ID: 1193835029

View in Genome Browser
Species Human (GRCh38)
Location X:86332264-86332286
Sequence ACACTGTTATTGAAGAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 306}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193835029_1193835032 6 Left 1193835029 X:86332264-86332286 CCTTGATTCTTCAATAACAGTGT 0: 1
1: 0
2: 3
3: 55
4: 306
Right 1193835032 X:86332293-86332315 GTTAATAAATACTACTTTCCAGG 0: 1
1: 0
2: 1
3: 23
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193835029 Original CRISPR ACACTGTTATTGAAGAATCA AGG (reversed) Intronic
902915077 1:19633395-19633417 ACACTGTTATTGAGGAGAGAAGG + Intronic
906875094 1:49528996-49529018 ACAAAGTCATTAAAGAATCATGG + Intronic
909072350 1:71011377-71011399 ACACTTTTGGTGAATAATCAAGG + Intronic
910955871 1:92703955-92703977 ATACTGTTATTCAAGAATGCAGG + Intronic
911707343 1:101028753-101028775 ACACTCTTATTGAGAAATAACGG - Intergenic
911928476 1:103868508-103868530 ACACTCTTTTTGTAGAATCTAGG + Intergenic
912164757 1:107029975-107029997 AGAGTGATAGTGAAGAATCAGGG - Intergenic
912693822 1:111825007-111825029 ACACTGTTACTGAAATGTCAGGG - Intronic
913093579 1:115496312-115496334 ACAGGGTAATTGAAGAAGCATGG - Intergenic
915039855 1:152959662-152959684 CCACTGTTGTTGAAGGAGCAGGG - Intergenic
915791732 1:158679511-158679533 ACACTGGTATGTAAGAAGCATGG + Intronic
920750121 1:208666339-208666361 AGACTGATATTGATGAATCTTGG - Intergenic
920839035 1:209538418-209538440 AGACTTTCCTTGAAGAATCATGG + Intergenic
921018589 1:211215190-211215212 ACACTATTTTTCAAGAATAAGGG + Intergenic
923127559 1:231045779-231045801 ACACTGTCATTCAGGAATGAGGG + Intergenic
924077511 1:240355761-240355783 ACACTGTTAGTGGAGCATTAAGG - Intronic
924385350 1:243494330-243494352 ACACAGTTTTGAAAGAATCAGGG - Intronic
924393896 1:243595515-243595537 AAACTGTTATAAAAGAGTCAAGG - Intronic
924844824 1:247756131-247756153 AAACTGTTATTTTAGATTCAGGG + Intergenic
1065557141 10:26927729-26927751 AAACTGTCTTTGAAGAATGAGGG + Intergenic
1066247785 10:33600449-33600471 AGATTGTTATTTAAGACTCATGG + Intergenic
1066786552 10:39010640-39010662 ACACTCTTTTTGGAGAATCTGGG - Intergenic
1066799739 10:39172231-39172253 ACACTGTTTTTGTAGGATCTCGG + Intergenic
1066809210 10:39303898-39303920 ACACTGTTTTTGTAGAATCTGGG - Intergenic
1066824428 10:39548385-39548407 ACACTCTTCTTGTAGAATCTGGG + Intergenic
1068695897 10:59967867-59967889 ACACAGGTATTGAACAATTATGG + Intergenic
1068838473 10:61582855-61582877 ACAGTGTTATAGAAGAAGCCTGG - Intergenic
1069116496 10:64513289-64513311 AAACTTTTATTAAATAATCAAGG + Intergenic
1069178173 10:65321354-65321376 AAACTTTTATTTTAGAATCAGGG + Intergenic
1069931168 10:71882690-71882712 AGATTGTTACTGAAGACTCAGGG - Intergenic
1074290978 10:112137827-112137849 ACACTGTAAATGAATAATAAGGG + Intergenic
1078165903 11:8884843-8884865 ACACTGATATTGAAGACTTATGG - Intronic
1081291627 11:41333191-41333213 GCTTTGTAATTGAAGAATCAAGG + Intronic
1082148055 11:48695767-48695789 ACACTGTTCTTGTAGAATCTGGG + Intergenic
1082292488 11:50394267-50394289 ACACTGTTTTTGTAGAATCTAGG + Intergenic
1082294819 11:50427306-50427328 ACAGTGTTTTTTAAGAATCTGGG + Intergenic
1082296966 11:50452652-50452674 ACACTGTTTTGGCAGAATCTGGG + Intergenic
1082297141 11:50455224-50455246 ACACTGTTTTGGTAGAATCTGGG + Intergenic
1082309295 11:50627046-50627068 ACACTGTTTTTGTAGAAACTGGG + Intergenic
