ID: 1193840719

View in Genome Browser
Species Human (GRCh38)
Location X:86405044-86405066
Sequence TTCCCAAGGCTGCACATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 1, 2: 8, 3: 114, 4: 491}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193840711_1193840719 26 Left 1193840711 X:86404995-86405017 CCCTTTTAGCCACAGCCATGGCT 0: 2
1: 0
2: 6
3: 68
4: 510
Right 1193840719 X:86405044-86405066 TTCCCAAGGCTGCACATGGCAGG 0: 1
1: 1
2: 8
3: 114
4: 491
1193840714_1193840719 11 Left 1193840714 X:86405010-86405032 CCATGGCTTGAGCAGTTGTGATG 0: 1
1: 0
2: 6
3: 125
4: 352
Right 1193840719 X:86405044-86405066 TTCCCAAGGCTGCACATGGCAGG 0: 1
1: 1
2: 8
3: 114
4: 491
1193840712_1193840719 25 Left 1193840712 X:86404996-86405018 CCTTTTAGCCACAGCCATGGCTT 0: 1
1: 1
2: 1
3: 16
4: 212
Right 1193840719 X:86405044-86405066 TTCCCAAGGCTGCACATGGCAGG 0: 1
1: 1
2: 8
3: 114
4: 491
1193840710_1193840719 27 Left 1193840710 X:86404994-86405016 CCCCTTTTAGCCACAGCCATGGC 0: 2
1: 0
2: 4
3: 48
4: 476
Right 1193840719 X:86405044-86405066 TTCCCAAGGCTGCACATGGCAGG 0: 1
1: 1
2: 8
3: 114
4: 491
1193840713_1193840719 17 Left 1193840713 X:86405004-86405026 CCACAGCCATGGCTTGAGCAGTT 0: 1
1: 0
2: 8
3: 38
4: 216
Right 1193840719 X:86405044-86405066 TTCCCAAGGCTGCACATGGCAGG 0: 1
1: 1
2: 8
3: 114
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193840719 Original CRISPR TTCCCAAGGCTGCACATGGC AGG Intronic
900594430 1:3474325-3474347 TTCCTGAGGCTACACATGGCAGG + Intronic
901355509 1:8644166-8644188 TTCCCAAGCCTGCACATGATGGG - Intronic
902117550 1:14133826-14133848 ATCCTCAGTCTGCACATGGCTGG - Intergenic
902498613 1:16892825-16892847 TTCCTAAAGCTGGACTTGGCAGG - Intronic
902797304 1:18807977-18807999 TTCCCTAGGCTGCCCCTGGAAGG + Intergenic
903869814 1:26425832-26425854 TTACCAGGTCTGCAAATGGCTGG + Intronic
905887149 1:41497428-41497450 TGCCCAAGGCCACACAGGGCAGG - Intergenic
906833484 1:49059205-49059227 GTCCCAAGGCTGCACAGAGCAGG - Intronic
907584924 1:55608525-55608547 ATCCCAGGGCTGCACATAGGAGG + Intergenic
907749216 1:57246270-57246292 GTCCCAAGGCTGCACAGAGCAGG - Intronic
908090992 1:60685686-60685708 GTCCCTAGGCTGCACACAGCAGG - Intergenic
909250211 1:73344135-73344157 GTCCCTAGGCTGCACACAGCAGG - Intergenic
909265946 1:73558449-73558471 GTCCCTAGGCTGCACACAGCAGG - Intergenic
909298704 1:73983684-73983706 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
910750465 1:90623781-90623803 CTCTCAAGGCTGCACAGGGTGGG + Intergenic
911376356 1:97056606-97056628 GTCCCAAGGCTGCACACTGCAGG - Intergenic
911695898 1:100890281-100890303 GTCCCAAGGCTGCACAGAGTAGG + Intronic
912052088 1:105542071-105542093 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
912206038 1:107510573-107510595 GTCCCTAGGCTGCACACAGCAGG - Intergenic
913018525 1:114763939-114763961 ATCCCAAGGCTGCACAGAGCAGG - Intergenic
914194338 1:145437567-145437589 TTTCCAAGGCTGCACAGCTCGGG + Intergenic
914475663 1:148020443-148020465 TTTCCAAGGCTGCACAGCTCGGG + Intergenic
915282143 1:154829841-154829863 TTCCCGAGGCTGGCCATGCCTGG + Intronic
