ID: 1193837601

View in Genome Browser
Species Human (GRCh38)
Location X:86364584-86364606
Sequence GAGGAGAAGCATGATGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193837597_1193837601 5 Left 1193837597 X:86364556-86364578 CCTAAACAAGGGGTGACCTTAGA 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1193837601 X:86364584-86364606 GAGGAGAAGCATGATGTGATGGG 0: 1
1: 0
2: 3
3: 22
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193837601 Original CRISPR GAGGAGAAGCATGATGTGAT GGG Intronic
900010431 1:102362-102384 GAGGAGAAAAATGATGTCACTGG - Intergenic
900026536 1:278927-278949 GAGGAGAAAAATGATGTCACTGG - Intergenic
900036322 1:412770-412792 GAGGAGAAAAATGATGTCACTGG - Intergenic
900057950 1:648525-648547 GAGGAGAAAAATGATGTCACTGG - Intergenic
900405145 1:2489731-2489753 GAGGAGGTGCATGATGGGAGGGG - Intronic
900885122 1:5409766-5409788 GAAGAGGAGCACGATGTGCTGGG + Intergenic
904341941 1:29841177-29841199 GAGGAGAAGCATAAGGTGATTGG - Intergenic
904636357 1:31884585-31884607 GAGGAGAAGCCTACTGTGGTCGG + Intergenic
904833824 1:33322268-33322290 GAGGAGGAGGATGCTGAGATTGG - Intergenic
904970170 1:34413339-34413361 GAGGAGAAGAATTTTGGGATGGG - Intergenic
905543779 1:38781505-38781527 GAGGAGGAGCATGTTGGGGTGGG - Intergenic
906078840 1:43070380-43070402 GAGGAGAGGCCTGTGGTGATGGG - Intergenic
907822133 1:57980546-57980568 GTGGAGAAGCAACATGGGATAGG - Intronic
908110807 1:60895543-60895565 GTGGAGAAGCATGGGGGGATGGG - Intronic
908978883 1:69929861-69929883 GAGTAGAAAGATGATGTAATGGG - Intronic
909129916 1:71721967-71721989 GAAGAGAAGCATGAGATGAGTGG + Intronic
909391847 1:75129027-75129049 GAGGTGAAGGAGGATGTGGTAGG + Intronic
911992965 1:104725977-104725999 AAGGAGAAGCTTCATGTCATTGG + Intergenic
912012322 1:104982557-104982579 GAGTAGCCGCATGATTTGATTGG - Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916485321 1:165253696-165253718 GAGGAGAAGCATATCGAGATAGG - Intronic
916572041 1:166036579-166036601 GAAGAGAAGCAGGATGTAGTAGG - Intergenic
917605496 1:176624590-176624612 GGGAAGAAGCTTGATGTGTTTGG - Intronic
918447754 1:184631995-184632017 GATTAGTAACATGATGTGATCGG - Intergenic
918477246 1:184938014-184938036 GAGGCAAAGGATGAGGTGATTGG + Intronic
919127902 1:193418346-193418368 GAAGAGAAGCAGGATCTGACTGG + Intergenic
921411908 1:214845053-214845075 GAGGAAAAGCATGATCTGATTGG - Intergenic
922059879 1:222078384-222078406 CAGGGGATGCTTGATGTGATAGG + Intergenic
922258870 1:223918368-223918390 GAGGAGAAAAATGATGTCACTGG - Intergenic
922425837 1:225491841-225491863 AAGGAGATGGATGATGTTATAGG - Exonic
922899166 1:229123046-229123068 GAGCAGAGGAATGATGTGGTCGG + Intergenic
923119747 1:230978932-230978954 GGGGAGAAGCATTGTGTGCTGGG + Intergenic