1082310661 11:50643625-50643647 ACACTGTTTTTGTAGAATCTGGG + Intergenic
1082584949 11:54925467-54925489 ACACTGTTTTGGCAGAATCTGGG - Intergenic
1082590167 11:54997406-54997428 ACACTGTTCTTGTAGAATCTGGG + Intergenic
1082592863 11:55035478-55035500 ACACTGTTTTTGTAGAATCTGGG - Intergenic
1082593689 11:55047383-55047405 ACACTGTTTTGGCAGAATCTGGG - Intergenic
1082595651 11:55077755-55077777 ACACTGTTTTGGTAGAATCTGGG + Intergenic
1082641013 11:55661318-55661340 ACAATATAATTGCAGAATCAAGG - Intergenic
1084467306 11:69333392-69333414 ACACTCTTCTTGCAGAAGCAGGG + Intronic
1085743543 11:79096320-79096342 ACACAGTCAATGAAGAAACAAGG + Intronic
1088971402 11:114777669-114777691 ACACAGTTGTTGAAGAAGGAAGG - Intergenic
1090102791 11:123818528-123818550 TGACTGTTGTTGAAGAATCGAGG - Intergenic
1092930795 12:13313859-13313881 ACATTCTCATTGTAGAATCAAGG - Intergenic
1093427020 12:19038983-19039005 ACGCAGTTATCAAAGAATCAGGG + Intergenic
1093739090 12:22660208-22660230 ATACTGTTAATGGAGAAGCAGGG + Intronic
1094256636 12:28437132-28437154 ACACTTTTACTGATAAATCATGG - Intronic
1094868103 12:34563687-34563709 ACACTGCTTTTGAAAAATCTGGG - Intergenic
1094869633 12:34586201-34586223 ACACTATTTTTGCAGAATCTGGG - Intergenic
1094869684 12:34587058-34587080 ACACTGTTTTTCTAGAATCTGGG - Intergenic
1094870001 12:34591634-34591656 ACACTGTTTTTGTAGAATCTGGG - Intergenic
1094873627 12:34614944-34614966 ACAATGTTTTTGTAGAATCTCGG + Intergenic
1094873652 12:34615282-34615304 ACACTGTTTTTGCAGAATCTGGG + Intergenic
1094873671 12:34615621-34615643 ACACTGTTTTTGTAGAATCTGGG + Intergenic
1094873747 12:34616832-34616854 ACACTGTTCTTGTAGAATCTGGG + Intergenic
1094873783 12:34617513-34617535 ACACTGTTTTTGTAGAATCTGGG + Intergenic
1094873876 12:34619224-34619246 ACACTGTTTTTGTAGAATCTGGG + Intergenic
1094876550 12:34651952-34651974 ACACTGTTTTTGTAGCATCTGGG + Intergenic
1095048684 12:37537487-37537509 ACACTCTTTTTGTAGAATCTAGG - Intergenic
1095075388 12:37915385-37915407 ACACTGTTTTTGTAGAATCTGGG - Intergenic
1095079124 12:37975646-37975668 ACACTGTTTTTGTAGAATCCAGG + Intergenic
1095210091 12:39483750-39483772 AAAATGTTACTGATGAATCATGG + Intergenic
1097407919 12:59214275-59214297 ACAATGTTATTGAGCAACCATGG - Intergenic
1098002838 12:65963066-65963088 AAACCGTAATTGAGGAATCAAGG - Intronic
1098086914 12:66855762-66855784 ACACTGTTGTGGCAGAATCTAGG - Intergenic
1099022221 12:77420881-77420903 TTTCTGGTATTGAAGAATCAAGG - Intergenic
1100510516 12:95267593-95267615 ACACTGTTTCTAAAAAATCATGG + Intronic
1100756244 12:97753775-97753797 ACTCTGTTAATGGTGAATCAGGG - Intergenic
1106988526 13:35386151-35386173 AAACAGTTATGGAATAATCATGG - Intronic
1107262010 13:38503849-38503871 AGACAGTTAATTAAGAATCAAGG + Intergenic
1108352315 13:49598686-49598708 AAAATGTTATTGCAGTATCAAGG + Intergenic
1108638430 13:52359267-52359289 AAAATGTGATTGAAGAATAAGGG - Intergenic
1108783618 13:53867798-53867820 ACACTGATCCTGTAGAATCAGGG + Intergenic
1109233864 13:59791981-59792003 ACACTGTTGTCTAAGAATGATGG - Intronic
1110993422 13:82072642-82072664 CCACTGCAATGGAAGAATCAGGG + Intergenic
1111080776 13:83304328-83304350 ATACTTTTTTTGAAGAAACATGG + Intergenic
1111539005 13:89646966-89646988 AGACTGTTACTGAAACATCAGGG - Intergenic
1111856764 13:93647664-93647686 TGACAGTTATGGAAGAATCACGG - Intronic
