-111065998 TTATACATGGGCATGGTTCAGGG - Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113695023 13:112339153-112339175 TCTTATATGGGCACTGTTTGTGG - Intergenic
1114152465 14:20059163-20059185 TTCTACATGGGCACGGCTTGTGG + Intergenic
1115249695 14:31332256-31332278 TTTTGCGTGGGCATAGTTTGTGG - Intronic
1115293567 14:31800366-31800388 TATTATATGGGTGTGGTTTGTGG + Intronic
1115379156 14:32714168-32714190 TCTTATATGGGTGTGGTTTGTGG + Intronic
1115542073 14:34430321-34430343 TGTTAAATAGGGATGGTTTGTGG - Intronic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1116446790 14:45020782-45020804 TTTTACACGGGTGAGGTTTGAGG + Intronic
1117370324 14:55072670-55072692 TATTAGATGTGCATTGTTTGGGG - Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1118260603 14:64243259-64243281 GCTTATATGGGCATAGTTTGTGG + Intronic
1118459497 14:65975743-65975765 TTTCATAAGGGCATGATTTGAGG + Intronic
1118553169 14:66980016-66980038 TCTTACATGGGCACCATTTGTGG + Intronic
1119363472 14:74071317-74071339 TTTCCCATGGCCATGGTGTGTGG - Exonic
1119769387 14:77210921-77210943 TTTTCCTAGGGCATGGCTTGTGG + Intronic
1119944333 14:78675979-78676001 TTCTACATGGGCATGGGTGATGG - Intronic
1119951508 14:78750626-78750648 TTGTTCATTGGTATGGTTTGGGG - Intronic
1120264678 14:82233912-82233934 TTTTATATGGGCATGGTTTCTGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1121036358 14:90707240-90707262 TCTTAGGTGGGCATGGTTTGTGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1123022384 14:105406921-105406943 ATTTGCACGGTCATGGTTTGGGG + Intronic
1123144867 14:106119024-106119046 TTTTACTTGGTGATTGTTTGTGG - Intergenic
1123406712 15:20023883-20023905 TTATACATTGGCATGGTTCTGGG + Intergenic
1123516042 15:21030531-21030553 TTATACATTGGCATGGTTCTGGG + Intergenic
1124044882 15:26139509-26139531 TTAGAAATGGGCATGCTTTGTGG + Intergenic
1124461003 15:29891716-29891738 TCTTATATGGGCAGGGTTTGTGG - Intronic
1124580381 15:30948724-30948746 TTTTACATTCGAATGGTTTGTGG + Intronic
1124878141 15:33615539-33615561 TTATATATTGGCATTGTTTGAGG + Intronic
1125313606 15:38407609-38407631 TTTTACATGCGAATGGTTTGGGG - Intergenic
1125810477 15:42536090-42536112 TCTTATATTGGCATGGTTTGTGG + Intronic
1126885920 15:53149944-53149966 TCTTACATGAACATGATTTGTGG - Intergenic
1129126446 15:73445763-73445785 TCTTCTATGGGCATGGTTTGTGG + Intronic
1129948813 15:79567318-79567340 TCTTAGATGGGCATGGCTTGTGG - Intergenic
1130100849 15:80892813-80892835 TTCCTCATGGGCATGTTTTGTGG + Intronic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1130408158 15:83621493-83621515 TCTTATATAGGCATTGTTTGTGG + Intergenic
1131496015 15:92911734-92911756 TTTTTCTTGGGCAGGGGTTGGGG - Intronic
1131626022 15:94121858-94121880 TCTTCTATGGGCATGGCTTGTGG - Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1132020676 15:98359251-98359273 TTATACATTGGCATGGTTCTGGG - Intergenic
1132032414 15:98449623-98449645 ACTTACACGGGCATGGTTTGTGG + Intronic
1133093812 16:3427144-3427166 AGTTACCTGGGCATGGTTGGGGG - Intronic
1133472832 16:6092131-6092153 TGGTACATGGGCTTGGTGTGAGG + Intronic
1134272994 16:12750528-12750550 CCTTAAATGGACATGGTTTGTGG + Intronic
1135042208 16:19126370-19126392 TTTTTCATGGGCTGGGTGTGGGG - Intronic
1135257011 16:20948919-20948941 GTTTTGATGGGCATGGGTTGTGG - Intronic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1136501538 16:30672466-30672488 TCTTACATGGGCACTGTTTGTGG + Intergenic
1136694329 16:32063955-32063977 TTTTACTTGGTGATTGTTTGTGG + Intergenic
1136794828 16:33007218-33007240 TTTTACTTGGTGATTGTTTGTGG + Intergenic
1136875080 16:33847167-33847189 TTTTACTTGGTGATTGTTTGTGG - Intergenic
1137740374 16:50765350-50765372 TCTTATATGGGTGTGGTTTGTGG - Intronic
1138019616 16:53466331-53466353 TTTTCCATGGACAGGGTTGGGGG + Intronic
1139014005 16:62668027-62668049 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1139125900 16:64077031-64077053 TCTTATATGGGCACAGTTTGTGG - Intergenic
1139915712 16:70427282-70427304 TTATGCATGGGTTTGGTTTGGGG - Intronic
1140936728 16:79677841-79677863 TTTTACATTGGCATTCTTGGTGG + Intergenic
1141064902 16:80906445-80906467 TTTTACATGGGCTTCATTTGGGG - Intergenic
1141292323 16:82730490-82730512 TCTTGTATGGGCATGGTTTGTGG + Intronic
1141304465 16:82848598-82848620 TCTTATATGGGCACAGTTTGTGG - Intronic
1203097089 16_KI270728v1_random:1268869-1268891 TTTTACTTGGTGATTGTTTGTGG + Intergenic
1142922732 17:3205213-3205235 TCTTATATGGGCATGATTTGTGG - Intergenic
1143184949 17:5004449-5004471 TCTTACAGGGTCATGGTCTGAGG - Intronic
1144265661 17:13566296-13566318 TCTTCTATGGGCGTGGTTTGAGG - Intronic