923254621 1:232210976-232210998 GAGGAGAAGCACAGTGTGGTTGG + Intergenic
923538488 1:234871224-234871246 AAGAAAAAGCATGATGTGGTGGG - Intergenic
924340059 1:243021117-243021139 GAGGAGAAAAATGATGTCACTGG - Intergenic
1065017602 10:21476239-21476261 CAGGAGATGAAAGATGTGATGGG + Intergenic
1065173376 10:23053813-23053835 GAGGAAAGGCATGATGGGAGAGG + Intergenic
1065972079 10:30813568-30813590 GAGAAGAAGCAAGGTGTGTTTGG - Intergenic
1066747056 10:38611109-38611131 GAATACAAGAATGATGTGATTGG + Intergenic
1068866018 10:61896829-61896851 GAGGAAAATCAAGATGAGATAGG + Intergenic
1069508010 10:69018977-69018999 GGGAAGCAGCATGATCTGATTGG + Intergenic
1069923478 10:71832042-71832064 GTGGAGAACCAGGATGTGACAGG - Intronic
1070546662 10:77457976-77457998 GAGCAAGAGCATGATTTGATGGG - Intronic
1071592309 10:86886418-86886440 TAGTAGAGGCATGATGTGATGGG + Intronic
1071854847 10:89613830-89613852 TAGGAGCAGCATGTTGTAATAGG + Intronic
1073955332 10:108864322-108864344 GATGAGAAGCGTGGTCTGATTGG - Intergenic
1074905504 10:117859780-117859802 GAGGAAAATAATGATGTGAGGGG - Intergenic
1075954106 10:126507592-126507614 GAAGCAACGCATGATGTGATTGG - Intronic
1076391636 10:130107760-130107782 GAGGAGAATCAAGCTGTGAAAGG + Intergenic
1077557162 11:3231284-3231306 GGGGAGAGGCATGAAGAGATGGG + Intronic
1077998102 11:7471295-7471317 GAGGAGAGGCATGTTATGAATGG + Intergenic
1078184706 11:9041864-9041886 GAGGAGAAGAATTCTGAGATGGG + Intronic
1078722973 11:13900858-13900880 GAGCAGCAACATGATGTGTTTGG + Intergenic
1079349457 11:19680196-19680218 GATGAAAAGAATGATGTGCTGGG - Intronic
1080636099 11:34124937-34124959 TAAGAGAGGCATGAGGTGATGGG + Intronic
1081084262 11:38779731-38779753 GATGGGAAGCATAATGTGACTGG + Intergenic
1081179027 11:39965224-39965246 GAGGAGCAGCATCAGGTGGTTGG - Intergenic
1084805507 11:71576269-71576291 GAGGAGAAACATGGTTTGAAAGG + Intergenic
1088757983 11:112902619-112902641 GATGAGAAGGTGGATGTGATAGG - Intergenic
1091663562 12:2402243-2402265 GAGGAGAAGCATAATATTAAAGG - Intronic
1092281726 12:7102516-7102538 GAGGAGAAGCTGGATGGGAGGGG - Intronic
1097930352 12:65177193-65177215 GAGGACAAGCATGATCGAATTGG + Intronic
1097987682 12:65801687-65801709 GATGAGAAAAATGAAGTGATGGG + Intergenic
1098282959 12:68879975-68879997 CAGGAGCAGAATGAGGTGATGGG + Intronic
1099124107 12:78730935-78730957 GAGGAGAAACATGGTTTGAAAGG + Intergenic
1099822771 12:87734234-87734256 GAATTGAATCATGATGTGATAGG - Intergenic
1100182387 12:92099732-92099754 GAGGTTAAGCATGATCGGATTGG + Intronic
1100738562 12:97565543-97565565 GGGGAGAAAGATGATGTGAGAGG + Intergenic
1101723507 12:107371063-107371085 GAAGGGAAGCATGTTCTGATGGG - Intronic
1102454985 12:113065617-113065639 GAGGAGATGGAAGCTGTGATGGG + Intronic
