ID: 1193836009

View in Genome Browser
Species Human (GRCh38)
Location X:86344788-86344810
Sequence CCCTAGGAGCAATGAGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193836009_1193836014 27 Left 1193836009 X:86344788-86344810 CCTTTGTCTCATTGCTCCTAGGG 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1193836014 X:86344838-86344860 TCTGGTTAACTTCTTTTTACAGG 0: 1
1: 0
2: 2
3: 24
4: 223
1193836009_1193836013 9 Left 1193836009 X:86344788-86344810 CCTTTGTCTCATTGCTCCTAGGG 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1193836013 X:86344820-86344842 ACATTTCACAACTTTCTCTCTGG 0: 1
1: 0
2: 2
3: 26
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193836009 Original CRISPR CCCTAGGAGCAATGAGACAA AGG (reversed) Intronic
901130628 1:6960716-6960738 CCCCAGGCACAATGACACAAAGG - Intronic
905324240 1:37139243-37139265 CCATAGGAGAAATGACACCAGGG + Intergenic
905584822 1:39107924-39107946 CCCTAGGGCCAATGGGAGAAGGG + Intronic
905800693 1:40840312-40840334 CCCTATGACCAAGGAGACATGGG + Exonic
908911799 1:69080053-69080075 ACCTAGGAGTAAGGAGACATCGG + Intergenic
914443018 1:147723466-147723488 CCCGAAGGACAATGAGACAAGGG - Intergenic
914979312 1:152398769-152398791 TCCTAGGAGCCCTGAGACCAAGG - Intergenic
917765461 1:178211746-178211768 CCCTATGGGGAATGAGAGAAAGG - Intronic
918744110 1:188177350-188177372 CCCTAGCAGAAATGAGGCCATGG - Intergenic
920223343 1:204420506-204420528 CCCAAGGAGAAAAGAAACAAAGG - Intergenic
921556782 1:216608329-216608351 CCCCAAAAGCAATGAGACCAGGG - Intronic
924199880 1:241647588-241647610 CACTAGAAGCAAAAAGACAATGG + Intronic
1065444892 10:25788204-25788226 CCCTAGGAGATTTGAGGCAATGG + Intergenic
1067266257 10:44748084-44748106 CCCCTGGTGCAATGAGGCAACGG - Intergenic
1071333745 10:84585343-84585365 CCCAAGGAGCACAGAGCCAAAGG + Intergenic
1072008534 10:91282614-91282636 CCCAAGGAGAAATGGTACAAGGG - Exonic
1074848924 10:117422949-117422971 CCATAGGAACAATGAAACCAGGG - Intergenic
1075231802 10:120686380-120686402 CCCTGGCTGCAATGAGAAAATGG - Intergenic
1076165559 10:128279656-128279678 GCCCAGGGGCAATGATACAAGGG - Intergenic
1076510904 10:131012950-131012972 ACCTAGGATCAATGAGATGATGG - Intergenic
1078562346 11:12384078-12384100 CCTTATGAGCAAGGAGAGAAGGG - Intronic
1078908123 11:15706358-15706380 CCCTCGGACCAGTGAGAAAAGGG - Intergenic
1080880626 11:36316706-36316728 CCCTAGGAGCAATTTGGGAAGGG + Intronic
1080937647 11:36881101-36881123 TCCTGTGAGCATTGAGACAATGG + Intergenic
1084920207 11:72463305-72463327 CCCTAGGACCTTTGAGAAAATGG - Intergenic
1091668367 12:2435434-2435456 CCCTGAGAGCACTGGGACAAAGG - Intronic
1091984650 12:4899239-4899261 CCCTAGGAATAATGAGAAGAGGG - Intergenic
