ID: 1193839586

View in Genome Browser
Species Human (GRCh38)
Location X:86392953-86392975
Sequence GTGGTGCTATGGCATCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193839580_1193839586 4 Left 1193839580 X:86392926-86392948 CCTTTTTGGCTGTCGCAATGGGT No data
Right 1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193839586 Original CRISPR GTGGTGCTATGGCATCTAGT GGG Intronic