1105900988 13:24752949-24752971 GGGGAGTAGCATGAGATGATGGG - Intergenic
1106058494 13:26262507-26262529 CAGGAGAAGCAAAATTTGATGGG + Intronic
1106583875 13:31039997-31040019 GAGGAGAAGAATGGTGTGCAAGG + Intergenic
1107045079 13:35985183-35985205 GTGGAGAAGGATGATGTGGAAGG - Intronic
1108385073 13:49892308-49892330 GAGGAGAATCAAGCTGTAATAGG + Intergenic
1108590547 13:51908888-51908910 GAGGAGAATCAAGCTGTGATAGG - Intergenic
1109126991 13:58530337-58530359 GAGGAGAATCAAGCTGTGATAGG + Intergenic
1110414655 13:75238609-75238631 GAGGAGAACCAAGCTGTGATAGG - Intergenic
1110503928 13:76262229-76262251 GAGCAGCAGCAGGATGTGCTTGG + Intergenic
1111281997 13:86038724-86038746 CAGGAGACACATGATGTTATTGG + Intergenic
1111956873 13:94768825-94768847 GGGGAGTAGCAAGATGAGATGGG + Intergenic
1116008816 14:39326912-39326934 GAGGAGAATCAAGCTGTGATAGG + Exonic
1120068190 14:80070490-80070512 GAGGAGAGGCATGCCTTGATTGG + Intergenic
1120203291 14:81561627-81561649 GAGGTGTAGGAAGATGTGATAGG + Intergenic
1122533249 14:102443848-102443870 TAGGACAAGCACGATGTGAAAGG - Intronic
1125292319 15:38163818-38163840 GAGGAAAAGCAGGATGTAACTGG + Intergenic
1126583920 15:50264800-50264822 GAGAAGAACCAGGATGTGAGAGG - Intronic
1127045385 15:55020004-55020026 GAGGACAATCATGATGTGGATGG + Intergenic
1127067654 15:55257200-55257222 GAAGGGAAGGATGATGAGATTGG + Intronic
1127569403 15:60226679-60226701 AAGGAGAAACATGATATCATGGG - Intergenic
1128438557 15:67680817-67680839 CAGGAGACACATGTTGTGATTGG + Intronic
1131612440 15:93979156-93979178 GAGGAGCAGCAGGATTTAATAGG + Intergenic
1131701663 15:94943097-94943119 GAGGAGAAGAATGAGGAGAATGG + Intergenic
1131701670 15:94943134-94943156 GAGGAGAAGAATGAGGAGAATGG + Intergenic
1133026860 16:2992376-2992398 GAGGAGAAGCAGTGTGTGAGGGG - Intergenic
1135848673 16:25942219-25942241 GAGGAGAAACAAGAGATGATGGG + Intronic
1136736011 16:32468536-32468558 GAATACAAGAATGATGTGATTGG - Intergenic
1137473335 16:48782851-48782873 GATGTGAAGCATGATTTTATAGG + Intergenic
1138004371 16:53317429-53317451 GAGAAGTAGCATGGTTTGATTGG + Intronic
1140276456 16:73513138-73513160 GATGAAAAGCATGTTCTGATGGG + Intergenic
1141490196 16:84367697-84367719 GAGGAGGAGGATGGTGTCATGGG + Intergenic
1142111100 16:88332087-88332109 GAGGACAGGCATGATGGGACAGG + Intergenic
1142453910 16:90204548-90204570 GAGGAGAAAAATGATGTCACTGG + Intergenic
1203017064 16_KI270728v1_random:361038-361060 GAATACAAGAATGATGTGATTGG + Intergenic
1203035399 16_KI270728v1_random:634196-634218 GAATACAAGAATGATGTGATTGG + Intergenic
1145036983 17:19548088-19548110 GAAGAGCAGCAGGATGTGCTGGG - Exonic
1145057614 17:19713848-19713870 GAAGAGCAGCAGGATGTGCTGGG + Exonic
1146212720 17:30954725-30954747 GAGGAGAAGCTTCATGCCATAGG - Intronic
