ID: 1193836177

View in Genome Browser
Species Human (GRCh38)
Location X:86347370-86347392
Sequence GCAAGTGCACCCATGTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193836177 Original CRISPR GCAAGTGCACCCATGTGCTG AGG (reversed) Intronic
900502713 1:3014360-3014382 GCCGATGCACCCATGTCCTGGGG - Intergenic
900576032 1:3382868-3382890 AGAAGTGGACCCATGGGCTGGGG + Intronic
900603652 1:3514488-3514510 GAAAGCGCACCCAGGTGCTGTGG - Intronic
901176461 1:7302952-7302974 GGAAGGGTACCCAGGTGCTGTGG + Intronic
902180598 1:14685453-14685475 CAATGTGCACCCATGTACTGAGG + Intronic
903885658 1:26539748-26539770 CCACGTGCACCTAGGTGCTGAGG - Intronic
907299514 1:53477780-53477802 GCCAGCGCTCCCATGTGCTCAGG - Intergenic
910956285 1:92710042-92710064 GGCAGTGCACCCATGTGATCTGG - Intronic
912181875 1:107228860-107228882 GCAAGACAAGCCATGTGCTGTGG + Intronic
920198563 1:204245316-204245338 ACAAGTGGGCCCATGTGCTTGGG + Intronic
920758018 1:208753808-208753830 GCAAGTGCAGCCAAGTTCTGGGG + Intergenic
921553513 1:216568561-216568583 TAAAGAGCACCTATGTGCTGGGG + Intronic
923104127 1:230841353-230841375 GCACGTGCAGCCATCTGCCGAGG + Intronic
1064805896 10:19132108-19132130 GTAAGTGCACCCATCTTCAGGGG + Intronic
1065442391 10:25766355-25766377 GTAAGAGCATCCATGTGCAGGGG - Intergenic
1065839279 10:29687556-29687578 GGTAGTGCACACTTGTGCTGAGG + Intronic
1069930605 10:71878994-71879016 CCAGGTGCAGCCATGTGCGGTGG - Intergenic
1072539095 10:96384821-96384843 GCAGGTGCAGCAGTGTGCTGGGG - Intronic
1075776642 10:124993388-124993410 CCAAGAGCTCCCTTGTGCTGAGG - Intronic
1076761705 10:132608985-132609007 GCCAGTGCTCCCATGTGGTGAGG + Intronic
1077104609 11:836732-836754 ACAAGGGCACCCTTGTTCTGAGG - Intronic
1077155975 11:1091017-1091039 GCATGTGCACCCATGTGGAACGG - Intergenic
1077544374 11:3162906-3162928 GGGAGTGCACCAGTGTGCTGGGG - Intronic
1079090105 11:17474971-17474993 GGAAATGAAGCCATGTGCTGTGG + Exonic
1082809354 11:57469504-57469526 GCAAGAGCACCCATCTCCTAGGG + Intronic
1086091290 11:83007727-83007749 GCACCTGCTCCCAGGTGCTGTGG - Intronic
1086772239 11:90780833-90780855 GCATGTGCACACATGTGATACGG - Intergenic
1088563824 11:111146180-111146202 GCTAGAGCACCCATGTCCTGGGG - Intergenic
1089395197 11:118132092-118132114 GAAAGTGAACACATGTGCTTAGG - Intergenic
1090953434 11:131494501-131494523 CCAATTGAACCCATTTGCTGGGG + Intronic
1101111578 12:101491665-101491687 GCATGTGCACCCACCTGCTAAGG + Intergenic
1103894574 12:124264530-124264552 GCAACTGACCCCATGTGGTGTGG - Intronic
1104112491 12:125716963-125716985 GCAAGTGCACTGATTTGCTGGGG + Intergenic
1105770861 13:23610559-23610581 GCAAGGGCTCCCATGTGGTGAGG - Intronic
1105777602 13:23677903-23677925 ACAAGTGGACTCCTGTGCTGCGG - Intergenic
