ID: 1193839586 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:86392953-86392975 |
Sequence | GTGGTGCTATGGCATCTAGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1193839580_1193839586 | 4 | Left | 1193839580 | X:86392926-86392948 | CCTTTTTGGCTGTCGCAATGGGT | No data | ||
Right | 1193839586 | X:86392953-86392975 | GTGGTGCTATGGCATCTAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1193839586 | Original CRISPR | GTGGTGCTATGGCATCTAGT GGG | Intronic | ||