1151409443 17:73912096-73912118 GAGGAGCAGCTTGATGGGAGGGG - Intergenic
1153397244 18:4638066-4638088 GAGGAGAAGCCTGTTCTCATGGG + Intergenic
1154055100 18:11005192-11005214 GGGAAGAAGCCTGATGTGAAGGG - Intronic
1155081650 18:22416162-22416184 GAGGAGAATCAAGCTGTGATAGG - Exonic
1155176699 18:23307503-23307525 GAGGACAAGAATGAAGCGATCGG - Intronic
1155873260 18:31053330-31053352 CAGGAGAACCAAGATGTGACAGG - Intergenic
1156189380 18:34700783-34700805 GAGAAGAAGCATGATGCAAATGG - Intronic
1157534402 18:48447915-48447937 GAGGAGAGACATGATCTGATGGG - Intergenic
1157673470 18:49550220-49550242 GAGGAGAAAGAAGATGTGAGAGG + Intergenic
1158204122 18:54972833-54972855 GAGGAGAAGCCTGATTGGAATGG - Intergenic
1159082091 18:63746312-63746334 GAGGGGGAGGAGGATGTGATAGG + Intergenic
1159455151 18:68652019-68652041 GAGGAGAACGATGATATTATGGG + Intergenic
1163489235 19:17607066-17607088 GAGGAGAAGCATGGTCTAGTGGG - Intronic
1165064491 19:33221072-33221094 GAGCAGAGGGATGATGGGATGGG - Intronic
1165081624 19:33310240-33310262 GGGAAGAAGCAGGATGTGAATGG - Intergenic
1166655245 19:44606397-44606419 GTGGGGAGGCATGATTTGATTGG - Intergenic
1166951901 19:46434414-46434436 GATAAGAAACATTATGTGATTGG - Intergenic
1167681934 19:50928894-50928916 CTGGAGAAGCATGATCTGACTGG + Intergenic
1167734913 19:51288190-51288212 GAGAAGAAGTGTGATGTGTTAGG + Intergenic
926046130 2:9710982-9711004 GCAAAGAAGCATGATCTGATAGG - Intergenic
926076837 2:9949746-9949768 GAGGAGCAGCATGAGGTCACAGG - Intergenic
926305056 2:11632063-11632085 GAGCACCAGCATGATGTGGTTGG - Exonic
926505258 2:13706226-13706248 GAGGTAAAGCATGATATGTTCGG - Intergenic
926807480 2:16724428-16724450 GATGAGAAGCAGGCTGAGATGGG + Intergenic
927732604 2:25487836-25487858 GAGGAGAGGCAGGATGTGAAAGG + Intronic
931569588 2:63654539-63654561 GAGGAAAAGCTTGATGTGAAAGG + Intronic
931645442 2:64417721-64417743 GAGGGGAAGCATGATGGAAGGGG - Intergenic
932736928 2:74260781-74260803 AAGCAGGAGCATGCTGTGATCGG - Intronic
933570366 2:84003505-84003527 GAGGAGAAAAAGGATGTGACAGG + Intergenic
933697511 2:85230856-85230878 GAGGAAAAGCCTGAGGGGATGGG + Intronic
933997881 2:87683251-87683273 GAGGAAAAACATGATTTGAGAGG + Intergenic
934110242 2:88735507-88735529 TAGGAGCAGCATGATGGGACTGG + Intronic
934187175 2:89757648-89757670 GAATACAAGAATGATGTGATTGG - Intergenic
934309458 2:91850276-91850298 GAATACAAGAATGATGTGATTGG + Intergenic
936295969 2:111267615-111267637 GAGGAAAAACATGATTTGAGAGG - Intergenic
936628116 2:114170479-114170501 GAGGGGAAGACTGATGTGGTTGG + Intergenic
941509277 2:166385891-166385913 GAGGAAATTCAAGATGTGATTGG + Intergenic
941615542 2:167714325-167714347 GAGGAGAACCAAGCTGTGATAGG - Intergenic
941727984 2:168885173-168885195 GAGGAGGAGCATGTTTTTATAGG - Intronic