1146265475 17:31449921-31449943 TTTTACATAGTGATGGTGTGTGG + Intronic
1146279686 17:31537100-31537122 GTTTTCATCTGCATGGTTTGGGG + Exonic
1147534649 17:41311732-41311754 TTTTAAAAGGACATGGTTTTTGG + Intergenic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1149177182 17:53886717-53886739 TTTTATATGGGCCTGGTTCATGG + Intergenic
1149290817 17:55216044-55216066 TTATACATTGGCATGGTTCTGGG - Intergenic
1149972050 17:61228656-61228678 TTTTACATGGGCATAGCTTGAGG - Intronic
1151027414 17:70694865-70694887 TCTTACATGGGTAGGGTTTGTGG - Intergenic
1151864204 17:76789264-76789286 TTATACATTGGCATGGTTCCGGG + Intergenic
1152970560 18:157709-157731 TTTTACACGGGGGTGGTTAGTGG + Intergenic
1152978963 18:254778-254800 TCTTAGATGGGCACAGTTTGTGG - Intronic
1153175426 18:2366907-2366929 TGTCATATGGGTATGGTTTGTGG - Intergenic
1153270650 18:3317957-3317979 TATTATATGGGTGTGGTTTGTGG + Intergenic
1153569886 18:6459622-6459644 TTTTATAAGGGCACGGTTTATGG - Intergenic
1154080981 18:11256692-11256714 TTTTACCTGACCATGCTTTGTGG - Intergenic
1154341642 18:13507681-13507703 TCTTATATGGGTATGGTTTGTGG - Intronic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155741197 18:29290327-29290349 TCTTATATGGGCAAGGTTTCTGG - Intergenic
1155809958 18:30219821-30219843 TCTTATATGGGCACAGTTTGTGG + Intergenic
1156110625 18:33722035-33722057 TCTTATGAGGGCATGGTTTGTGG - Intronic
1156500707 18:37555544-37555566 TTTTACATGGGCATAATTTCCGG + Intronic
1157371853 18:47120895-47120917 CTTAACATGGGCATGGTTTGTGG + Intronic
1158194974 18:54874850-54874872 TTTTACATGAGCAAGTTTAGGGG + Intronic
1159332133 18:67009447-67009469 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1159700536 18:71621162-71621184 TGTTACATGGGTGTGGTTTGTGG + Intergenic
1159906275 18:74095560-74095582 TCTTACATGGGCACTGTCTGAGG + Intronic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160166218 18:76514765-76514787 TCCTATATGGGCGTGGTTTGTGG + Intergenic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1163466922 19:17473427-17473449 TGTTGAATGGGCATGCTTTGAGG + Intronic
1164717830 19:30406372-30406394 TTTGCCATGGTCATGGGTTGGGG + Intronic
1165359176 19:35324174-35324196 TTTTACATGGGTGTGTTTTATGG - Intronic
1165668785 19:37656395-37656417 TTTTCCATGGAGACGGTTTGTGG + Intronic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
1166776036 19:45313334-45313356 TTTTATATGGGCAAGGTCGGTGG - Intronic
1167397590 19:49241389-49241411 TTTTATATGGGCATAGTTTGTGG + Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925462392 2:4074707-4074729 TTTTCCATGGGCAGGGGTTGGGG - Intergenic
925871453 2:8275058-8275080 TCTTATATGGGCCTGGTTTGTGG + Intergenic
926834842 2:17007067-17007089 TCTTATATAGGCATGGTTTCTGG - Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928264021 2:29794742-29794764 CCTTATAGGGGCATGGTTTGTGG + Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929529771 2:42741738-42741760 TCTTATATGGGCATGGCTTGTGG + Intronic
930591033 2:53326584-53326606 TTATAGATTGGCATGCTTTGGGG - Intergenic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
932116756 2:69057530-69057552 TCTTACATGTGTGTGGTTTGTGG - Intronic
932469958 2:71948321-71948343 TTTTCTATGGGCATGGTTCATGG + Intergenic
935334115 2:101999215-101999237 TTTTAGATGGGCAGGTTTTCTGG + Intronic
935616381 2:105087168-105087190 TTCTATATGTGGATGGTTTGTGG + Intronic
935746679 2:106194845-106194867 TTTTACTTCGGCAAGGTTTAGGG - Intergenic
936920170 2:117680467-117680489 TCTTATATGGGTATGGTTGGAGG - Intergenic
937174027 2:119908491-119908513 TCTTATATGGGTGTGGTTTGTGG - Intronic
937924882 2:127160452-127160474 ATTTGCAAGGGCACGGTTTGGGG - Intergenic
938174189 2:129109248-129109270 CCTTATATGGGCATGATTTGTGG + Intergenic
938225101 2:129608991-129609013 TTTTGCATGGACATTGTTTGTGG + Intergenic
938423884 2:131167987-131168009 TCTTATATGGGTGTGGTTTGTGG - Intronic
938562556 2:132487157-132487179 TCTTATATGGGTATGGTTTGTGG + Intronic
938621305 2:133057099-133057121 TCTTATATGGGCACGATTTGTGG - Intronic
938987237 2:136589290-136589312 TCTCATATAGGCATGGTTTGTGG + Intergenic
939486577 2:142820004-142820026 TTTCATATGGGTATGGTTTGTGG + Intergenic
939509138 2:143085101-143085123 AGTTATACGGGCATGGTTTGTGG - Intergenic
939577149 2:143909397-143909419 TTATACATTGGCATGCTTCGGGG - Intergenic
939722739 2:145675200-145675222 TCTTAAATGGGCACGGTTTGTGG + Intergenic
939867783 2:147493638-147493660 TCTTATGTGGGCACGGTTTGTGG - Intergenic
939933673 2:148261990-148262012 TTTTATATGGACATGTGTTGTGG + Intronic
940891009 2:159035350-159035372 TTTTACATGAGAATATTTTGTGG + Intronic