1114921630 14:27339456-27339478 AAACTGTTATAGAAGATTCTTGG - Intergenic
1115377625 14:32695033-32695055 ACAGTGTTTTAGAAGAATCTGGG + Intronic
1119669097 14:76505379-76505401 ATACTGTTTTTGAAAAATCAAGG - Intergenic
1120339234 14:83197738-83197760 ACACTTTTATTTAAAAATCTGGG - Intergenic
1120406097 14:84095097-84095119 ACACTTTAATTAAAGAGTCAGGG - Intergenic
1120581874 14:86261955-86261977 ACAGTGTTATTCAACATTCATGG - Intergenic
1121522867 14:94598384-94598406 ACAGGGTTATTGAAGGCTCAGGG + Intronic
1123662655 15:22578060-22578082 ACTCTGTGACTGATGAATCAAGG - Intergenic
1124261628 15:28197852-28197874 ACTCTGTGACTGATGAATCAAGG + Intronic
1124316456 15:28672361-28672383 ACTCTGTGACTGATGAATCAAGG - Intergenic
1125006340 15:34821996-34822018 CCTCTGTTCTTGAAGATTCAAGG - Intergenic
1126176875 15:45744057-45744079 ACACTGTTAATGAACAGTGAGGG + Intergenic
1126192178 15:45889154-45889176 ACAGTGTTGTTGAAGAAGTAGGG + Intergenic
1126857232 15:52850523-52850545 TCACGGTTGTTGAAAAATCATGG + Intergenic
1128437723 15:67671542-67671564 AAACTGTTTTTAAAGTATCAGGG + Intronic
1129932659 15:79425333-79425355 ACATTGTTAAAGAAGAACCATGG - Intronic
1131760644 15:95618960-95618982 ACACTGTCATTTAACAATCACGG + Intergenic
1134355881 16:13481917-13481939 ATACTTTGATTGAATAATCAGGG + Intergenic
1134536620 16:15031564-15031586 ACACAGATATGGAAGAATTAGGG - Intronic
1135231368 16:20711331-20711353 ACAATATCATTGGAGAATCAAGG + Intronic
1136738896 16:32493919-32493941 ACACTGTTTTTGTACAATCTGGG + Intergenic
1136740000 16:32510581-32510603 ACAGTGTTTTTGTAGAATCTGGG - Intergenic
1137045356 16:35652515-35652537 ACACTTTTTTTGTAGAATCTAGG + Intergenic
1137059601 16:35777721-35777743 ACACTGTTTTTGTAGAATCCAGG - Intergenic
1137095707 16:36253124-36253146 ACACTCTTTTTGTAGAATCTGGG - Intergenic
1138130819 16:54478513-54478535 AAACTGATATTGAACAAGCAGGG + Intergenic
1141225341 16:82109681-82109703 GGACTGTTATTGAAGAAAAATGG + Intergenic
1141232732 16:82185043-82185065 CCTCTTTTATTGAAAAATCAAGG - Intergenic
1203012909 16_KI270728v1_random:316756-316778 ACAGTGTTTTTGTAGAATCTGGG + Intergenic
1203014316 16_KI270728v1_random:337873-337895 ACACTGTTTTTGTACAATCTGGG - Intergenic
1203031244 16_KI270728v1_random:589915-589937 ACAGTGTTTTTGTAGAATCTGGG + Intergenic
1203032651 16_KI270728v1_random:611032-611054 ACACTGTTTTTGTACAATCTGGG - Intergenic
1203040477 16_KI270728v1_random:744516-744538 ACAGTGTTTTTGTAGAATCTGGG - Intergenic
1143980437 17:10864762-10864784 ACCCTGTTTTTGGAGAAGCAAGG + Intergenic
1145728007 17:27151508-27151530 ACACTCTTATTGTAGAATCTAGG + Intergenic
1147754555 17:42760142-42760164 ACACTGTTAAGGAAGCAGCAAGG - Intronic
1149073001 17:52565375-52565397 ACACTTTCATTGAAAAACCATGG - Intergenic
1151735541 17:75937902-75937924 TCACTGGTATTGAGGAGTCAGGG - Intronic
1153174432 18:2354910-2354932 AAACTTTTATTTTAGAATCAGGG - Intergenic
1153657232 18:7293770-7293792 ACACTTTTATTTGAGATTCAGGG - Intergenic
1154096197 18:11417346-11417368 AAACTGCTATAGGAGAATCATGG - Intergenic
1154336735 18:13471809-13471831 ACACTGTTCTTCAAGAAAAATGG - Intronic
1155400000 18:25427611-25427633 ACACTGTTATTTCAGAAACCAGG - Intergenic
1155909380 18:31490554-31490576 ACACTGTTGATGAAGAGTCAGGG - Intergenic
1159578120 18:70204744-70204766 ACATTGGTATTTATGAATCACGG + Intronic