943011092 2:182450520-182450542 GAGGACTAGCTTGATGTCATTGG - Intronic
944275753 2:197835564-197835586 TAGGAGCAGCATGATATGGTAGG + Intronic
944686441 2:202122048-202122070 GAGGAGCAGCGTGGTGTGAGTGG + Intronic
945009486 2:205446103-205446125 GAGAGGAAGCATGATGTGTTAGG + Intronic
945149668 2:206776451-206776473 TAGGAGAAGCCTGATGGCATTGG - Intronic
945435769 2:209815761-209815783 GAGGAGAATAAGGATGTCATTGG - Intronic
946678709 2:222190452-222190474 GAGTAGAAGCTTGACTTGATTGG - Intergenic
946788034 2:223268550-223268572 GAGGAGAAGCATGGGGTCAGAGG - Intergenic
947062457 2:226181938-226181960 GAGCAGAAGCATGAATGGATTGG - Intergenic
947481426 2:230503900-230503922 GAGGAAAATCATTGTGTGATAGG + Intronic
949085362 2:242149211-242149233 GAGGAGAAAAATGATGTCACTGG + Intergenic
1168805022 20:667445-667467 GAGGAGCAGCACGATGTGTTGGG - Intronic
1172572427 20:35981091-35981113 AAGGAGAATCAGGGTGTGATTGG + Intronic
1173564952 20:44032042-44032064 GAACAGAAGCATAATGGGATGGG + Intronic
1175822855 20:61920088-61920110 GCGTGGAAGCATGTTGTGATTGG + Intronic
1177356686 21:20017853-20017875 GATGAGATGCATTCTGTGATAGG + Intergenic
1179774430 21:43651798-43651820 GGGGAGAGGCATGATTTGTTAGG - Intronic
1180536552 22:16397413-16397435 GAATACAAGAATGATGTGATTGG + Intergenic
1183747222 22:39698763-39698785 GAGGTGAAGGAGGAGGTGATGGG - Intergenic
1183747249 22:39698852-39698874 GAGGTGAAGGAGGAGGTGATGGG - Intergenic
1183747256 22:39698875-39698897 GAGGTGAAGGAGGAGGTGATGGG - Intergenic
1183747269 22:39698921-39698943 GAGGTGAAGGAGGAGGTGATGGG - Intergenic
1183747280 22:39698955-39698977 GAGGTGAAGGAGGAGGTGATGGG - Intergenic
1183747287 22:39698978-39699000 GAGGTGAAGGAGGAGGTGATGGG - Intergenic
1183747325 22:39699135-39699157 GAGGTGAAGGAGGAGGTGATGGG - Intergenic
1184309837 22:43634008-43634030 GAGGAGAAGCAGGAAGTGAGGGG + Intronic
1184670392 22:46009283-46009305 GAGGAAAAGTATGATGAGCTTGG - Intergenic
1184715598 22:46280118-46280140 CAGGAAAAGCAGGCTGTGATGGG + Intronic
1184946421 22:47807419-47807441 GAGGAGGAGAGTGATGTTATGGG - Intergenic
1184954543 22:47877015-47877037 GAACAGAAGCAAAATGTGATGGG - Intergenic
949369157 3:3316311-3316333 GAGGAGAAGGAGGAAGAGATAGG - Intergenic
951636263 3:24781545-24781567 GACGATATGCATGATTTGATGGG - Intergenic
953635323 3:44658549-44658571 GAGGAGAGGTAACATGTGATGGG + Intronic
953798094 3:46000913-46000935 GTGGATAAACATGATGAGATGGG + Intergenic
954438863 3:50510743-50510765 CAGGAGGAGCATCATGTCATGGG + Intergenic
959657515 3:108826137-108826159 GAGGGGAATCATGATGTGCTAGG + Intronic
960309622 3:116105272-116105294 CAGTAGAAGCATGATGTGAGAGG + Intronic
960326904 3:116308148-116308170 GAGGAAAAGCAGGATCTAATAGG - Intronic