1106321330 13:28642141-28642163 GAAAGTGCATCCATGAGATGGGG + Intergenic
1107792223 13:44014083-44014105 TCAAGTGCACAGATGTGCTTAGG - Intergenic
1108104687 13:46996484-46996506 GTGTGTGCACCCATGTGCAGAGG + Intergenic
1110406034 13:75151491-75151513 GCAAGAGCACACAGGAGCTGGGG + Intergenic
1111124098 13:83890627-83890649 GCCATAGCACCCATCTGCTGAGG - Intergenic
1112731912 13:102372575-102372597 CCATGTTTACCCATGTGCTGTGG + Intronic
1113864125 13:113509847-113509869 GGAAGTGCACCCAGGCCCTGTGG - Intronic
1118297194 14:64581391-64581413 GCCAGTGGACCCATTTGGTGGGG + Intronic
1120347441 14:83308582-83308604 GCCAGGGGACCCATGTGCTGCGG + Intergenic
1122577544 14:102751560-102751582 GGAACTGCACCCTGGTGCTGCGG + Intergenic
1125513857 15:40307263-40307285 GAAAGTGCACCCCAGAGCTGAGG - Intronic
1127169134 15:56280882-56280904 GTAATTTCAACCATGTGCTGGGG + Intronic
1129725139 15:77897827-77897849 CCAGGTGCAGCCCTGTGCTGCGG - Intergenic
1132285327 15:100658401-100658423 ACAGGGGCACCCATGTGCGGCGG - Intergenic
1134419077 16:14069972-14069994 GCAAGGGCACCCACATGCTCTGG + Intergenic
1135726253 16:24856059-24856081 TCCAGTGCACACATGTGCTCTGG - Intronic
1139517492 16:67460410-67460432 GCCAGTGCACACATCTGCTTTGG - Intronic
1142533230 17:596555-596577 GCAAGAGGACCCGGGTGCTGTGG - Intronic
1146544389 17:33725679-33725701 GCAATTGCATCCATATGCTGAGG - Intronic
1148876595 17:50690945-50690967 GCAAGTGTGCACATGTGGTGCGG + Intronic
1148883873 17:50757167-50757189 CCGAGTGCTCCTATGTGCTGTGG + Intergenic
1149140821 17:53430721-53430743 GCAAGTGCAACTAAGTGCTAAGG - Intergenic
1149252187 17:54783250-54783272 TCATGTGCACGCATGTGCTCAGG - Intergenic
1149806969 17:59627350-59627372 GCAAGAGAACCCTTGTGCTTAGG + Intronic
1150216714 17:63475513-63475535 AGAAGTGCACCCATGTCCTCTGG + Intergenic
1151236397 17:72722921-72722943 GAAAGTGCAGCCAGGTGCAGTGG - Intronic
1156586312 18:38434842-38434864 GCAAGTGCAGCCTTGGGATGTGG - Intergenic
1157131205 18:45009018-45009040 GCAATTGCCACCGTGTGCTGTGG + Intronic
1159136319 18:64341223-64341245 GCAAACTCAACCATGTGCTGGGG - Intergenic
1160263900 18:77321983-77322005 GCACGCGCACACGTGTGCTGGGG + Intergenic
1164890702 19:31820854-31820876 GCAGGTTCATCCATGTGCTAGGG + Intergenic
1164924068 19:32112894-32112916 GCAAGTGAATCCATGTATTGAGG - Intergenic
1165447473 19:35864521-35864543 GTAAGAGCACCCAAGAGCTGGGG - Intronic
1166118696 19:40671763-40671785 GCCAGTGAACCCATGTGGTCTGG - Intronic
925082368 2:1080436-1080458 GCAAGTGTATCAATATGCTGAGG - Intronic
925379075 2:3411872-3411894 GCCAGTGCACTCAGGTGCTGTGG - Intronic
925923695 2:8655380-8655402 GCCAGTGCAACCAGGTGGTGTGG - Intergenic
927668227 2:25046865-25046887 GCACATGCGCACATGTGCTGTGG - Intronic
