ID: 1193839586

View in Genome Browser
Species Human (GRCh38)
Location X:86392953-86392975
Sequence GTGGTGCTATGGCATCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 8, 3: 15, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193839580_1193839586 4 Left 1193839580 X:86392926-86392948 CCTTTTTGGCTGTCGCAATGGGT 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG 0: 1
1: 0
2: 8
3: 15
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193839586 Original CRISPR GTGGTGCTATGGCATCTAGT GGG Intronic
903508422 1:23854747-23854769 GGGGTGGTATGCCATCTAGTGGG + Intronic
904994211 1:34618301-34618323 GGGTTGCACTGGCATCTAGTGGG + Intergenic
907596090 1:55721274-55721296 GGAGTGCTATGGCATCTGGTGGG + Intergenic
909314497 1:74198271-74198293 GTGGGGCTATGGCAGCTGCTAGG + Exonic
910033182 1:82756993-82757015 AGAGTGCTATGGCATCTAGACGG + Intergenic
915474898 1:156147559-156147581 GTGGTCCTCTGGCCTCTACTGGG + Intronic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
921033415 1:211353805-211353827 GAGGTGCTGTGGCACCTAGAAGG + Intronic
922177865 1:223211134-223211156 GGGGTACTATTGCATCTTGTGGG - Intergenic
922177878 1:223211183-223211205 GAGGTACTATTGCATCTTGTGGG - Intergenic
924772237 1:247088342-247088364 TGGCTGCTATGGCATCTGGTGGG - Intergenic
1067278908 10:44856774-44856796 GTGGTGCTACAGCATCTATAGGG + Intergenic
1068011729 10:51460117-51460139 GGGGTCCTCTGGCATTTAGTGGG - Intronic
1068255747 10:54508484-54508506 GTTATGCTATGACATTTAGTAGG - Intronic
1072663335 10:97376689-97376711 TGGGTGCTCTGGCATCTAGTGGG - Intronic
1073457693 10:103647481-103647503 GTGGAGCTAGAGCATCTTGTTGG - Intronic
1074729861 10:116359553-116359575 AGGGTGCTACTGCATCTAGTGGG - Intronic
1075638937 10:124050526-124050548 GGGGTGCTATGGCATCCAGTGGG - Intronic
1075653850 10:124148133-124148155 AGGATGCTATGGCATCTAGGAGG - Intergenic
1081360760 11:42174977-42174999 GTGGTGCTATGCCATATGGGAGG - Intergenic
1081797720 11:45832965-45832987 GAGTTGCTATGGAATCTGGTGGG + Intergenic
1084971487 11:72774610-72774632 GTGGTGCTCTGGCAACAGGTTGG - Intronic
1086350285 11:85937188-85937210 GTGGTGTTATGATATATAGTTGG - Intergenic
1086903045 11:92389057-92389079 GTGTTGCTATGGCACCTACTGGG - Intronic
1087749272 11:101989383-101989405 GAAGTGCTGTGGCATCTAGTGGG - Intronic
1087769402 11:102191304-102191326 GTGGTGCTATGGCACTTAGCGGG - Intronic
1088979903 11:114852880-114852902 AGGATGCTATTGCATCTAGTGGG - Intergenic
1090135347 11:124192285-124192307 GTGGTGTCATGGAATCTAGGAGG - Intergenic
1091229361 11:133977755-133977777 GTGGTGCTGTGGGATCCAGGTGG - Intergenic
1098349096 12:69538938-69538960 GGGGTGTCATGGCATCTAGGAGG - Intronic
1099306666 12:80965301-80965323 ATGGTGCTATGTGATTTAGTTGG - Intronic
1101693664 12:107104485-107104507 GTGGTACTTGGGCATTTAGTGGG + Intergenic
1103173145 12:118839377-118839399 GAAGGGCTCTGGCATCTAGTAGG - Intergenic
1104576537 12:129971862-129971884 GAGGTGCTATGGCACCTAGTGGG - Intergenic
1104582537 12:130021735-130021757 AGGTTGCTATGGCATCTAATGGG + Intergenic
1111174374 13:84574140-84574162 GTGGTGCTATGGAAGCCAGGTGG + Intergenic
1111894043 13:94118828-94118850 GTGTTTCTTTGGCATATAGTAGG - Intronic