962993246 3:140599168-140599190 GAGGAGAAGCTTGAAATGACAGG + Intergenic
963705997 3:148688963-148688985 GAGGAGAGGCGTGATGTGTAAGG - Intergenic
964314783 3:155432123-155432145 CAGGAGCAGCAGGATGTGTTGGG - Intronic
964568702 3:158088814-158088836 GAAGAGAAGCATGGGATGATGGG + Intergenic
964646502 3:158963697-158963719 AAGGAGAAGCAAAATTTGATGGG + Intronic
965409049 3:168306701-168306723 GATGAGATGCTTGGTGTGATAGG - Intergenic
970390613 4:15607698-15607720 GAGGAGAGGCACTAGGTGATTGG - Intronic
972113246 4:35592763-35592785 GAGGAGAAGCACATTGTGACTGG + Intergenic
973072687 4:45884407-45884429 GAGGAGAATGATGAGATGATGGG + Intergenic
973151960 4:46899112-46899134 GAGGAGAAGGATAATGAGTTGGG - Intronic
973820944 4:54660752-54660774 GTGGTGAAGCCTGATGAGATTGG + Intronic
974031692 4:56782093-56782115 GAGGAGAAGCATGGGCTGCTTGG - Intergenic
975175514 4:71284066-71284088 TAGGAGTAGTATGATGTCATAGG + Intronic
975319011 4:72988792-72988814 GAGTAGTTGCATGAAGTGATGGG - Intergenic
976673363 4:87678135-87678157 GAGGGGAAGCATGATTTAAGAGG - Intergenic
978550866 4:109925129-109925151 GAGGAAAAGCCTGATATTATTGG + Intronic
979262794 4:118667459-118667481 GAGGAGAAAAATGATGTCACTGG + Intergenic
979274906 4:118804370-118804392 GAGGAGAAAGACGATGAGATTGG + Intronic
980712316 4:136585620-136585642 GATAAGAGGCATGATCTGATTGG - Intergenic
981902816 4:149886861-149886883 GAGGAGAAGCAGGAGCTGACGGG - Intergenic
982004707 4:151052402-151052424 GAAGAGAAGCATTTTGAGATAGG - Intergenic
983160427 4:164407106-164407128 GAGGAGAAGCCTGCTGTAAGTGG - Intergenic
983748351 4:171230461-171230483 GATGTGAAGCATGATGATATAGG - Intergenic
984339525 4:178438145-178438167 GAGGAGTAGAAGGATGTGTTTGG + Intergenic
984766118 4:183401756-183401778 GAGCAGCAGTATGATGTGCTGGG + Intergenic
984797461 4:183676635-183676657 AAGGAGAAGCATGGTGAGAAAGG - Intronic
986507581 5:8468487-8468509 GGAGAGAAGCATGATCTCATAGG - Intergenic
987826333 5:23034885-23034907 GAGGAAAAGCATGGTTTGGTGGG - Intergenic
991556722 5:67903007-67903029 GAGGAAAAAAATGACGTGATTGG - Intergenic
992035462 5:72770342-72770364 TAGGGGAAGCATGAAGTGCTAGG + Intergenic
992242814 5:74788813-74788835 GAGTTGAACCGTGATGTGATGGG - Intronic
992671123 5:79062177-79062199 GAGGAGAAGAAGGAGGTGCTAGG - Intronic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
993029182 5:82684457-82684479 GAGGAGAAGGTTGACTTGATAGG - Intergenic
994723129 5:103403494-103403516 GAGAAGCAGGGTGATGTGATAGG + Intergenic
995122017 5:108546301-108546323 GAGGAAAAGCAGGATGAGAACGG - Intergenic
998769226 5:145523190-145523212 GATGAGAAACATGATGTCAAAGG + Intronic
999689322 5:154133062-154133084 GAGGAGTGGCATGACCTGATGGG + Intronic
1001216727 5:169863511-169863533 GAGAAGAAGCATGATGGTTTAGG + Intronic