941016426 2:160362565-160362587 TCCTATATGGGAATGGTTTGTGG + Intronic
941077465 2:161022171-161022193 TCTTTTATGGGCATGGTGTGTGG - Intergenic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
942050744 2:172138442-172138464 GTTTATATGGGCATGGTTCTTGG - Intergenic
942876851 2:180810840-180810862 TCTTATATGGGCAAGGTTTGTGG - Intergenic
943074815 2:183180767-183180789 TTTAACAAGGACTTGGTTTGTGG - Intergenic
943229192 2:185224022-185224044 TTTTACATGTAAATGGTTTTGGG + Intergenic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
943851290 2:192725889-192725911 CTTTATATGGGCGTGGTTTGTGG + Intergenic
943935446 2:193909566-193909588 TTTTATATGGGCACAGATTGTGG - Intergenic
944100798 2:196023992-196024014 TTTTACATGGGTGCAGTTTGTGG + Intronic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
944332720 2:198490660-198490682 TTTTAAATTGGCATGGATTAAGG + Intronic
944623034 2:201538629-201538651 TCTTAGATGGGTGTGGTTTGTGG - Intronic
945392025 2:209276133-209276155 TTATACATTGGCATGGTTCCAGG - Intergenic
945477618 2:210304004-210304026 TTTTGGATGGGACTGGTTTGGGG + Intronic
945830211 2:214775435-214775457 TGTTACATGGCCAGGGTTTGTGG + Intronic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947035499 2:225849319-225849341 TTTTCCATGGACACAGTTTGTGG + Intergenic
947051195 2:226045373-226045395 TTATACATTGGCATGGTTCCGGG - Intergenic
947234603 2:227926943-227926965 TTTTATATGGGCATGATTCATGG - Intergenic
947554022 2:231073172-231073194 TTTTATATGGGTGTGGTTCGTGG + Intronic
947555423 2:231088597-231088619 TTTTACATGGGTGTGGTTCGTGG - Intronic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1169702204 20:8459478-8459500 TTTCACATGGTCTTGGTTTGAGG + Intronic
1170155900 20:13269144-13269166 TTTTTCTTGGGCATGTTTTGGGG - Intronic
1171313163 20:24162417-24162439 TCTCACATGGGTGTGGTTTGTGG - Intergenic
1172257763 20:33534814-33534836 TCTTATATGGGCACAGTTTGTGG + Intronic
1173891690 20:46517283-46517305 TTTTCCATGGACAGGGTTGGGGG + Intergenic
1173942087 20:46920033-46920055 TCTTATATGGGCACAGTTTGTGG + Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1177335717 21:19723465-19723487 GCTTATATGGGCATGGTTTGTGG + Intergenic
1177654639 21:24002184-24002206 TCTTATATGGGCACAGTTTGTGG - Intergenic
1178070661 21:28962484-28962506 TCTTATATGGCAATGGTTTGTGG - Intronic
1178100546 21:29264129-29264151 TCTTATATGGGCGGGGTTTGTGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1179811811 21:43876395-43876417 TTTCACATGGGCTTTGTCTGTGG + Intronic
1179915522 21:44475536-44475558 TTATACATTGGCATGGTTCCGGG - Intergenic
1180878980 22:19190390-19190412 TCTTATAGGGGCATGGTTTGTGG + Intronic
1181829612 22:25549600-25549622 TTTTTCATGGACAGGGTCTGGGG - Intergenic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1183795328 22:40112439-40112461 CTTATCATGGGCAGGGTTTGGGG - Intronic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949768777 3:7555330-7555352 TTTTACATTGAGATGGCTTGTGG - Intronic
949813554 3:8034188-8034210 CTTTATATGGGCATGGTTTGTGG + Intergenic
950112654 3:10429508-10429530 TCTGATATGGGCATGGTTTGTGG - Intronic
950125514 3:10507467-10507489 CTTTACACGGGCCTGTTTTGGGG - Intronic
950780364 3:15386528-15386550 TTATACATGGGCATGGTTCCAGG + Intronic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
951741373 3:25928102-25928124 TTATATGTGGGCATGGTTTGTGG + Intergenic
951756961 3:26101650-26101672 TTTTACATTGGCATGCTTCCTGG + Intergenic
952017459 3:28974931-28974953 GTTTTCAAGGGCAGGGTTTGAGG + Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
953790064 3:45940583-45940605 TTATACATTGGCATGGTTCCAGG - Intronic
954229872 3:49208507-49208529 TTTTCCATGGACATTGGTTGCGG - Intronic
954491573 3:50911937-50911959 TTATACATGGGCTTGCTTTTTGG + Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955513617 3:59705753-59705775 TATTACATATGCATGGGTTGGGG + Intergenic
955678306 3:61472719-61472741 CCTTATATGGGCATGATTTGTGG + Intergenic
955831021 3:63004188-63004210 TTTTATAAGAGCCTGGTTTGTGG + Intergenic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956098223 3:65739783-65739805 TCTTATATGGGTATAGTTTGTGG + Intronic
956409564 3:68965554-68965576 TTTTACTTGGGAAAGGTTTGGGG + Intergenic
957005643 3:74943483-74943505 TGTCACATTGGCTTGGTTTGAGG - Intergenic
957782914 3:84842777-84842799 TCTTACATGGGTGTGGTTTGTGG - Intergenic
957863734 3:85994795-85994817 TCCTATATGAGCATGGTTTGTGG + Intronic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959270796 3:104207445-104207467 TTTGGGGTGGGCATGGTTTGGGG - Intergenic