915828291 1:159102099-159102121 TTCCGAAGGCTGCATAGAGCAGG - Intronic
915891320 1:159776729-159776751 TTCCCAAAGCTTCCCATGGCAGG + Intergenic
916025552 1:160830474-160830496 TTCCCCAGGATGCACATTGAAGG - Intronic
916068885 1:161158678-161158700 TTTCTAAGGCTGCACAGGGAAGG + Exonic
916736023 1:167607756-167607778 GTCCCCAGGCTGCAAAGGGCAGG - Intergenic
916993008 1:170265391-170265413 GTCCCCAGGCTGCATATAGCAGG + Intergenic
917152165 1:171956963-171956985 GTCCCTAGGCTGCACAGAGCAGG + Intronic
918013964 1:180614924-180614946 TTCCCAAGGACTCTCATGGCAGG + Intergenic
918920096 1:190698223-190698245 GTCCCTAGGCTGCACATAGCAGG - Intergenic
920800496 1:209183149-209183171 GTCCCAAGGCTGCACACATCAGG - Intergenic
920813911 1:209313207-209313229 TTCCCAAGGATGCACAACTCAGG + Intergenic
921606899 1:217166514-217166536 CTCCCAATGCTGAACATGGTGGG - Intergenic
922667808 1:227487766-227487788 GTCCCAAGGCTGCACACTGCAGG + Intergenic
923932808 1:238721959-238721981 GTCCCTAGGCTGCACAGAGCAGG - Intergenic
923996956 1:239506323-239506345 GTCCCTAGGCTGCACAGAGCAGG - Intronic
924394735 1:243606836-243606858 GTCCCAAGGCTGCACAGAGCCGG - Intronic
924648682 1:245903815-245903837 GTCCCGAGGCTGCACACTGCAGG + Intronic
1064021503 10:11813042-11813064 TTCCCAAGTCTCTACATGGAAGG - Intergenic
1066379783 10:34891392-34891414 TTCCCAATTTTGCCCATGGCTGG + Intergenic
1067222487 10:44353934-44353956 TCCCCATGGCTGCCCATGGCAGG + Intergenic
1068235469 10:54227439-54227461 GTCCCAAGGCTGCACAAGCATGG + Intronic
1069077393 10:64052395-64052417 ATCCCAAGGCTGCACAGAACAGG + Intergenic
1069772288 10:70907543-70907565 CACCCAAGGCCGCACATGGCTGG - Intergenic
1070191013 10:74112155-74112177 GTGTCAAGGCTGCACATGGCCGG - Intronic
1071069016 10:81669956-81669978 TTCACTGGGCTGCACGTGGCAGG + Intergenic
1071818315 10:89254451-89254473 GTCCCTAGGCTGCACACAGCAGG + Intronic
1071873473 10:89819161-89819183 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1071990599 10:91097464-91097486 GTCCCAAGGCTGCACACAGCAGG + Intergenic
1072627346 10:97121304-97121326 TTCCCAAGTCTGCAGAAGGGAGG - Intronic
1073880275 10:107973171-107973193 TTCCTAAGCCTGCACACAGCAGG - Intergenic
1073942367 10:108713404-108713426 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1075543700 10:123337472-123337494 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1076544895 10:131238661-131238683 TTGCCAGGGCTGCACATGGAAGG - Intronic
1077410869 11:2403345-2403367 TTCCCAAGGCCGCCCCTGCCTGG - Exonic
1077464166 11:2725691-2725713 TTCCCCAGGCTGCCCTCGGCTGG - Intronic
1078131437 11:8617405-8617427 TCCACTAGTCTGCACATGGCAGG + Exonic
1078887871 11:15523500-15523522 TTCCCAATGCTGGCCATGCCAGG + Intergenic
1079716707 11:23756726-23756748 GTCCCAAGGCAGCACACAGCGGG - Intergenic
1079744384 11:24106760-24106782 GTCCCAAGGCTTCACAGAGCAGG - Intergenic
1080418058 11:32088202-32088224 TTCCCAAACATGCACATGGGGGG + Intronic
1081167125 11:39820324-39820346 GTCCCAAGGCTGCACACAGCAGG + Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1082948021 11:58780717-58780739 GTTCCAAGGCTGCACACAGCAGG + Intergenic