1001626585 5:173140955-173140977 AACAAGAAGCATGATGTGAACGG + Intergenic
1002737499 5:181406094-181406116 GAGGAGAAAAATGATGTCACTGG + Intergenic
1004373226 6:15070616-15070638 GAGGATAAGCCTGCTTTGATTGG - Intergenic
1005317800 6:24621052-24621074 GAGGATGAGCAGGATGTGACAGG - Intronic
1007183650 6:39949235-39949257 GAGGTCAAGTATGATATGATTGG - Intergenic
1007376632 6:41461369-41461391 GAGGAGAAGAAGGATGAAATAGG + Intergenic
1009168977 6:60375675-60375697 TAAGAGAAGCAAGATGTGAGGGG + Intergenic
1010838506 6:80618762-80618784 AAAGAGCAGCATGATCTGATTGG - Intergenic
1011037594 6:82994781-82994803 TAGGAGAATCATGATGCCATTGG + Intronic
1015375148 6:132501697-132501719 GAGGATAAGCATCCTGTGTTGGG - Intronic
1015614231 6:135058291-135058313 TAGGAGTAGAATGATATGATAGG + Intronic
1015735302 6:136393229-136393251 TGGGAGAAGCATGGTTTGATGGG - Intronic
1016606130 6:145929892-145929914 GAGATGAAGAATGATGTTATTGG - Intronic
1018938159 6:168287576-168287598 GAGGAGAATCAAGCTGTGATAGG - Intergenic
1019242596 6:170681649-170681671 GAGGAGAAAAATGATGTCACTGG + Intergenic
1019891998 7:3954488-3954510 GAGGAGAAGCAGGAGGGGAGGGG - Intronic
1020983449 7:15101190-15101212 GAGAAGAAGCATGTTTTAATAGG - Intergenic
1021966062 7:25920164-25920186 GGGAAGAAGCATGATGACATTGG + Intergenic
1022612196 7:31887006-31887028 GAGGAACAGAATGATGAGATTGG + Intronic
1023299759 7:38757696-38757718 GAGGAGTGGCCTGAGGTGATGGG + Intronic
1024282587 7:47731716-47731738 CAGCAGAAGCATGATGAGCTAGG - Intronic
1024924783 7:54601247-54601269 GAGGTGAACAAGGATGTGATAGG - Intergenic
1027918004 7:84351241-84351263 GAGGAAAAGGATGTTATGATGGG - Intronic
1027948390 7:84780442-84780464 GAGGAGCAGCAGGGTGTGCTTGG + Intergenic
1031450910 7:121916806-121916828 GAAGATAAGCATGTTGTGATTGG + Intronic
1032158196 7:129487986-129488008 GTGGAAAAAAATGATGTGATTGG - Exonic
1033657572 7:143383388-143383410 GAGCATAAGCATAAGGTGATTGG + Intronic
1033678942 7:143573544-143573566 GAGGAGAACCAAGCTGTGACAGG + Exonic
1033692896 7:143755910-143755932 GAGGAGAACCAAGCTGTGACAGG - Exonic
1034014524 7:147567559-147567581 GAGGAGGAGATTGATTTGATGGG + Intronic
1034357745 7:150466036-150466058 ACAGAGAAGCATGATGTGGTGGG - Intronic
1035281922 7:157784079-157784101 GAGGAGAAGGAAGCTGGGATGGG + Intronic
1035505524 8:126504-126526 GAGGAGAAAAATGATGTCACTGG - Intergenic
1036694025 8:10963085-10963107 GAGGAGAAGCGGGATGTGCTTGG - Intronic
1038047585 8:23779147-23779169 GAGGAAAAGCATGAAGTAACTGG - Intergenic
1039182042 8:34877948-34877970 GAAGAGAAGAATGTTGCGATGGG - Intergenic
1040624101 8:49125719-49125741 GAGGAGAAGCAGGAAGGGATCGG - Intergenic
1040786908 8:51176935-51176957 TAGGAAAAGCATCATTTGATTGG + Intergenic
1040936844 8:52790436-52790458 GAGGTGAGGAGTGATGTGATCGG - Intergenic