1095840628 12:46687832-46687854 CCATAAAAGCAATGAGACCAAGG + Intergenic
1096156496 12:49344312-49344334 CCCAAGGAACAACAAGACAAAGG - Intergenic
1096321585 12:50618848-50618870 CCATGGGAGCAAGGAGAGAATGG - Intronic
1098944818 12:76578184-76578206 CTCTAAGATAAATGAGACAAGGG + Intergenic
1099068597 12:78016188-78016210 ACCTAGGAGCAATGAGATCTTGG - Intronic
1101830016 12:108249696-108249718 CCCAAGTAGCAAAGAGACCATGG + Exonic
1103797351 12:123513482-123513504 CCGTAGGAGCTATGAGACCGAGG + Intronic
1108030494 13:46224159-46224181 TCCCAGGGGCAAAGAGACAAAGG - Intronic
1108469623 13:50755099-50755121 TCTTAAGAGCTATGAGACAAAGG - Intronic
1117162366 14:53002059-53002081 CCCTAGGCCCAAAGGGACAAGGG + Intergenic
1119031741 14:71198002-71198024 CCATAGGACCAATTAGAGAATGG + Intergenic
1126161855 15:45621050-45621072 CCCTAGTAGGAAGGATACAAGGG + Intronic
1128889283 15:71316577-71316599 CCCTAGCAGCAATGGGCCTAAGG - Intronic
1130363309 15:83209689-83209711 CCCCAGGAGAGATAAGACAAGGG + Intergenic
1132689033 16:1174284-1174306 CTCCAGGAGAAATGAGAGAAAGG - Intronic
1134414787 16:14034044-14034066 CCCTAGGAGCTCTGGGAGAAGGG - Intergenic
1138714807 16:59008810-59008832 ACCTAGGAGCAGTGTGACCAAGG - Intergenic
1140558496 16:75948766-75948788 GCCTAGGAGGTATGAGACACAGG + Intergenic
1141747839 16:85938036-85938058 CTCTATGAGCAAGGAGAAAAGGG - Intergenic
1145959557 17:28879536-28879558 CCATTGGAGCAAGGAGACAGAGG + Exonic
1149306376 17:55350722-55350744 CCATAAAAGCAATGAGACATTGG + Intergenic
1151243708 17:72778204-72778226 CCATGGGATAAATGAGACAATGG - Intronic
1158768683 18:60487727-60487749 CTCTATAAGCACTGAGACAAAGG + Intergenic
1158855205 18:61536876-61536898 CCCAAGGAGCTATGAGGAAAAGG + Intronic
1158980837 18:62759982-62760004 CCCAAGGGGCAAAGAGACACAGG - Intronic
1161883812 19:6977323-6977345 CAAGAGGTGCAATGAGACAAGGG - Intergenic
1162302024 19:9849693-9849715 CCTGAGGAGAAATGAGACACAGG - Intergenic
1163754632 19:19099337-19099359 CCCTGGGAGCACTGAGGAAAAGG + Intronic
929484583 2:42342303-42342325 CCCTAGGAGAGCTGAGACGAGGG + Intronic
932960366 2:76406373-76406395 GCCTGGGAGCCATGGGACAAAGG + Intergenic
933747146 2:85579569-85579591 CTCTAGGAGCTGTTAGACAAGGG + Intronic
938287199 2:130128372-130128394 CCGAAGGAGCAAGGAGACCATGG + Intronic
938428396 2:131210498-131210520 CCGAAGGAGCAAGGAGACCATGG - Intronic
938469297 2:131544500-131544522 CCGAAGGAGCAAGGAGACCATGG - Intergenic
940358807 2:152775036-152775058 CCTTAGGAACAATAAGAGAAGGG + Intergenic
945146984 2:206748549-206748571 CCATAGGAGCACAGACACAAAGG - Intronic
947979782 2:234399027-234399049 CCCTCGGAGCACTGAGGCAGAGG - Intergenic