1159755168 18:72355296-72355318 CCACTTTTATTTTAGAATCAGGG + Intergenic
1160278890 18:77468239-77468261 TAGCTGTAATTGAAGAATCAAGG + Intergenic
1161232471 19:3181220-3181242 ACACGGCTATTGAAAATTCATGG + Intergenic
1164327067 19:24203777-24203799 ACACTGTTTTTTCAGAATCTGGG - Intergenic
1164327470 19:24210040-24210062 ACACTGTTTTTGTAGGATCTGGG - Intergenic
1164327484 19:24210208-24210230 ACACTGTTTTTGTAGAATCTGGG - Intergenic
1164327622 19:24212607-24212629 ACACTGTTTTTGTAGGATCTGGG - Intergenic
1164328306 19:24223556-24223578 ACACTGTTTTTGTAGAATCTAGG - Intergenic
1164328554 19:24227829-24227851 CCACTGTTTTTGTAGAATCTGGG - Intergenic
1164328711 19:24229855-24229877 ACACTGTTTTTGTAGTATCTAGG - Intergenic
1164328749 19:24230371-24230393 ACACTGTTTTTGTAGTATCTCGG - Intergenic
1164333784 19:24287148-24287170 ATACTGTTTTTGTAGAATCAGGG + Intergenic
1164335672 19:24317565-24317587 ACACTGTTTTGGTAGAATCTGGG + Intergenic
1164339446 19:24373533-24373555 ACACTGTTTTTGTAGAATCTAGG + Intergenic
1164339666 19:24377613-24377635 ACACTGTTTTTGTAGAATCTGGG + Intergenic
1164359444 19:27487163-27487185 ACACTGTTTTGGTAGAATCTAGG + Intergenic
1164360819 19:27506992-27507014 ACACTGTTCTTTTAGAATCTAGG + Intergenic
1164360922 19:27508687-27508709 CCACTGTTTTTTTAGAATCAAGG + Intergenic
1164361179 19:27512815-27512837 CCTCTGTTTTTGCAGAATCAAGG + Intergenic
1164361263 19:27514189-27514211 ACACTGTTTTTGTAGAATCTAGG + Intergenic
1164364114 19:27555086-27555108 ACACTGTTTTTCTAGAATCTGGG + Intergenic
1168488266 19:56783815-56783837 TCACTTTTATTTTAGAATCAGGG - Intronic
925014404 2:510822-510844 ACACAGTTCTTGAAGAAACAAGG - Intergenic
925429335 2:3777767-3777789 ACACTGTTCTTGCACATTCAAGG + Intronic
926122269 2:10249954-10249976 ACACTGTAATTACAGAATAAAGG - Intergenic
926648124 2:15312176-15312198 ATACTCACATTGAAGAATCAAGG - Intronic
928043699 2:27905627-27905649 ACATTGTTATTTTAGAATCAGGG + Intronic
928068770 2:28193741-28193763 AAACTGCTTTTGAAGGATCATGG - Intronic
928675865 2:33650535-33650557 ACACTCTTATTGAGTAGTCAAGG + Intergenic
930877319 2:56233395-56233417 ACATTTGTGTTGAAGAATCATGG + Intronic
930983468 2:57556097-57556119 CCAGTGATATTTAAGAATCATGG + Intergenic
931404826 2:61965876-61965898 TTACTGATATTGAAGTATCAAGG + Intronic
931509862 2:62979609-62979631 ATACTATTAATGAGGAATCATGG - Intronic
932449929 2:71802859-71802881 ACAGTGTTATGGAAAAATAAAGG - Intergenic
933592132 2:84244716-84244738 TCACAGCTGTTGAAGAATCAAGG + Intergenic
933622541 2:84559912-84559934 ACACTACTATAGAAGAATGATGG + Intronic
933882369 2:86682690-86682712 AAACTGTCATGAAAGAATCATGG - Intronic
933999404 2:87694832-87694854 ACAGTTTTATTGAAGTATAATGG - Intergenic
935096035 2:99945323-99945345 ACACTTTCCTTGAAGACTCATGG + Intronic
936294448 2:111256059-111256081 ACAGTTTTATTGAAGTATAATGG + Intergenic
936467266 2:112764595-112764617 AAACTGTCACTGAAGAGTCATGG - Exonic
936481380 2:112888271-112888293 ACACAATTATTGCAAAATCAAGG - Intergenic
936913300 2:117614679-117614701 ACATTCTTATTAAAGAATCAGGG + Intergenic
937797205 2:126037887-126037909 ATACTGACATTGAAAAATCAAGG + Intergenic
941290818 2:163672178-163672200 ACATTGTGATTGAAGAATGAGGG - Intronic
941944226 2:171076947-171076969 ACACTGGTACTCAAGAAACACGG + Intronic
942715739 2:178889933-178889955 ACACTGCTTTTGTAGAATTATGG - Intronic