959726234 3:109545026-109545048 TATTACATGGGAATGTTGTGTGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960154627 3:114286261-114286283 TCTTATATGGGCCTGGTTTGTGG + Intronic
960179853 3:114562867-114562889 TCTTATATGGGTGTGGTTTGTGG + Intronic
960476386 3:118134543-118134565 TCTTACATGGGTGAGGTTTGTGG - Intergenic
960858044 3:122123164-122123186 TTTTCCAGGCGCATGGTTGGTGG - Intergenic
961092142 3:124122654-124122676 TTTTATATGGGCATGGTTTGTGG - Intronic
961725423 3:128925187-128925209 GGTTGTATGGGCATGGTTTGGGG + Intronic
962053240 3:131841630-131841652 TTTTCCATGGACATGGGGTGGGG - Intronic
963126318 3:141820212-141820234 TTTTACATAGGTGAGGTTTGAGG - Intergenic
963195217 3:142520154-142520176 TCTTATATGGGCACAGTTTGTGG - Intronic
963608806 3:147439364-147439386 TCTTGTGTGGGCATGGTTTGTGG + Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965224176 3:165966599-165966621 TCTTATGTGAGCATGGTTTGTGG - Intergenic
965918630 3:173883360-173883382 TCTTATATGGGTGTGGTTTGTGG + Intronic
966307663 3:178555246-178555268 TTTTGCTTGGGGAAGGTTTGTGG - Intronic
967034794 3:185640241-185640263 TGCCACGTGGGCATGGTTTGTGG - Intergenic
967400386 3:189054301-189054323 TTTTATAAGACCATGGTTTGTGG + Intronic
967400403 3:189054502-189054524 TTTTATAAGAGCATGGTTTGTGG - Intronic
967412259 3:189178804-189178826 TTTTACTTAGCCATGGTTTAAGG + Intronic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967710797 3:192705561-192705583 TCTTATGTGGGCATGGCTTGTGG + Intronic
969254894 4:5995036-5995058 TTTTCCATGGGCAGGGGGTGAGG - Intergenic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970605391 4:17676327-17676349 TCTTCTACGGGCATGGTTTGTGG + Intronic
971016746 4:22496871-22496893 TCTGTCATGGGCATGGTATGGGG - Intronic
971018008 4:22508478-22508500 TTTTCCATGGACATCGGTTGAGG - Intronic
971295557 4:25386521-25386543 TTTTATATGGCCATGGTTTGTGG + Intronic
971477907 4:27089583-27089605 TCATACATTGGCATGGTTTTGGG + Intergenic
971679865 4:29683933-29683955 TATTATATGGGCATGGTTTTTGG - Intergenic
971709065 4:30088079-30088101 TCTCATATGGGCATGGTTTGTGG + Intergenic
971830828 4:31692530-31692552 TTTTATGTGGGCATAGTTTTTGG - Intergenic
971868554 4:32205636-32205658 TATTAATTGGGTATGGTTTGTGG - Intergenic
971919778 4:32922833-32922855 TTTTACATGGCCATTGTATAAGG + Intergenic
972189358 4:36571240-36571262 TCTTACATGGGTGTGGTTCGTGG + Intergenic
972383720 4:38543420-38543442 TCTTATATGAGCATGGTTGGTGG + Intergenic
972912194 4:43831203-43831225 TTGTACATTGGCATGGTTCCAGG - Intergenic
973128604 4:46620823-46620845 TTTTAAATAGCCATGTTTTGGGG - Intergenic
974039215 4:56843550-56843572 TTATACATTGGCATGGTTCTGGG - Intergenic
974316227 4:60284711-60284733 TCTTATATGGGCACAGTTTGTGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974997018 4:69174152-69174174 TCTTATATGGGCGTGGATTGTGG - Intronic
975008033 4:69314634-69314656 TCTTATATGGGCGTGGATTGTGG + Intronic
975222857 4:71833343-71833365 TTATACATTGGCATGGTTCCGGG + Intergenic
975430386 4:74283324-74283346 TTTTACATGAGCATTTTTGGTGG + Intronic
975567884 4:75779095-75779117 TCTTATATGGGCACTGTTTGTGG - Intronic
975916411 4:79330992-79331014 TTATACATTGGCATGGTTCAGGG - Intergenic
976328553 4:83800792-83800814 TGTTACATGGATATAGTTTGTGG + Intergenic
976835306 4:89365766-89365788 CTTCATATGGACATGGTTTGTGG - Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977356059 4:95948320-95948342 TCTTATATGGGCACAGTTTGTGG + Intergenic
977401130 4:96534047-96534069 TTTTATATGGGCATTGTTCACGG - Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977556381 4:98491085-98491107 TTGTACATGTCCATGTTTTGAGG + Intronic
977582883 4:98744587-98744609 TTATACATTGGCATGGTTCCAGG + Intergenic
977612902 4:99054866-99054888 CTTTACATGGGCACAGTTTGTGG + Intronic
977809010 4:101337155-101337177 TTTAACATTGGGATGGTTTATGG - Intronic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
978212132 4:106149592-106149614 TTTTAAATGGGCTCCGTTTGTGG + Intronic
978249424 4:106612240-106612262 TCTTATATGGGAGTGGTTTGTGG + Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979648626 4:123104289-123104311 TCTTACATGGGTGTGGTTTATGG - Intronic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979811560 4:125042608-125042630 TCTTACAAGGGCATGGTTCGTGG - Intergenic
979911250 4:126368660-126368682 TTTAACATGGCAATGGTTTTTGG - Intergenic
979969363 4:127114873-127114895 TTTTACATGGTCATAGGTGGAGG + Intergenic
980529465 4:134033225-134033247 TCTTATATGGGTGTGGTTTGTGG - Intergenic
980549720 4:134318853-134318875 TCTTATATGGGCATAGTTTGTGG + Intergenic