928914584 2:36457476-36457498 GCAAGTGCAGCCCTGCCCTGGGG - Intronic
929069807 2:38018859-38018881 GCATGTGCACCCATGTATTTGGG - Intronic
932775427 2:74525484-74525506 GCAAGAGCACCCAGGTGTGGTGG - Exonic
934157257 2:89214973-89214995 GAAAGTGCACCCGTGTTGTGGGG + Intergenic
934210057 2:89967771-89967793 GAAAGTGCACCCGTGTTGTGGGG - Intergenic
938789002 2:134660115-134660137 GCAAGTGCTCCTATGAGGTGGGG + Intronic
938824408 2:134990905-134990927 GCTACTGCAGCCATGTGCGGTGG + Intronic
940577081 2:155522608-155522630 GAAAATGCAGCCATTTGCTGAGG + Intergenic
941006235 2:160250042-160250064 GCAAGAGCAAGGATGTGCTGGGG - Intronic
941619573 2:167761283-167761305 GCAACTGCAGCAATGTTCTGAGG - Intergenic
943773981 2:191745412-191745434 GCAAGAGAGCTCATGTGCTGGGG + Intergenic
944118188 2:196211420-196211442 GGAAGTGCAGTCATGTGCTCAGG + Intronic
944285134 2:197941243-197941265 GCAAGTGCCCCCATGCACTGAGG + Intronic
948334719 2:237198959-237198981 GAGAGTGGACCCAAGTGCTGAGG - Intergenic
1171243131 20:23587462-23587484 GCAGGTACACCCCTGTGGTGTGG + Intergenic
1174466858 20:50724519-50724541 GCAAGTGCACCAATGTGGGGTGG - Intergenic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175975245 20:62707676-62707698 GCCAGTGCCACCAGGTGCTGGGG + Intergenic
1178919087 21:36726833-36726855 GACAGGGCACCCATGAGCTGTGG - Intronic
1179470350 21:41606047-41606069 GCAAATGGCCCCATGTGCTGAGG + Intergenic
1182228055 22:28815372-28815394 ACACGTGTTCCCATGTGCTGAGG - Intergenic
1182414508 22:30212504-30212526 GCAAGTGCCTCCCTCTGCTGAGG - Intergenic
1182920461 22:34074527-34074549 TCAGGTGCGCCCAGGTGCTGGGG + Intergenic
1183351008 22:37334795-37334817 GCGAGTGCACCCAGGTATTGGGG + Intergenic
1184627501 22:45748052-45748074 GCCAGTGCTCCCAGGTGCTTGGG + Intronic
949255000 3:2035543-2035565 GTGTGTGCACACATGTGCTGAGG - Intergenic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
958688188 3:97426324-97426346 GCAAGAGCAAGCATGTGCAGGGG + Intronic
961074338 3:123967706-123967728 GCAGGTGCAGCCCAGTGCTGTGG + Intergenic
961435041 3:126911154-126911176 GCCAGTCCTCCCAGGTGCTGTGG - Intronic
969317172 4:6389291-6389313 GCAAGTCCCCCGACGTGCTGGGG - Intronic
978556695 4:109988710-109988732 GTAAGAGGACACATGTGCTGGGG + Intronic
980325511 4:131339841-131339863 TCAAGTGCACACATCTCCTGGGG - Intergenic
982528995 4:156514947-156514969 GCAAATGCACCCATGTCATATGG - Intergenic
983810063 4:172050602-172050624 GCCAGTGGACCCATTTGGTGTGG + Intronic
985111748 4:186553993-186554015 CCTAGTGCAGCCTTGTGCTGTGG - Intronic
986531735 5:8744129-8744151 GCAAATGCACCACTGTGGTGTGG - Intergenic
988991164 5:36672294-36672316 GCAAGAGAACCCATGTGTTGTGG + Intronic