942857221 2:180563590-180563612 ACACTGTTATTAATCAATGATGG + Intergenic
943037582 2:182766173-182766195 AAACTGTTGTTTAAGAATCCAGG + Intronic
946593012 2:221272397-221272419 ACACTGTTGTTCAGGAATCAAGG - Intergenic
948820418 2:240540766-240540788 AATCTGTTATTGAAACATCACGG - Intronic
1169057026 20:2631502-2631524 AAACTGTTCTTCAAGAATGAAGG - Intronic
1169841118 20:9938890-9938912 ACACTCTCATTGAAGAATTTTGG - Intergenic
1170196870 20:13698031-13698053 ACAATTTTATTGTAGAAACAGGG + Intergenic
1170234402 20:14086355-14086377 ACAATATTTTTGTAGAATCACGG - Intronic
1171182436 20:23100749-23100771 AGACTGATGTTGAAGAAGCAAGG + Intergenic
1171543206 20:25980966-25980988 ACACTCTTTTTGTAGAATCTAGG - Intergenic
1171846258 20:30277613-30277635 ACACTCTTTTTGTAGAATCTGGG - Intergenic
1172737587 20:37139375-37139397 ACAGTGTTATTGAAGACCCAGGG - Intronic
1175035962 20:56002433-56002455 ACACTGTAATTGGAGCATCCAGG + Intronic
1175340638 20:58227252-58227274 ACACAGTTGTTGAAGGATCTGGG + Intronic
1177006311 21:15676580-15676602 ACACTTATATTAAAAAATCAAGG - Intergenic
1177241905 21:18469141-18469163 AAACTGTAATTGAAAAATAAAGG - Intronic
1180114471 21:45690291-45690313 ACAGTGTTAGGCAAGAATCAAGG - Intronic
1180505005 22:15986155-15986177 ACACTGTTTTTGTAGTATCTAGG + Intergenic
1181691143 22:24561679-24561701 AAAATGTTATTGAACAAGCAAGG - Intronic
1181926432 22:26362820-26362842 AGACTGCTATTGAAGTATAAAGG + Intronic
1183173185 22:36202928-36202950 ACTCTGCTATTGAAGAAAAACGG + Intronic
1183677338 22:39306958-39306980 CCGCTGTTACTGAAGACTCACGG - Intergenic
1203333655 22_KI270739v1_random:35891-35913 ACACTGTTTTTGTAGTATCTAGG - Intergenic
952787466 3:37169830-37169852 ACACCTTCATTAAAGAATCATGG - Intronic
955510844 3:59678859-59678881 ACACATTTGTTGTAGAATCAGGG - Intergenic
955821039 3:62895804-62895826 ATACTTATCTTGAAGAATCAAGG - Intergenic
957461320 3:80524163-80524185 ACACTGCTAAGGAATAATCAGGG - Intergenic
957833842 3:85559732-85559754 GACTTGTTATTGAAGAATCATGG - Intronic
957901579 3:86500836-86500858 ACTCTATTATTCAAGAGTCATGG - Intergenic
958564353 3:95789144-95789166 ACACTGTGTTTGAAGAAACATGG - Intergenic
959141957 3:102496444-102496466 ACAATTTTAATGAAGAATAAAGG + Intergenic
961800578 3:129445558-129445580 TCACTGTTATTAAAGTATGAAGG + Intronic
961912506 3:130333956-130333978 ACACTGCTAGTGAAGAAGAATGG + Intergenic
963975658 3:151477267-151477289 AAACTGGGTTTGAAGAATCATGG - Intergenic
965860231 3:173140301-173140323 TCTCTGTTTTTGAAGCATCAGGG - Intronic
966504788 3:180687483-180687505 ACAATTTTATTTAAGAAACAGGG - Intronic
967674641 3:192281936-192281958 ACACTGTTATTGGAGATTTATGG - Intronic
967986138 3:195096688-195096710 ACACAGTTATTTAACAAGCAAGG + Intronic
969453566 4:7288416-7288438 ATACTGTTATTGAAGCCTCCTGG - Intronic
974165907 4:58201684-58201706 GCACTGTGATTGAAGCATCCTGG + Intergenic
974369866 4:61001472-61001494 AAACTGTTATTTAAAAATGAAGG + Intergenic
975815375 4:78211375-78211397 ATACTGTCATTGAAAAAGCAGGG + Intronic
976892204 4:90063495-90063517 ACATTTTTATTAAAGAATTATGG + Intergenic
976950552 4:90824569-90824591 ATTCTGTTATTAAAGTATCAAGG - Intronic
977262269 4:94812214-94812236 ATACTGTTATAGAAGAAGCAGGG + Intronic
978623941 4:110663412-110663434 AAACTGTTATTGAAAAAGCAAGG + Intergenic
979053260 4:115963287-115963309 ATACTGATTTTGTAGAATCAGGG + Intergenic