980952889 4:139399082-139399104 TGTTATATGGGCACAGTTTGTGG + Intronic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981493002 4:145361112-145361134 TCTTACATGGGTGTGGTTTGTGG - Intergenic
981764578 4:148233763-148233785 TCTTACGTGGTCATGGTTTGTGG + Intronic
981984784 4:150840575-150840597 TCTTAAATGGGTGTGGTTTGTGG + Intronic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982344650 4:154344122-154344144 TCTTTCATGGCCATGGTTTGTGG + Intronic
982344660 4:154344311-154344333 TTTTACAAATTCATGGTTTGTGG - Intronic
982439863 4:155422829-155422851 TTATACATTGGCATAGTTGGAGG + Intergenic
982509123 4:156258754-156258776 TTTTGCATTGGCATGCTTTTTGG - Intergenic
982575694 4:157107093-157107115 TCTTATGTGGGCATGATTTGTGG - Intronic
982768077 4:159370270-159370292 TTTAACATGTCCATGGTTTATGG + Intergenic
983086710 4:163454016-163454038 TCTTATACGGGCATGGTTTGTGG + Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983808595 4:172027437-172027459 TCTTACAAGGGCACAGTTTGTGG - Intronic
984436542 4:179717529-179717551 TTTAACATTGGCATGGTTCTGGG - Intergenic
984810275 4:183790155-183790177 TTTTACATCACCATGTTTTGGGG - Intergenic
984911953 4:184682067-184682089 TTTTATATGTGTAGGGTTTGTGG + Intronic
985905237 5:2830194-2830216 TGCTACATGGGCCTGGTTGGGGG - Intergenic
986020039 5:3793011-3793033 TTTTATAATGCCATGGTTTGGGG + Intergenic
986294818 5:6429265-6429287 TTTTTCATGGGCAAAGGTTGGGG - Intergenic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
986764878 5:10916244-10916266 CTATTCATGGGCATGGTTTTTGG + Intergenic
987501938 5:18722795-18722817 TTTTATATGGCTGTGGTTTGTGG + Intergenic
987966324 5:24880584-24880606 TCTTATATGGGAGTGGTTTGTGG - Intergenic
987982406 5:25103205-25103227 TTTTATATTGGTTTGGTTTGTGG + Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988669778 5:33368912-33368934 TTTTATAGGGGCATGGTTTGTGG + Intergenic
988889109 5:35595267-35595289 TCTTATATGGGTGTGGTTTGCGG + Intergenic
990097450 5:52134907-52134929 TTTATCATGGGAATGGTATGTGG + Intergenic
990398544 5:55411062-55411084 GTTTTCATGGGCACGGTTTGAGG + Intronic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
990874583 5:60469742-60469764 TCCTATATGGGCATGGTTTGTGG - Intronic
991394132 5:66185660-66185682 TCTTATATGGGCACGGTTTGTGG - Intergenic
992362956 5:76061048-76061070 TCTTATATGGGCATAGTTTGTGG + Intergenic
992753329 5:79881254-79881276 GTTTACATGGTGATGTTTTGTGG - Intergenic
992887304 5:81171239-81171261 TTTTCCATGGGCATGGGATCAGG - Intronic
992918353 5:81483099-81483121 TCTTGTATGGGCACGGTTTGTGG + Intronic
993082121 5:83314742-83314764 TATTTTATGGGCATGGTTTGTGG - Intronic
993124338 5:83814090-83814112 TCTTATATGGGCACTGTTTGTGG + Intergenic
993349616 5:86832554-86832576 TTTTATATGGGCACAGTTTGTGG + Intergenic
994255809 5:97594707-97594729 TCTTGTATGGTCATGGTTTGTGG + Intergenic
994281418 5:97908000-97908022 TTATACATTGGCATGGTTCTGGG - Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
995325275 5:110882588-110882610 TTTTACTTGGGCAGGGGGTGGGG + Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995534661 5:113123028-113123050 TGGTACATGGGTATGTTTTGTGG - Intronic
995627848 5:114098609-114098631 TTTTTCACGGACATGGTTGGGGG - Intergenic
995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG + Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996586612 5:125095380-125095402 TCTTATATGGGTGTGGTTTGTGG - Intergenic
996673159 5:126143287-126143309 TCTTATATGGGTATGGTTTGTGG - Intergenic
997021444 5:130007532-130007554 AGTTAAATAGGCATGGTTTGTGG + Intronic
997044205 5:130294326-130294348 TTTTACATGTGCATGGAATTTGG + Intergenic
997162904 5:131627933-131627955 TCTTACATGGGCACAGTTTGTGG - Intronic
997274305 5:132571088-132571110 TCTTATATGTGGATGGTTTGTGG + Intronic
998863646 5:146472493-146472515 TCTTACATGGGTGTGGTTTGTGG - Intronic
999234745 5:150083629-150083651 CTTCACAGGGGCATGGTGTGTGG - Intronic
1000129264 5:158279661-158279683 TCTTCTATGGGCATGGTTTGTGG - Intergenic
1000821259 5:165987190-165987212 TCTTATATGGGCATGCTTTGTGG - Intergenic
1001091338 5:168743448-168743470 TCTTTGATGGGCATGGTTCGTGG - Intronic
1002813092 6:653052-653074 TCTCATATGAGCATGGTTTGTGG - Intronic
1002940136 6:1708610-1708632 TTTATAATAGGCATGGTTTGAGG - Intronic
1002985059 6:2181690-2181712 TTTTGTATGGGCTTGGTTTGTGG - Intronic
1003598781 6:7499446-7499468 TCTTATATGGGCGTGGCTTGTGG + Intergenic
1003662776 6:8078380-8078402 TCTTATATGGGCATGGCTTGTGG + Intronic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1003950567 6:11111751-11111773 TTATACATCGGCATGGTTCCGGG + Intronic
1004100744 6:12608145-12608167 TTTGACAGGAGGATGGTTTGAGG - Intergenic