1083435388 11:62639467-62639489 TTCCCAACCCTTCACTTGGCAGG - Exonic
1084121565 11:67071900-67071922 CTCCCAGGGCTGCACCTGCCAGG + Exonic
1084498706 11:69521535-69521557 GTCCTGAGGCTGCACAGGGCAGG + Intergenic
1085012118 11:73148354-73148376 TTACGAAGGCTGCAAATGGGAGG - Intergenic
1086503637 11:87479400-87479422 GTCCTAAGGCTGCACACAGCAGG - Intergenic
1090167686 11:124568662-124568684 TTTACAAGGCTGCACATGTGAGG + Intergenic
1090504612 11:127297970-127297992 TTCCCTAGGCTGCACACAGCAGG - Intergenic
1090692557 11:129199416-129199438 GTCCCTAGGCTGCACACAGCAGG - Intronic
1091350689 11:134891827-134891849 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1092048738 12:5452740-5452762 TTCCCAAGGCTGCCCTAGGTGGG - Intronic
1092140657 12:6180970-6180992 TCCCCCAGGATCCACATGGCTGG - Intergenic
1092618210 12:10234705-10234727 TTCCCAAGGGTGCACAGAGCAGG + Intergenic
1093786211 12:23194771-23194793 TTCCCATGTCTGAACAAGGCAGG + Intergenic
1094625427 12:32119089-32119111 TTCCCCAGTCTCCACATGACTGG - Intronic
1095345904 12:41148392-41148414 ATCCCTAGGCTGCACAGAGCAGG + Intergenic
1095836831 12:46648335-46648357 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
1097301988 12:58028737-58028759 TTTCTAAGACTGCAAATGGCAGG - Intergenic
1097368085 12:58742217-58742239 GTCCCAAGGCTGCACAGAGCAGG - Intronic
1097654717 12:62344903-62344925 GTCCCTAGGCTGCACAGAGCAGG + Intronic
1097735782 12:63179454-63179476 GTCCCCTGGCTGCACATAGCAGG - Intergenic
1098327379 12:69316586-69316608 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1099088609 12:78278181-78278203 GTCCTAAGGCTGCACATAGCAGG - Intergenic
1099407432 12:82281536-82281558 GTCCCAAGGCTACACATAGCAGG - Intronic
1099607902 12:84828675-84828697 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1100929148 12:99585844-99585866 GTCCCTAGGCTGCACAGAGCAGG + Intronic
1100937935 12:99691161-99691183 GTTCCAAGGCTGCACAGAGCAGG + Intronic
1101194669 12:102370075-102370097 GTCCCAAGGCTGCACAGAGGAGG + Intergenic
1101563760 12:105885076-105885098 TCCCCATCTCTGCACATGGCTGG - Intergenic
1101803870 12:108046562-108046584 TTCCCAGGGCTTCATATGGTGGG - Intergenic
1102016639 12:109652383-109652405 AGCCCAAGGCTGCACAGGGATGG - Intergenic
1104079874 12:125420494-125420516 GTCCCTAGGCTGCACAGAGCAGG + Intronic
1104587928 12:130062513-130062535 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
1104728690 12:131093461-131093483 GGCTCAAGGCTGCACCTGGCTGG - Intronic
1104897501 12:132171523-132171545 TTCCCAGGGCTGCACCTGGGAGG - Intergenic
1105774050 13:23639813-23639835 TTCCAAGCGCTGCACATGGCTGG + Intronic
1106361947 13:29039067-29039089 TCCCCAAGGCTCCTCCTGGCTGG - Intronic
1106377644 13:29204516-29204538 TTCCCAAGGCTCCTCCTGGCTGG - Intronic
1107711089 13:43151283-43151305 TTCACATGGCTCCACATTGCTGG + Intergenic
1108885649 13:55178276-55178298 GTCCCGAGGCTGCACAGAGCAGG - Intergenic
1109324679 13:60853026-60853048 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1110359637 13:74610626-74610648 GTCCCAAGGCTGCACCCAGCAGG - Intergenic