948269917 2:236666377-236666399 TCCCAGGAGTAATGAGACAATGG - Intergenic
1168956456 20:1837716-1837738 CCCTCTGAGCAATGGGAAAAGGG + Intergenic
1174545781 20:51324153-51324175 CCCTAGGAGGTTTGAGAAAAGGG - Intergenic
1178025964 21:28467251-28467273 CCTTAAGAGAAATGAGACTAAGG + Intergenic
1181576147 22:23796482-23796504 CCCAAGGAGCATTAAGAAAAAGG + Intronic
1182067214 22:27439085-27439107 CCCAAGGAGCAAGGAAACCAGGG + Intergenic
952471464 3:33657854-33657876 CCCTAGGGGCTATGAGAGATAGG - Intronic
952734417 3:36674620-36674642 CCCCAGGAGCAATTTGAGAAGGG + Intergenic
955841010 3:63112803-63112825 CCCTGGTAGAGATGAGACAAAGG - Intergenic
961562740 3:127741649-127741671 CCTTGGGAACCATGAGACAAGGG - Intronic
964159998 3:153635384-153635406 CCCAAAGACCAATAAGACAAAGG + Intergenic
980306264 4:131064960-131064982 CCCTAGCAGAGATGAGACACTGG + Intergenic
980626620 4:135381530-135381552 CCCCAGGAGCAATGAGAGGAGGG - Intergenic
981927483 4:150155753-150155775 CCCTAGGAGCAATGGGAAGAGGG + Intronic
983728446 4:170961421-170961443 TCAGAGGAGCAAAGAGACAAAGG + Intergenic
985201384 4:187488656-187488678 CCCGAGGACCAAGGAGAAAATGG + Intergenic
987700940 5:21397442-21397464 CTTTAGGAGAAATGAGATAAGGG + Intergenic
988006649 5:25420864-25420886 CTTTAGGAGCAATAACACAATGG - Intergenic
994206777 5:97044347-97044369 CCCTAGGGTCTGTGAGACAAGGG + Intergenic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1000205457 5:159053846-159053868 CCTTAGGAGCAAATATACAATGG - Intronic
1004933263 6:20482428-20482450 ACCTGGGAGCCATGAGGCAAGGG + Intronic
1006297538 6:33176625-33176647 CCATATGAATAATGAGACAAGGG + Intronic
1007072910 6:39049460-39049482 CCCCAGGAGCCATGAATCAAAGG - Intronic
1012750205 6:103152127-103152149 CCATAGCAGCAAAGAGACATAGG + Intergenic
1018176882 6:161184767-161184789 GCCTAGGAGCAATGAGAGCTTGG + Intronic
1020660553 7:10975868-10975890 CCCTAGCAGGAAAAAGACAAGGG - Intronic
1020714115 7:11648348-11648370 CCTTATGAGCCATGAGTCAAGGG + Intronic
1021781285 7:24109176-24109198 GCCTAGGACCCATGAGACAAAGG - Intergenic
1025923451 7:65936931-65936953 CCCTGGAAGAAATGAGAGAAGGG - Intronic
1030961787 7:115932107-115932129 GCCTAGGAGAAGTGACACAAAGG + Intergenic
1034929767 7:155152779-155152801 CCCAAGGACCAGTGAGATAATGG - Intergenic
1034929784 7:155152858-155152880 CCCAAGGACCAGTGAGATAATGG - Intergenic
1034929800 7:155152934-155152956 CCCAAGGACCAGTGAGATAATGG - Intergenic
1034929830 7:155153086-155153108 CCCAAGGACCAGTGAGATAATGG - Intergenic
1034929862 7:155153241-155153263 CCCAAGGACCAGTGAGATAATGG - Intergenic
1038886283 8:31666331-31666353 GCCTTGGAGCAATGAGTCATTGG - Intronic
1039698619 8:39939930-39939952 CCCAAGGAGAAATTAGAAAAAGG - Intronic