1004467673 6:15901143-15901165 TTATACATTGGCATGATTTTGGG + Intergenic
1004978605 6:20996580-20996602 TCTTATATGGGCGCGGTTTGTGG + Intronic
1005621363 6:27623568-27623590 TTATACATTGGCATGGTTCCGGG + Intergenic
1005638930 6:27776331-27776353 TTTTCCATGGACAGGGGTTGGGG + Intergenic
1005689879 6:28293716-28293738 TTTTAAACGGGCATGGTTTGTGG - Intronic
1007884227 6:45207735-45207757 TTTTATATGGGCCTGGTTCTTGG - Intronic
1008152267 6:47968288-47968310 TCTTACATGGGTGTGGTTTGTGG + Intronic
1009240521 6:61180608-61180630 TCTTACATAGGTATGGTTTCTGG - Intergenic
1009346286 6:62615718-62615740 TTTTACATTGGCTTGGTTCCAGG + Intergenic
1009440514 6:63672611-63672633 TTTTCCACAGGTATGGTTTGTGG + Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010608478 6:77921837-77921859 TCTGATATGGGCATGGTTTGTGG + Intronic
1010693143 6:78934182-78934204 TCTTATATGGGTGTGGTTTGTGG + Intronic
1010724600 6:79318995-79319017 CGTCACATGGGCATGGTTTGTGG + Intergenic
1010898469 6:81396033-81396055 GATTATATGGGCACGGTTTGTGG - Intergenic
1011029405 6:82905402-82905424 CTATATATGGGCATGATTTGTGG - Intronic
1012493671 6:99811021-99811043 TTGTACATTGGCATGGTTCCAGG + Intergenic
1012716068 6:102672111-102672133 TTATACATTGGCATGGTTCTAGG + Intergenic
1012983317 6:105852256-105852278 TCTTATATGGGCACAGTTTGTGG + Intergenic
1013088826 6:106880546-106880568 TCTTACATGAGTGTGGTTTGTGG + Intergenic
1013414684 6:109914035-109914057 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1013729760 6:113151265-113151287 TCTTATATGGGCATGACTTGTGG + Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013933101 6:115559127-115559149 TGTCATATGGGCATTGTTTGTGG - Intergenic
1013943575 6:115695258-115695280 TTTTATATGGGCATGGTTTGTGG - Intergenic
1014076404 6:117240445-117240467 TCTTATATAGGCATGGTTTGTGG - Intergenic
1014480385 6:121928626-121928648 ATTTTCCTGGGCATGTTTTGTGG - Intergenic
1014528296 6:122527619-122527641 TTTTATATGGGAATGGTTTGTGG + Intronic
1015282284 6:131446675-131446697 CTTTACATGGGGCTGGTTTGAGG - Intergenic
1015337014 6:132050954-132050976 TGTTTTGTGGGCATGGTTTGTGG - Intergenic
1015433407 6:133156432-133156454 TCTTACATGGGCACAGTTTGTGG + Intergenic
1016081599 6:139863928-139863950 TCTTATATGGGCACAGTTTGTGG - Intergenic
1016411162 6:143785651-143785673 TTTGCCATGGGCAGGGTTGGGGG - Intronic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016672506 6:146725535-146725557 ATTTCCATGGACTTGGTTTGGGG - Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016946161 6:149536140-149536162 TCTTATATGGGCACAGTTTGTGG - Intronic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1017592911 6:155996365-155996387 TTGTACATGGGCAAGGGTTGTGG - Intergenic
1017656820 6:156637508-156637530 TTTCACAAGGGCACGGCTTGAGG + Intergenic
1018070396 6:160159726-160159748 TGTCACAAGGACATGGTTTGTGG - Intergenic
1018076601 6:160221778-160221800 TTTTACACAGCCATGGTTTGTGG + Intronic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1018294747 6:162333547-162333569 TTTTATATAGGCATGGTTGGTGG - Intronic
1018320855 6:162607093-162607115 TTTTACACGGGTGGGGTTTGAGG + Intronic
1018385192 6:163296608-163296630 TTTTACATGGAGAATGTTTGGGG + Intronic
1019159495 6:170059606-170059628 TCTTACATGGATGTGGTTTGTGG - Intergenic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020727648 7:11835799-11835821 TTTTATATGGGCACAGTATGTGG - Intergenic
1020764452 7:12302868-12302890 TTATACATTGGCATGGTTCCAGG - Intergenic
1020848323 7:13315923-13315945 TTTTCCATCGGCTGGGTTTGGGG + Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021237178 7:18156312-18156334 TATTTCATGGGCAAGGTCTGGGG + Intronic
1021472840 7:21025268-21025290 TTTAACATGGGAATAGTTTGGGG + Intergenic
1022951366 7:35341348-35341370 TCTTATATGGGCACAGTTTGTGG - Intergenic
1023193494 7:37609242-37609264 TTGTACATGAGCATGGTTTGTGG - Intergenic
1023635374 7:42204230-42204252 TGTTGGATAGGCATGGTTTGGGG - Intronic
1024016829 7:45324952-45324974 TTATACATTGGCATGGTTCCAGG - Intergenic
1024133292 7:46379394-46379416 TCTTATGTGGGCATGGCTTGTGG - Intergenic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1024894920 7:54246938-54246960 TTTTAGATGTTCATAGTTTGAGG + Intergenic
1025846371 7:65202061-65202083 TGTTCCATGGGCCTGGTCTGAGG - Intergenic
1025896617 7:65707968-65707990 TGTTCCATGGGCCTGGTCTGAGG - Intergenic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026466722 7:70660733-70660755 TTTTACATGGGAAGGCTCTGGGG + Intronic
1027296240 7:76774523-76774545 TCTTATGTGAGCATGGTTTGTGG + Intergenic