991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG + Intergenic
994013651 5:94938913-94938935 GCACATGCACCCTTGTGCAGAGG - Intronic
994811864 5:104529478-104529500 TCAAGTGTACCCATTTGTTGAGG - Intergenic
995280694 5:110332436-110332458 GCAAGTGAAACTATGTGTTGAGG - Intronic
997656570 5:135559546-135559568 TCATGTGCACCCAAGTCCTGTGG + Intergenic
1000001038 5:157139400-157139422 GGAAGTGCACTCACTTGCTGTGG + Exonic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1014189281 6:118474452-118474474 GCAAGTGCAACCAAGAGATGGGG + Intronic
1017073033 6:150593384-150593406 GAAAATGCACACATGTGCTCTGG - Intergenic
1020241109 7:6395946-6395968 GAAAGTGGACCCATCTGTTGTGG + Intronic
1024898752 7:54293052-54293074 GAAAGAGCACCCAAGTGGTGGGG + Intergenic
1027187658 7:75981611-75981633 GCAAGTGCCCGCAGGTGCGGTGG + Intronic
1027842004 7:83324724-83324746 ACAAGTGCACCCATGAGGTCAGG - Intergenic
1028156665 7:87437392-87437414 GTAAATGCAGCCATGTGCTCAGG + Intronic
1034058509 7:148063416-148063438 GAAAGAGCACCAATGAGCTGTGG - Intronic
1035849378 8:2900104-2900126 ACAAATGCACCCCTCTGCTGAGG + Intergenic
1036201532 8:6774715-6774737 GCGTGTGCACCTGTGTGCTGAGG - Intergenic
1036288502 8:7465850-7465872 GAAATTGCACACATGTGCAGGGG + Intergenic
1036332973 8:7845678-7845700 GAAATTGCACACATGTGCAGGGG - Intergenic
1038055969 8:23858045-23858067 CCAAGTGCGCCCAAGTGCAGTGG + Intergenic
1039793797 8:40895829-40895851 GCAAGATCCCCCACGTGCTGGGG + Intronic
1045350361 8:101332755-101332777 GCAAATGGACACATCTGCTGAGG + Intergenic
1046607306 8:116385877-116385899 GTAAGTGCAGCCATATTCTGAGG - Intergenic
1048454819 8:134568046-134568068 GTGTGTGCACTCATGTGCTGGGG - Intronic
1049018759 8:139939685-139939707 GCAAGTGCTCCCACCTTCTGTGG + Intronic
1049537931 8:143190610-143190632 TCAAGTGCTCCCATCTGCAGTGG - Intergenic
1050291839 9:4163222-4163244 GCATGTGCACGCATGTGCACTGG + Intronic
1057067615 9:92070526-92070548 GCAAGTGCAAGAAAGTGCTGAGG - Intronic
1057141737 9:92730603-92730625 GGAAGAGCACACATGTGCTATGG + Intronic
1057630334 9:96714913-96714935 GCAAGTGCACAGATGTGCCTAGG + Intergenic
1060416607 9:123435134-123435156 GCAGGTGCTCCCATGTTCTCAGG - Intronic
1060753251 9:126189079-126189101 GCTAATGCACCCATTTCCTGAGG - Intergenic
1062119668 9:134827539-134827561 GCAAGGCCACCCATTTGCAGAGG - Intronic
1062524609 9:136973196-136973218 GCAAGGGCTGCCAGGTGCTGTGG - Intergenic
1062643560 9:137534364-137534386 GGAAGTGCACCCATCTGGAGTGG - Intronic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1198822206 X:140660415-140660437 GCAAGTCCTCTCAGGTGCTGGGG - Intergenic
1199268221 X:145851969-145851991 GAAAATGCACCCTTGTGTTGTGG - Intergenic
1199849024 X:151712058-151712080 CCAGGTGCACCCATTTGCTTGGG + Intergenic