979617126 4:122756069-122756091 AAAATGTTCTTGAAGAATAATGG - Intergenic
980190428 4:129518154-129518176 ACACTGTTACTCAAGTATAAAGG - Intergenic
980398256 4:132244344-132244366 ACACTGTTAATGAAGATTCATGG - Intergenic
981697191 4:147570773-147570795 AAACTGTTCTTGCAGAAACAGGG + Intergenic
982226896 4:153174571-153174593 AAACTGTTCTGGAAGAATCCTGG - Intronic
982460636 4:155665630-155665652 ACACTGTTATTCAAGAAACAAGG - Intergenic
984510948 4:180678102-180678124 ACACAGTTATGGATAAATCATGG - Intergenic
984832069 4:183985062-183985084 AGACTTTTATTGAAGGACCATGG - Intronic
985868140 5:2532570-2532592 ACACTTTTATGGAAAAATCCTGG - Intergenic
985994297 5:3588210-3588232 CCACTGTTATAGAAAAATCTGGG - Intergenic
988217759 5:28298507-28298529 ACACAGTTATTTAAGAATAATGG - Intergenic
988994244 5:36699169-36699191 ACACTGATAATGAAGATACAAGG - Intergenic
989559075 5:42830319-42830341 GCACTGTTACTGAAAAACCAGGG - Intronic
989830665 5:45914635-45914657 ACACTCTTTTTGTAGAATCTGGG - Intergenic
989838127 5:46021526-46021548 ACACTGTTTTTGTGGAATCAGGG + Intergenic
989839067 5:46037293-46037315 ACACTATTTTTGTAGAATCTGGG + Intergenic
989839139 5:46038490-46038512 ACACAGTTTTTGTAGAATCTGGG + Intergenic
989840466 5:46060128-46060150 ACAATGTTTTTGTAGAATCTGGG + Intergenic
989847972 5:46170156-46170178 ACACTGTTTTGGTAGAATCTGGG + Intergenic
989850322 5:46200465-46200487 ACACTGTTTTTGTCGAATCTTGG - Intergenic
989853814 5:46252520-46252542 ACACTGTATTTGTAGAATCTAGG - Intergenic
989856112 5:46294391-46294413 ACACTGTTTTTGCAAAATCTGGG - Intergenic
990141378 5:52708127-52708149 TCAATGTCATTGAAGCATCAAGG + Intergenic
992821502 5:80501777-80501799 ACACTGTTATTTTAGGATCTTGG + Exonic
994675194 5:102812090-102812112 ACAGTGTTATTCAAAACTCAGGG - Intronic
994754211 5:103775092-103775114 ACACTTTTATTGAAAGATTAGGG + Intergenic
995016328 5:107313846-107313868 AAACTGTTCTTAAAGAAGCATGG + Intergenic
996768765 5:127063435-127063457 ACACAGTGTTTGAAGAATCCAGG - Intronic
998434653 5:142097217-142097239 GCACTGTTATGAAAGAATCGGGG - Intergenic
998724747 5:144997745-144997767 ACTCTGTTATTGTAGAACAAAGG + Intergenic
998905047 5:146895927-146895949 AATTTCTTATTGAAGAATCACGG - Intronic
999633071 5:153591708-153591730 ATACTGTTATTTAAGAAGCAAGG + Intronic
1000316663 5:160098970-160098992 AGACTGTACTTGAAGAATTAGGG - Intronic
1000725638 5:164767283-164767305 ACACTACTTGTGAAGAATCAAGG + Intergenic
1001328580 5:170746558-170746580 ACCCTGGTATTGCAGAGTCAGGG + Intergenic
1005204789 6:23390182-23390204 ACACTGTTATTGAATATTGAAGG + Intergenic
1005608020 6:27495187-27495209 ACACTGTTATTGAGATATTAAGG + Intergenic
1007361112 6:41356572-41356594 ACACTGTTCTTGATGAAGAAGGG + Intergenic
1008006585 6:46416438-46416460 ACATTGTTATTGTAGAATATTGG + Intronic
1008802041 6:55380315-55380337 CCACTATTAATGAAGAAACATGG + Intronic
1009254195 6:61355342-61355364 ACACTGTTTTTGTAGAATCTTGG + Intergenic
1009258881 6:61457163-61457185 ACACTGTTTTTGTAGAATCTTGG + Intergenic
1009259576 6:61467475-61467497 ACACTGTTTTTGTACAATCTTGG + Intergenic
1009261023 6:61488219-61488241 ACACCGTTTTTGTAGAATCTGGG - Intergenic
1010596891 6:77774901-77774923 ACACTGTTATTTAAGAATCCTGG - Intronic
1011741596 6:90366061-90366083 AGACTGTTGTTGAAGAGTAAAGG - Intergenic
1011967898 6:93182608-93182630 ACATTTCTATAGAAGAATCAAGG + Intergenic