1027908871 7:84221724-84221746 TCTTACATAGGCATAGTTTATGG + Intronic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028675220 7:93452117-93452139 TTTTACATGGGCATCTTGCGTGG - Intronic
1029378124 7:100194452-100194474 TCTTATATGGGCACGGTTTGTGG + Intronic
1029499356 7:100918437-100918459 TTATACATTGGCATGGTTCCGGG - Intergenic
1030479130 7:110080250-110080272 TTTTATATGGGCACGGTTTGTGG + Intergenic
1030567714 7:111180446-111180468 TCTTACATGGGTGAGGTTTGTGG + Intronic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031512943 7:122671345-122671367 TTATACATGTGCATGGATGGGGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1031878366 7:127167655-127167677 TTTTATATGGGCACAGTTCGTGG - Intronic
1032235526 7:130118863-130118885 TTTTATATGGGCGTGGTTCATGG + Intronic
1032558630 7:132864371-132864393 TTTTATATGGGTGTGGTCTGTGG + Intronic
1032927773 7:136628699-136628721 TCTTGCATGGGCACAGTTTGTGG - Intergenic
1033107574 7:138542430-138542452 TCTTACATGGGTGTGGTTTGTGG + Intronic
1033152816 7:138931122-138931144 TTGTATATGGGCAGAGTTTGCGG + Intronic
1033446635 7:141428688-141428710 TTATACATTGGCATGGTTCCAGG - Intronic
1033629873 7:143147246-143147268 TTTTACATTGGAATGGAATGAGG - Intergenic
1035167124 7:156998165-156998187 TCTTATATGGGCAAGGTTTGTGG + Intronic
1037191741 8:16134446-16134468 TCTTTTACGGGCATGGTTTGTGG - Intronic
1037209101 8:16363436-16363458 TGCTTCATAGGCATGGTTTGAGG - Intronic
1037435633 8:18860234-18860256 CGTTATATGGGCATGGTTTATGG + Intronic
1038526891 8:28282462-28282484 TCTTCCATGGGCACGGTTTGTGG - Intergenic
1038630538 8:29239140-29239162 TATTACGTGTGTATGGTTTGGGG - Intronic
1039197356 8:35047491-35047513 ATCTACATGGGCATGGGCTGTGG + Intergenic
1039836055 8:41257069-41257091 TTGTACTTGGGAATGGATTGAGG - Intergenic
1040718141 8:50283434-50283456 TTTTACATGGCCATTGTTGAAGG + Intronic
1040774128 8:51018470-51018492 TCTTATATGGGCGTGGTGTGTGG + Intergenic
1041199662 8:55439282-55439304 TTATACGTGGGCATTATTTGAGG - Intronic
1042299409 8:67260329-67260351 TTTTACAGGTTCATGGTTTGTGG + Intronic
1042396438 8:68296412-68296434 TTTTACATTGGCATGGTTCCAGG - Intergenic
1042409843 8:68451653-68451675 TCTTACATGGGTGTGGTTTGTGG + Intronic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1042882423 8:73508438-73508460 TCTTATATGGGCATGATTTGTGG + Intronic
1042897506 8:73686849-73686871 TTTTACATGCAGGTGGTTTGCGG + Intronic
1042909429 8:73810175-73810197 TTTTACCTGTGCATGCTTTTGGG + Intronic
1043098999 8:76016115-76016137 TCTTATATGGGAATAGTTTGTGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1043873349 8:85459716-85459738 GTTTACATGGGGATGGATGGGGG - Intergenic
1043928275 8:86062204-86062226 TTTTAAATGTGCATGAATTGGGG + Intronic
1043990891 8:86752662-86752684 TCTTATATGGGCATAGTTTGTGG + Intergenic
1044030897 8:87235590-87235612 TCTTATATGTGCATAGTTTGCGG + Intronic
1044114304 8:88315564-88315586 TCTTAAATGGGCAGAGTTTGTGG - Intronic
1044289506 8:90451265-90451287 TCTTACGTGAGCATGGTTTTTGG + Intergenic
1044461189 8:92446356-92446378 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1044807729 8:96025396-96025418 TCTTATATGGGTAGGGTTTGTGG - Intergenic
1045067906 8:98468313-98468335 TTTTAGAATGGCATGGTTTGTGG + Intronic
1045333979 8:101181747-101181769 TTTTCCATGGACAGGGTTGGGGG + Intronic
1045399813 8:101802222-101802244 TATTTTATGGGCATGGTTTGTGG - Intronic
1045704849 8:104910619-104910641 TTTTACAAGGGCATTACTTGTGG - Intronic
1046702504 8:117417607-117417629 TTTAGCATGGGAATGGTTTAGGG - Intergenic
1046957815 8:120079691-120079713 TTTTACATGGCCAACGTATGCGG + Intronic
1047106512 8:121736791-121736813 TCTTCTATGGGCATAGTTTGTGG + Intergenic
1048572241 8:135665833-135665855 TTCCCCAGGGGCATGGTTTGGGG - Intergenic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1050001753 9:1084614-1084636 TTAGAGATGGGCATGGCTTGGGG + Intergenic
1050321433 9:4456846-4456868 TTGTATATGGGCATGGTTCATGG + Intergenic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051137127 9:13934956-13934978 TTTTGCATTGGCATTGTATGAGG - Intergenic
1051179095 9:14391742-14391764 TTATACATTGGCATGGTTCCAGG - Intronic
1051305466 9:15703866-15703888 TCTTCTATGGGCATGGTTTGTGG + Intronic
1051601702 9:18881520-18881542 TTTTATATGAGCATGGTTCATGG + Intronic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051753568 9:20370318-20370340 TCTTACATGGGTGCGGTTTGTGG - Intronic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1052111336 9:24586809-24586831 TCTTACATGGGCACGGTTACTGG + Intergenic
1052371365 9:27668644-27668666 TTTTATATGGGTGGGGTTTGTGG + Intergenic
1053296470 9:36917950-36917972 TCTTATATGGGCACAGTTTGTGG - Intronic