1111343084 13:86913841-86913863 GTCCCTAGGCTGCACAGAGCAGG - Intergenic
1111441425 13:88286308-88286330 GTCCCGAGGCTGCACAGAGCAGG + Intergenic
1111457691 13:88506353-88506375 GTCCTAAGGCTGCACATGGCAGG - Intergenic
1111799102 13:92960362-92960384 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1111885182 13:94011690-94011712 TTCCCACTGCTGCAAATGCCAGG - Intronic
1112308799 13:98299671-98299693 TTCCTAAGGCTGCAGAAGGATGG - Intronic
1112769674 13:102781810-102781832 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1112789559 13:102988045-102988067 TTCCCAAAGCTGCACAGAGCAGG + Intergenic
1112971671 13:105270059-105270081 GTCCCTAGGCTGCACATGGCAGG - Intergenic
1115010570 14:28540207-28540229 GTTCCAAGGCTGCACACAGCAGG - Intergenic
1115085809 14:29513432-29513454 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1115609084 14:35034644-35034666 GTCCCAAGGCTGCACACAGCAGG + Intergenic
1116080225 14:40162349-40162371 GTCACTAGGCTGCACATAGCAGG - Intergenic
1116095278 14:40359553-40359575 GTCCCTAGGCTGCACATAGCAGG - Intergenic
1116265745 14:42687550-42687572 GTCCCTAGACTGCACACGGCAGG + Intergenic
1116296687 14:43119850-43119872 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1116533872 14:46006992-46007014 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
1117084138 14:52181491-52181513 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1117101191 14:52349963-52349985 TGCCCAAGCTTACACATGGCAGG - Intergenic
1117713761 14:58559670-58559692 TTCCCAAGGCTTCTCAGGCCAGG - Intergenic
1118042486 14:61932388-61932410 TTCCCACAGTTCCACATGGCTGG + Intergenic
1118820347 14:69341534-69341556 TGGCCAGGGCTGGACATGGCAGG + Intronic
1119142933 14:72284368-72284390 GTCCCTAAGCTGCACATAGCAGG - Intronic
1119305816 14:73607397-73607419 GTCACAAGGCTGCACACAGCAGG + Intergenic
1119401255 14:74364184-74364206 TTCACAAGGTTGCACACTGCTGG + Intergenic
1120378021 14:83733940-83733962 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1120407810 14:84110893-84110915 TTTCCAAGGCTGCTAGTGGCAGG - Intergenic
1120485907 14:85112959-85112981 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1120590932 14:86372619-86372641 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1120921094 14:89756000-89756022 GTCTCAAGGCTGCACAGAGCAGG + Intergenic
1121054701 14:90843117-90843139 TTCCTAAGGCTGCAGAAGACTGG - Intergenic
1121982106 14:98463578-98463600 TTTCCATGGCTCCACATGTCTGG - Intergenic
1122161745 14:99789670-99789692 TGCACAAGGCTGCACATTTCTGG + Intronic
1123737593 15:23200327-23200349 GTCTCAAGGCTGCACACAGCAGG + Intergenic
1124062346 15:26306033-26306055 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1124347813 15:28934134-28934156 TTCCCAAGGCTGTGGAGGGCTGG - Intronic
1126399850 15:48257684-48257706 GTCCCTAGGCTGCACACAGCAGG + Intronic
1126514980 15:49524253-49524275 GTCCCTAGGCTGCACAGAGCAGG - Intronic
1126942474 15:53781383-53781405 ATCCCAAGGCTGCACACAGCAGG + Intergenic