1041992986 8:64016990-64017012 CCCTAGGAGGAACAAGACACTGG + Intergenic
1042351788 8:67784329-67784351 CCCCACTAGCATTGAGACAAAGG + Intergenic
1042719650 8:71813531-71813553 TCCCAGGACTAATGAGACAAGGG + Intergenic
1042883379 8:73520027-73520049 CCCTATGAGCAATGAGAGAATGG + Intronic
1051489473 9:17645701-17645723 CCCTAGGAGCCAGAAGACAGTGG - Intronic
1051945954 9:22570272-22570294 CCCTAGGAGCCATTAGAGAGTGG + Intergenic
1053560916 9:39193274-39193296 CCCTAGGAGAAAACAGAGAAAGG + Exonic
1053825019 9:42013524-42013546 CCCTAGGAGAAAACAGAGAAAGG + Exonic
1054136203 9:61425681-61425703 CCCTAGGAGAAAACAGAGAAAGG - Intergenic
1054605551 9:67173839-67173861 CCCTAGGAGAAAACAGAGAAAGG - Intergenic
1055723703 9:79204438-79204460 CCCTTGGAGCATCCAGACAATGG - Intergenic
1056243526 9:84670983-84671005 CCCTAGGGGCAAGGAGAAAAAGG - Intronic
1056531606 9:87492990-87493012 CCCTAGGCTCAAAAAGACAAAGG + Intergenic
1056822866 9:89855776-89855798 GACTATGAGCAAGGAGACAAAGG + Intergenic
1056953832 9:91066796-91066818 CCCTCGAAGCCATGAGACACTGG - Intergenic
1058731118 9:107850812-107850834 CCCGAGTAGCAATGAGAATAGGG - Intergenic
1185521847 X:746146-746168 CCCTAGCAGCTATGAGTCTATGG + Intergenic
1187057862 X:15757925-15757947 GCGTAGGAGCAATGTGACAAAGG + Intronic
1188320603 X:28732457-28732479 CCCTCGAAGAAATAAGACAAAGG - Intronic
1188946608 X:36312849-36312871 CCTGAGGAGATATGAGACAAAGG + Intronic
1189206318 X:39242314-39242336 ACCCAGGAGAAATGTGACAAGGG + Intergenic
1193836009 X:86344788-86344810 CCCTAGGAGCAATGAGACAAAGG - Intronic
1195461170 X:105126404-105126426 CCTTATGAGCAATGAGTCATGGG - Intronic
1195918751 X:109961599-109961621 CCCTAGGAGCAAGGAGACCTGGG - Intergenic
1196276419 X:113770815-113770837 CCCTTGGAGGAATGAGATATAGG + Intergenic
1196974819 X:121147820-121147842 CCCTTATAGCAATGAGAAAAAGG - Intergenic
1197027946 X:121778114-121778136 TTCTAAGAGCAGTGAGACAAAGG - Intergenic
1198196006 X:134363272-134363294 CCCTTGGAGCAATGCAACAATGG + Intergenic
1200206552 X:154320547-154320569 CCCTAGGAGCTATGAGTTGAGGG + Intronic
1200987893 Y:9323801-9323823 CGGTAGGAGCAATGTGACAGAGG - Intergenic
1202109144 Y:21403725-21403747 CGGTAGGAGCAATGTGACAGAGG - Intergenic
1202120130 Y:21512394-21512416 CGGTAGGAGCAATGTGACAGAGG + Intronic
1202122581 Y:21535935-21535957 CGGTAGGAGCAATGTGACAGAGG + Intronic
1202156424 Y:21893448-21893470 CGGTAGGAGCAATGTGACAGAGG - Intronic
1202158872 Y:21916989-21917011 CGGTAGGAGCAATGTGACAGAGG - Intronic
1202185323 Y:22181904-22181926 CGGTAGGAGCAATGTGACAGAGG - Intronic
1202197541 Y:22309881-22309903 CGGTAGGAGCAATGTGACAGAGG + Intronic
1202206037 Y:22404491-22404513 CGGTAGGAGCAATGTGACAGAGG + Intronic