1042010328 8:64237388-64237410 GAGGATAAGCCAGCTGTGATTGG + Intergenic
1042335227 8:67622917-67622939 GATGAGAAGTGTGGTGTGATTGG - Intronic
1042502317 8:69523073-69523095 GAGGAGAAGCATGATCATCTGGG + Intronic
1043022691 8:75024285-75024307 GAGCAGAGGAATGATGTGTTTGG + Intronic
1044747893 8:95388993-95389015 GAGGAGAAGCATCATGTGCTTGG + Intergenic
1045986613 8:108256616-108256638 GAGGAAAAGCCTAGTGTGATTGG + Intronic
1046738150 8:117799670-117799692 GAGGGGAAGCAAGAAGGGATGGG - Exonic
1049812905 8:144583548-144583570 GAGGAGAAACAGGATGTCAGGGG - Intronic
1050934323 9:11375394-11375416 GAGGAGAAGAAGGAGGTGGTAGG + Intergenic
1051209103 9:14722661-14722683 GAGGAGATGCATGCTGTCAGGGG + Exonic
1052365628 9:27609053-27609075 GAGGAGAATCAAGATGTGACAGG - Intergenic
1056890623 9:90488475-90488497 GAGGAAAAGCATGGTTTGAGGGG + Intergenic
1058822498 9:108745437-108745459 AAGGAGAAGCATGAGTGGATTGG - Intergenic
1059880497 9:118683648-118683670 GAGGAGAAGCTTGCAGTGAGCGG + Intergenic
1059986925 9:119829474-119829496 GAGGAGAGGCAGGCAGTGATGGG - Intergenic
1060693565 9:125686553-125686575 GAGGAAAAGGAGGATGTGACTGG + Intronic
1060736567 9:126070076-126070098 GAGGAGAAGCAGGAACTGTTTGG - Intergenic
1061775187 9:132958257-132958279 GAGGAGAAAGAGGATGTGTTAGG + Intronic
1203602787 Un_KI270748v1:30873-30895 GAGGAGAAAAATGATGTCACTGG + Intergenic
1188453615 X:30336521-30336543 GAGAAGAAGCATGAAGTTGTGGG - Intergenic
1188893507 X:35638312-35638334 GAGGAGAAGCATGAAGCCAGTGG - Intergenic
1189708088 X:43779740-43779762 GAGGAGAACCCTGATGGAATCGG + Intronic
1189785484 X:44555463-44555485 GAGGAGAAGCAGCAGGCGATTGG - Intergenic
1190259686 X:48790085-48790107 GAGGAGAAGGATGAAGAAATTGG + Intronic
1192359912 X:70432954-70432976 GAGGAGAAACATGAGGTGAGGGG - Intronic
1193837601 X:86364584-86364606 GAGGAGAAGCATGATGTGATGGG + Intronic
1196848797 X:119918032-119918054 GAGGAGAAGCAAGATCAGAATGG - Intronic
1197000672 X:121435389-121435411 GAGGAGAAGCAAGCTTTAATTGG - Intergenic
1198034715 X:132789841-132789863 GAGGAGGAGCAAGATGTGACTGG + Intronic
1198936589 X:141906425-141906447 GAGGAGAAGGAGGAGGTCATAGG - Exonic
1198936623 X:141906635-141906657 GAGGAGAAGGAGGAGGTCATAGG - Exonic
1199989687 X:152979402-152979424 GAGCAGAAGAGGGATGTGATCGG - Intergenic
1199995988 X:153027167-153027189 GAGAAAAAGCAGGATGTGAGTGG - Intergenic
1200924336 Y:8641094-8641116 GAGGAGCAGCATGCTCAGATGGG + Intergenic
1201486650 Y:14501862-14501884 GAGGTGAGGCCTGAGGTGATTGG - Intergenic
1201520824 Y:14871713-14871735 GTGGAAAAAAATGATGTGATTGG + Intergenic
1202384859 Y:24315918-24315940 GAGGAGAAAAATGATGTCACTGG + Intergenic
1202485926 Y:25354204-25354226 GAGGAGAAAAATGATGTCACTGG - Intergenic