1054994493 9:71370039-71370061 TGTTATGTGGGTATGGTTTGTGG - Intronic
1055781388 9:79825085-79825107 TTTGAGCTGGGCATGGTTTGGGG - Intergenic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1056227201 9:84507315-84507337 TCTTATATGTGCATGGCTTGTGG - Intergenic
1056274276 9:84977952-84977974 TCTTACATGGATATAGTTTGTGG - Intronic
1057538977 9:95946878-95946900 TTTTATAGGGGCATGGTTCATGG - Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1058641723 9:107093593-107093615 TCTTACATGGGTGTGGTTTATGG + Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059264747 9:113016623-113016645 TCTTATATGTGCATGGTCTGTGG - Intergenic
1059290102 9:113215449-113215471 TTTTATGTGAGCGTGGTTTGTGG + Intronic
1059793528 9:117666256-117666278 TTTTACATATTCAAGGTTTGTGG + Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1060496025 9:124119132-124119154 TTTCACATGTGCATGCTTTTGGG + Intergenic
1060903012 9:127277883-127277905 TTTTACATTGTCATTATTTGTGG + Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1061933149 9:133843677-133843699 ATGGACATGGGCATGGTTTAGGG + Intronic
1186321927 X:8437090-8437112 TTTTACAATGGCATGGTTCAGGG + Intergenic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1186969877 X:14830173-14830195 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1188091895 X:25974954-25974976 TTATACATTGGCATGGTTCCAGG - Intergenic
1188116355 X:26248987-26249009 TTTTACATAGGCATGGATTTAGG + Intergenic
1188221912 X:27551028-27551050 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1188291452 X:28393695-28393717 TCTTGTATGTGCATGGTTTGTGG + Intergenic
1188297521 X:28468303-28468325 TTTTACACCAGCATGCTTTGGGG - Intergenic
1188329900 X:28856676-28856698 TCCTATGTGGGCATGGTTTGTGG - Intronic
1188469131 X:30517619-30517641 TCTTATATGGTCATAGTTTGTGG - Intergenic
1189060166 X:37745207-37745229 TCTTATATGGGTGTGGTTTGTGG + Intronic
1189072429 X:37877929-37877951 TTTTATATGAGCATGGTTCATGG - Intronic
1189930869 X:46008395-46008417 TCTTATATGGGCATTGTTTGTGG + Intergenic
1190460827 X:50672133-50672155 TCTTATATGGGCACAGTTTGTGG + Intronic
1190949028 X:55123990-55124012 TTATACATTGGCATGGTTCTGGG + Intronic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1191957784 X:66664951-66664973 TGTCATATGGGCATGGTTTGTGG + Intergenic
1192028745 X:67485981-67486003 TCTTACATTGGCATGAGTTGTGG + Intergenic
1192328684 X:70156076-70156098 TCTTCTGTGGGCATGGTTTGTGG + Intronic
1192606556 X:72524959-72524981 TTTTCCATGGGCATGGTTGGGGG + Intronic
1193286533 X:79721494-79721516 TTATACATTGGCATGGTTTGGGG - Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1194100510 X:89697422-89697444 TTTTACATGGGTATGGTTTGTGG + Intergenic
1194167869 X:90542876-90542898 TTTTATATGGGCGTGGTTCATGG + Intergenic
1194241168 X:91451138-91451160 TTTTAAAAGGACATGTTTTGGGG - Intergenic
1194286475 X:92017116-92017138 TTTTATATGAGCAAGGTTTGTGG + Intronic
1194713661 X:97265413-97265435 ATTTACTTGGGCATGGAATGGGG + Intronic
1194940208 X:100000104-100000126 TCTTAAAAAGGCATGGTTTGTGG - Intergenic
1195593332 X:106657761-106657783 TCTCACATGGGTGTGGTTTGTGG + Intronic
1195628394 X:107028474-107028496 TCTTATATGGGCATAGTTTGTGG + Intergenic
1195818955 X:108921688-108921710 TCTTATATGGGTATGGTTTGTGG - Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196564041 X:117183726-117183748 TCTTACATAGGCATGGTTGGTGG - Intergenic
1197473708 X:126894291-126894313 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1197561591 X:128029226-128029248 TCTTTTATGGGCATGGTTTGTGG + Intergenic
1198265886 X:135008359-135008381 TTTTACATTGGCAGTGTTTAAGG - Intergenic
1198826663 X:140705377-140705399 TTTTATATGGGCACAGTTTATGG + Intergenic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199103011 X:143827911-143827933 TTTTATATGGGCATAGTTTGTGG - Intergenic
1199359239 X:146898342-146898364 TCTTACATAGGCGTGGTTTGTGG - Intergenic
1200453462 Y:3358483-3358505 TTTTACATGGGTATGGTTTGTGG + Intergenic
1200604019 Y:5241667-5241689 TTTTATATGAGCAAGGTTTGTGG + Intronic
1200635054 Y:5641589-5641611 TCTTATCTGGGCCTGGTTTGTGG + Intronic
1200803862 Y:7411924-7411946 TTTTACATGTGTGTGGCTTGGGG + Intergenic
1200859893 Y:7979511-7979533 ATTTTCATTGGCATGGTTTTGGG + Intergenic
1200959554 Y:8984387-8984409 TTTTACTAGGGCATGCTTTAAGG - Intergenic
1202173236 Y:22073321-22073343 TTTGACTTGGGCCTGTTTTGGGG - Intronic
1202218124 Y:22513053-22513075 TTTGACTTGGGCCTGTTTTGGGG + Intronic
1202325061 Y:23683005-23683027 TTTGACTTGGGCCTGTTTTGGGG - Intergenic
1202545710 Y:25987049-25987071 TTTGACTTGGGCCTGTTTTGGGG + Intergenic