1111982130 13:95027462-95027484 GTGGTGCTGTGGAATCAATTTGG - Intronic
1113898141 13:113778720-113778742 GTGGTACTGTGGCATCTTCTGGG + Intronic
1116107342 14:40526963-40526985 ATGGCTCTATGGTATCTAGTGGG + Intergenic
1117666049 14:58057005-58057027 GTTGTGCTCTGCCACCTAGTAGG - Intronic
1119209162 14:72817058-72817080 GTGGTGCTTTTGCATCATGTAGG - Intronic
1128332619 15:66765735-66765757 TTGGTGCTATGGGATAGAGTTGG + Intronic
1128570181 15:68728049-68728071 GGGTTGCTATGGCATCTGATTGG - Intergenic
1128685547 15:69682203-69682225 GTGTTCTTATGGCATCTAGAAGG + Intergenic
1129913232 15:79245297-79245319 GTTCTGCTCTGGCCTCTAGTAGG - Intergenic
1129945236 15:79533940-79533962 GTGTTCCACTGGCATCTAGTGGG + Intergenic
1130366976 15:83249482-83249504 GGGGTGCTATGGCATTTAGTGGG + Intergenic
1130898791 15:88191790-88191812 ATGGTGCTAAGGCATCAAGGGGG + Intronic
1132646762 16:1002798-1002820 GGGGTGCTGTGGCATCCAGCGGG - Intergenic
1134083682 16:11341936-11341958 AGGGTGCCATGGCATCTCGTGGG + Intronic
1135647543 16:24176132-24176154 GTGGTGATATGGAATCTATAGGG + Intronic
1138759396 16:59522830-59522852 GTGGTGGAATGTCATCAAGTTGG + Intergenic
1140503822 16:75457222-75457244 GTGGTTCTGTGGCAGCTGGTAGG - Intronic
1140836470 16:78798925-78798947 GTGGTTTTATGGCATTTTGTTGG + Intronic
1141312021 16:82923533-82923555 CTGAGGCTATGGAATCTAGTGGG + Intronic
1146265904 17:31452621-31452643 GTGGTCCCATGGCATGTAGGGGG - Intronic
1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG + Intergenic
1150234744 17:63583867-63583889 TTGGTACTATGGCATCTAGGGGG + Intronic
1151433797 17:74081812-74081834 GTGTTGCTCTGGCATCAAGCGGG + Intergenic
1153406894 18:4750848-4750870 GTGGTTCTATGCCATTTTGTTGG + Intergenic
930586659 2:53275481-53275503 CTGATGCAATGGCCTCTAGTTGG + Intergenic
933903762 2:86868921-86868943 GTGGAGTTATTTCATCTAGTGGG + Intergenic
933905004 2:86883389-86883411 GTGGAGTTATTTCATCTAGTGGG - Intergenic
935640073 2:105281881-105281903 GGTGTGCTATGGCATCTAGTAGG + Intronic
935776753 2:106480046-106480068 GTGGAGTTATTTCATCTAGTGGG - Intergenic
936367144 2:111868041-111868063 GTGGAGTTATTTCATCTAGTGGG + Exonic
940449352 2:153818336-153818358 GTGTGGCTATGGCCTCTATTGGG - Intergenic
941620925 2:167777927-167777949 ATGGTGCTGTGGTATCTAGTAGG + Intergenic
945219443 2:207468904-207468926 GTGGTGTTATGGTATCTATACGG - Intergenic
946612795 2:221477502-221477524 TTGGTGCAGTTGCATCTAGTGGG - Intronic
946862691 2:224015023-224015045 GTGGTGCCATGGCATCTGGTAGG + Intronic
946862704 2:224015061-224015083 GTGGTGCCGTGGCATCTGCTAGG + Intronic
947371106 2:229446457-229446479 CTGGTGCAATGGCCTCTAGCTGG - Intronic
1168934030 20:1647468-1647490 CTGTTGCTATGTCATCTAGGAGG + Intronic
1169841075 20:9938344-9938366 GTGCAACTATGGCATCTAGTGGG + Intergenic
1171144042 20:22766397-22766419 CTGGTGCTTTGCCATCTACTTGG - Intergenic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1174176334 20:48647585-48647607 GTGGTGGGATTGCATCTAGCTGG - Intronic
1177830631 21:26134863-26134885 GTGATACTGTGGCATCTATTTGG - Intronic
1181170854 22:21009043-21009065 GTGGGGGTATGGCACCAAGTTGG + Intergenic