1127186452 15:56485647-56485669 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1127791053 15:62398988-62399010 GTCCCAAGGCTGCACACAGCAGG - Intronic
1129900498 15:79144452-79144474 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1129974070 15:79806596-79806618 TTACCAAGCTGGCACATGGCAGG + Intergenic
1130422062 15:83757467-83757489 GTCCCTAGGCTGCACACAGCAGG + Intronic
1131921415 15:97332714-97332736 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1132121953 15:99183921-99183943 GTCCCTAGGCTGCACACAGCAGG - Intronic
1132575865 16:663770-663792 CTCCTAAGGCTGCAGCTGGCGGG - Intronic
1132821773 16:1876425-1876447 TTGGCAATGCTGCAAATGGCTGG - Intronic
1132945010 16:2527766-2527788 CTCCCAGGGCTGCACCTGGAGGG + Exonic
1133788579 16:8991664-8991686 TTCTAAAAGCTGGACATGGCTGG - Intergenic
1133807229 16:9134890-9134912 GTCCTGAGGCTGCACATGGGAGG - Intergenic
1133888831 16:9858835-9858857 TTGCCAAGGCTGCAAAAGGCTGG + Intronic
1133969356 16:10556429-10556451 TTGCTGAGGCTGCACCTGGCAGG - Intronic
1135919066 16:26631958-26631980 GTCCCTAGGCTGCACACAGCGGG + Intergenic
1135926049 16:26694975-26694997 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1136188005 16:28599449-28599471 TTCCCAAAGCTGGACCAGGCTGG + Intergenic
1136190477 16:28612443-28612465 TTCCCAAAGCTGGACCAGGCTGG + Intronic
1136872503 16:33820385-33820407 TTCCCAAAACTGCACAGAGCAGG + Intergenic
1137993675 16:53185712-53185734 GTCCCAAGGCTGCACACAGCAGG - Intronic
1139218951 16:65159012-65159034 TTCCAAAGTCTGCAAATGGGTGG + Intergenic
1139507997 16:67409178-67409200 TCCCCAAGGCTGTAAGTGGCGGG - Intronic
1140864756 16:79050296-79050318 TGCCCTAGGCTGGACATGGGTGG + Intronic
1141019891 16:80485303-80485325 CTCCCAAGGCAGCACAGAGCTGG + Intergenic
1141648965 16:85382438-85382460 TACCCAATTCTGCACATTGCAGG - Intergenic
1142143086 16:88481242-88481264 TGGCCAAGGCTGCACCTGCCTGG - Intronic
1203099669 16_KI270728v1_random:1295683-1295705 TTCCCAAAACTGCACAGAGCAGG - Intergenic
1143540803 17:7567624-7567646 TTCCCAGGTCTGCGCATGGCTGG - Intronic
1143554597 17:7652296-7652318 CTCCCCAGGCTGACCATGGCAGG + Intronic
1143925250 17:10363821-10363843 TTCCCAAAGATGTATATGGCAGG - Intronic
1143931966 17:10438499-10438521 GTTCCAAGGCTGCACACAGCAGG + Intergenic
1144044902 17:11446652-11446674 TTTCCCAGGTTGGACATGGCAGG - Intronic
1144399686 17:14884067-14884089 ATCCCAAGGCAGCACAAAGCAGG + Intergenic
1144500158 17:15779262-15779284 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1144508745 17:15857061-15857083 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
1145172864 17:20674701-20674723 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
1145837888 17:27968488-27968510 TTCCCAAAGCAGCACTTAGCAGG + Intergenic
1145869245 17:28259926-28259948 TTCCCTAGGCTGCCCTTGGGGGG + Intergenic
1146371399 17:32267004-32267026 TTCCCAGGGCTTCGCAGGGCCGG - Intronic
1147834439 17:43319940-43319962 GTCCCCAGGCTGCACAGAGCAGG + Intergenic
1148108544 17:45132140-45132162 TTCCCCAGGCTGCACGGGGCTGG - Intronic
1148245571 17:46027744-46027766 TTCCTACGCCTGCACCTGGCTGG - Exonic