1012308597 6:97691855-97691877 ACAATGTAATTTAAAAATCAAGG + Intergenic
1012455703 6:99402619-99402641 ACACTGATGATGAAGAATTACGG - Exonic
1013871904 6:114773843-114773865 AAACTGTTGTTGGAGATTCATGG + Intergenic
1014706175 6:124750316-124750338 ACACAGTTATGGAAGACTCAAGG - Intronic
1015456651 6:133434057-133434079 CCACTGTTAAAGAAGAATCCTGG + Intronic
1015814023 6:137189739-137189761 ACATTGTTATTAAAAAATCCTGG + Intergenic
1016727589 6:147392905-147392927 ACATTGTTATTAAAGGAACATGG - Intergenic
1019535201 7:1525526-1525548 ACATTGTTAATGAAAAAGCAAGG - Intergenic
1020723325 7:11777360-11777382 ACACTATTATGGCAAAATCATGG - Intronic
1023107045 7:36772843-36772865 GCAGTGTTATTGCAGAATCATGG - Intergenic
1023695659 7:42843620-42843642 ATACTGTTATTGAAGATTTTTGG - Intergenic
1025294598 7:57766059-57766081 ACACTCTTTTTGTAGAATCTAGG - Intergenic
1025522837 7:61761477-61761499 ACACTGTTTTTGTAGAATCTGGG - Intergenic
1025523987 7:61781444-61781466 ACACTGTTTTTGTAGAATCTGGG - Intergenic
1025524009 7:61781773-61781795 ACACTGTTTTTGTAGAATCTGGG - Intergenic
1025525322 7:61800714-61800736 ACACTGTTTTTGTAAAATCTGGG - Intergenic
1025525506 7:61804169-61804191 ACACTGTCTTTGCAGAATCTGGG - Intergenic
1025535510 7:61943161-61943183 ACACTGTTTTTGTAGAATCTGGG + Intergenic
1025546590 7:62180504-62180526 ACACTGTTTTTGTAGAATCTGGG - Intergenic
1025547347 7:62193648-62193670 ACACTGTTTTCGTAGAATCTGGG - Intergenic
1025547367 7:62193990-62194012 ACACTGTTTTTGTAGAATCTGGG - Intergenic
1025548704 7:62213281-62213303 ACACTGTTTTTGTAAAATCTGGG - Intergenic
1025548899 7:62216902-62216924 ACACTGTCTTTGCAGAATCTGGG - Intergenic
1025550528 7:62241573-62241595 ACACTGTTTTTGTACAATCTGGG + Intergenic
1025584641 7:62767807-62767829 ACACTGTTTTCGTAGAATCTGGG - Intergenic
1025585522 7:62780519-62780541 ACACTGATATCTTAGAATCAGGG + Intergenic
1025596834 7:62939685-62939707 ACACTGTTGTTGTAGAATCTGGG - Intergenic
1026116343 7:67498954-67498976 CGACTGTTATTGAAAAGTCAAGG + Intergenic
1028120775 7:87054511-87054533 ACACTGTTATTGAAGGAGTTAGG - Intronic
1028618533 7:92798610-92798632 CCACTCTTATTGATGAATGAGGG + Intronic
1028679961 7:93516060-93516082 ACACTGGTTTTGAATAATAATGG - Intronic
1030823669 7:114127260-114127282 ACACTCTTATGTAACAATCATGG + Intronic
1032065749 7:128768981-128769003 ACACTGTTATAGAAGAATTGGGG - Intronic
1032556702 7:132843450-132843472 TCAGTGTTTTTGAAGAATGATGG + Intronic
1033807002 7:144965724-144965746 ACACTCTTATTCAAGAAGGAAGG - Intergenic
1037635343 8:20696945-20696967 ACACTGTTGATGGTGAATCAGGG - Intergenic
1040117034 8:43633895-43633917 ACACAGTTTTTGTAGAATCTGGG + Intergenic
1040117051 8:43634067-43634089 ACACTCTTTTTGTAGAATCTGGG + Intergenic
1040123752 8:43712072-43712094 AAACTCTTTTTGAAGAATCTAGG + Intergenic
1040123783 8:43712590-43712612 ACACTTTTTTTGTAGAATCTGGG + Intergenic
1040124329 8:43719886-43719908 ACACTCTTCTTGCAGAATCTTGG + Intergenic
1040126350 8:43742049-43742071 ACACTGTTTTTGGAGTATCTGGG + Intergenic
1040274397 8:45999273-45999295 ACACTGTTTTTGTAGAATCTGGG + Intergenic
1040281941 8:46059367-46059389 ACACTCTTTTTGTAGAATCTGGG + Intergenic
1040283104 8:46078795-46078817 ACACTCTTTTTGTAGAATCTGGG + Intergenic
1040322092 8:46318474-46318496 ACACTTTTTTTGTAGAATCTTGG - Intergenic
1040327016 8:46352206-46352228 ACACTCTTTTTGTAGAATCTGGG - Intergenic