1181595688 22:23913150-23913172 GTGGGGCTTTGGCATTAAGTTGG + Intergenic
1183193849 22:36339665-36339687 GTGGTGGTAATGCATCTTGTTGG - Intronic
1183523295 22:38309087-38309109 GGGGTGCCCTGGCATCTAGTGGG - Intronic
949905611 3:8856060-8856082 GCTGTGCTGTTGCATCTAGTGGG + Intronic
955332092 3:58055610-58055632 GTGGTGCTGTGGTGTGTAGTAGG + Intronic
956171833 3:66439019-66439041 GTGATGCTATAGCAACTATTTGG - Intronic
960089710 3:113626886-113626908 GTGGAGCCCGGGCATCTAGTAGG - Intronic
962267648 3:133955115-133955137 GTGGTGCTGTGGCACTTACTGGG + Exonic
963612827 3:147493710-147493732 GTGGTGAGATGGCATTTAGGTGG + Intronic
965379642 3:167972465-167972487 GAGGTGCTTTGGCACATAGTTGG - Intergenic
971536959 4:27765078-27765100 GTGGTGTTATGACATCCAGTTGG + Intergenic
977101789 4:92825395-92825417 GTTGTGCTATGGCACCGAGGAGG + Intronic
977564081 4:98563850-98563872 AGGGTGCACTGGCATCTAGTGGG + Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1001494584 5:172178905-172178927 GAGGTGTTCTGGCATCCAGTGGG + Intronic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1011264668 6:85502787-85502809 GTTGTGCTATGACATTTAGTTGG + Intergenic
1013238077 6:108216329-108216351 GGGGTGCTATGTTGTCTAGTGGG - Intronic
1020208042 7:6134639-6134661 GTGATGCTGCAGCATCTAGTGGG - Intronic
1021917973 7:25454841-25454863 TGAGTGTTATGGCATCTAGTGGG - Intergenic
1023767020 7:43521279-43521301 GTGGTGCTACTGTACCTAGTGGG - Intronic
1023856606 7:44188084-44188106 CTGGTGCTATGGCAGCAATTTGG - Intronic
1027488625 7:78793365-78793387 TTGCACCTATGGCATCTAGTGGG + Intronic
1032553540 7:132807925-132807947 GTGGTGCCCAGGCATCTAGAGGG - Intronic
1033479467 7:141725242-141725264 TTAGTGCGATGGCAACTAGTTGG + Intronic
1034002601 7:147432248-147432270 GGGGTGCTATGCCATCTAGTGGG - Intronic
1034011526 7:147534189-147534211 GGGTTGCTATGGTATCTAATGGG + Intronic
1038200830 8:25411214-25411236 GTGGTGCTTTGGCTTCTCTTCGG - Exonic
1044963521 8:97554187-97554209 AGGGTGCCATGGCATGTAGTGGG - Intergenic
1045568507 8:103345860-103345882 GTGGGCCTATGTCATCTATTTGG + Intergenic
1052407532 9:28081174-28081196 AAGGTGCTACTGCATCTAGTGGG - Intronic
1052441357 9:28499875-28499897 GTGCAACTATGGCATCCAGTGGG - Intronic
1057526734 9:95809706-95809728 GTGATGCTAAGGCATGTAGTTGG - Intergenic
1061417863 9:130457649-130457671 GTGGAATTCTGGCATCTAGTGGG - Intronic
1062694210 9:137864852-137864874 GGAGTGCTATGGCACTTAGTGGG + Intronic
1186135547 X:6516438-6516460 GTGGGGCTAGGCCATTTAGTAGG + Intergenic
1186323399 X:8453404-8453426 GGGGTGGATTGGCATCTAGTGGG - Intergenic
1186431626 X:9510132-9510154 GGGGTGCTATGGCATTGGGTGGG + Intronic
1186525276 X:10242597-10242619 GGGGTGCGATGGCATCTAGTGGG - Intergenic
1192572368 X:72216998-72217020 GATGTGCTTTGGCATCTAGAGGG - Intronic
1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG + Intronic
1195996610 X:110737944-110737966 AGGGTACTCTGGCATCTAGTGGG + Intronic
1197944736 X:131826982-131827004 GTGGAGCTATAACATCTACTAGG - Intergenic
1198157398 X:133975009-133975031 GTGGTGCTGTGGCACATAATAGG - Intronic
1200747281 Y:6913305-6913327 GTGGGGCTTTGGAGTCTAGTTGG + Intronic
1201920563 Y:19229342-19229364 GTGGTGCTATTGCAGCTTGCTGG - Intergenic