1040344464 8:46475629-46475651 ACACTGTTTTTGTAGGATCTGGG - Intergenic
1040768673 8:50947031-50947053 ACACGGTTAGTGAACATTCATGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1042017902 8:64337544-64337566 AGACTGTTATTGAACAATAAAGG - Intergenic
1043827348 8:84945518-84945540 AAACTGTCATTCAAGAATCCTGG - Intergenic
1044217745 8:89632693-89632715 ACACTGTTAAAAAAGAAACAAGG - Intergenic
1044924152 8:97195586-97195608 ACAGTGTTATTGAATCATCCTGG - Intergenic
1045479762 8:102582627-102582649 AAATGGTTCTTGAAGAATCAGGG + Intergenic
1045725233 8:105165093-105165115 ACACTGTTAAAAAAAAATCAAGG - Intronic
1046892052 8:119432889-119432911 ACTCTATTATTGATGGATCAAGG - Intergenic
1048226178 8:132588340-132588362 ACACTTTTATTTAAGAAGCCAGG - Intronic
1051242078 9:15068740-15068762 ACACTATTGTTGTAGAAACAAGG + Intergenic
1051333815 9:16048474-16048496 TCACTGTTACTGAAGTACCAGGG - Intronic
1051379945 9:16446730-16446752 AGACTGTTACTGAAGAAAAAAGG - Intronic
1051507909 9:17845725-17845747 ACAGAGTGATTGAAGAAGCAAGG + Intergenic
1052128739 9:24814098-24814120 ACACTTTAAATGAAGAGTCAAGG + Intergenic
1052266875 9:26584383-26584405 CCAGTTTTATTGAAGCATCATGG + Intergenic
1054362292 9:64186055-64186077 ACACTGTTTTTGTAGAATCTTGG + Intergenic
1054362986 9:64196368-64196390 ACACTGTTTTTGTACAATCTTGG + Intergenic
1054363875 9:64210276-64210298 ACACCGTTTTTGTAGAATCTGGG - Intergenic
1054964041 9:71001693-71001715 TCACTGTAACTGAAGAAACATGG + Intronic
1057218515 9:93243100-93243122 ACACTGCTCTTGTAGAATCCTGG - Intronic
1057380702 9:94564798-94564820 ACACTTTTATTTTAGATTCAGGG - Intronic
1057529298 9:95830240-95830262 ACACTGCTTAGGAAGAATCAGGG + Intergenic
1059789482 9:117624749-117624771 CCACAGTTATTACAGAATCAGGG + Intergenic
1062643234 9:137532950-137532972 ACACTGTTGTTGAGGATTCTGGG - Intronic
1062643307 9:137533288-137533310 ACACTGTTGTTGAGGATTCTGGG - Intronic
1186668478 X:11744289-11744311 CCACTGTTACTGAAGCACCAGGG + Intergenic
1189585447 X:42456407-42456429 CCACTGTAAGGGAAGAATCATGG + Intergenic
1191259072 X:58292787-58292809 ACACTCTTTTTGTAGAATCTGGG + Intergenic
1191259217 X:58295195-58295217 ACACTCTTCTTGTAGAATCTGGG + Intergenic
1191259584 X:58301209-58301231 ACCCTCTTTTTGAAGAATCTGGG + Intergenic
1191259713 X:58303067-58303089 ACACTCTTTTTGTAGAATCTGGG + Intergenic
1191262955 X:58348010-58348032 AAACTGTTTTTGTAGAATCTGGG + Intergenic
1191580219 X:62752812-62752834 ACACTCTTCTTGTAGAATCTGGG - Intergenic
1191581333 X:62764942-62764964 ACACTCTTCTTGTAGAATCTGGG - Intergenic
1193429960 X:81390060-81390082 ATACTGGTAGTGAAGAACCAGGG + Intergenic
1193573053 X:83167994-83168016 AAACAGTTATTTAAGAATAAAGG - Intergenic
1193835029 X:86332264-86332286 ACACTGTTATTGAAGAATCAAGG - Intronic
1193947129 X:87752314-87752336 AAACTGTTCTTTAAGAATGAAGG + Intergenic
1194842476 X:98761199-98761221 ACAATGGTATTGATAAATCATGG + Intergenic
1195527737 X:105911290-105911312 AAACTGATAATGAAGAATTATGG + Intronic
1195767615 X:108313128-108313150 TCACTGTAATTGAAGACTCCTGG - Intronic
1198408275 X:136338554-136338576 ACATTGTTAAGAAAGAATCAAGG - Intronic
1198996977 X:142584208-142584230 ATACTGTGATTGAAAAATGATGG + Intergenic
1199974716 X:152886574-152886596 ACACTTGTATGGCAGAATCAGGG - Intergenic
1200904746 Y:8470398-8470420 ACACTGTAAGTGAAGAGCCAAGG - Intergenic