1148390557 17:47269117-47269139 GTTCCTAGGCTGCACATAGCAGG + Intronic
1149112387 17:53048921-53048943 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1149143138 17:53458041-53458063 GTCCCAAGGCTGCACACAGCAGG - Intergenic
1149371002 17:55993256-55993278 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1149562572 17:57619287-57619309 GTCCCAAGGCTACCCAGGGCTGG - Intronic
1151501018 17:74488891-74488913 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1151674276 17:75589696-75589718 TTCCCCAGGATCCACAGGGCAGG + Intergenic
1151950529 17:77351175-77351197 TTCCCAAGGCTGCACATGGAGGG + Intronic
1152214596 17:79024890-79024912 TGCCCGCGGCTGCACCTGGCGGG + Intronic
1153846047 18:9050853-9050875 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1156078396 18:33307711-33307733 ATCCCAAGGCTGCACAGAGCAGG - Intronic
1156207923 18:34906234-34906256 GTCCCAAAGCTGCACACAGCAGG + Intergenic
1156243573 18:35276477-35276499 GTCCCTAGGCTGCACACAGCAGG - Intronic
1156260105 18:35438613-35438635 TTCCCAGGGCTGGGCAGGGCAGG - Intergenic
1156607241 18:38680527-38680549 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
1156892325 18:42204689-42204711 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1158020618 18:52837118-52837140 GTCCCTAGGCTGCACACAGCAGG + Intronic
1158338666 18:56441307-56441329 CTCCCAGGTCTCCACATGGCTGG + Intergenic
1159215540 18:65386837-65386859 ACCCCTAGGCTGCACATCGCAGG - Intergenic
1159357737 18:67358710-67358732 GTCCCAAGGCTGCACAGAACAGG - Intergenic
1159606238 18:70478131-70478153 GTCCCAAGGCTGCACATAGCAGG - Intergenic
1159640614 18:70859377-70859399 GTCCGAAGGCTGCACAGAGCAGG - Intergenic
1159643187 18:70887655-70887677 GTCCCGAGGCTGCACAGAGCAGG - Intergenic
1159756315 18:72370562-72370584 GTCCCAAGGCTGCACACAGCTGG - Intergenic
1159805862 18:72957682-72957704 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1160700501 19:504685-504707 TTCCCAAGCCTGCAGAGGCCTGG + Intronic
1160901049 19:1428927-1428949 TGCCCAACGCTGCCAATGGCTGG + Exonic
1161389742 19:4014851-4014873 GTCCCAGGGCTGCAGATGGGAGG - Intronic
1163683343 19:18696344-18696366 CTTCCATGGCTCCACATGGCAGG - Intronic
1163721706 19:18900988-18901010 TGCCCACGGCGGCCCATGGCAGG + Intronic
1164145682 19:22511163-22511185 TGCCCCAGGCTGCACACTGCTGG + Intronic
1165068853 19:33243718-33243740 TCCCCAAGGCAGGGCATGGCTGG + Intergenic
1165985523 19:39765598-39765620 TTTCCAAGGCTGGAAATGGATGG + Intergenic
1166164975 19:40980977-40980999 GTCCCAAGGCTGCACATAGCAGG + Intergenic
925009208 2:469128-469150 TGCCCAGGGCTGCACCTCGCAGG - Intergenic
925354385 2:3227733-3227755 GTCCCAAGGCTGCACAGAGCAGG - Intronic
925358183 2:3257417-3257439 TCCACACGGCTGCACATGTCAGG + Exonic
925416421 2:3673029-3673051 TCCCCCAGGCTACCCATGGCTGG - Intronic
926243481 2:11105194-11105216 TTCCCAAGGCTGCTCATCAATGG - Intergenic
926431061 2:12786081-12786103 ATCCCTAGGCTGCACACAGCAGG + Intergenic
926519891 2:13897558-13897580 GTCCCAAGGCTGCACACAGCAGG - Intergenic
926840137 2:17070981-17071003 GTCCCTAGGCTGCACACAGCAGG - Intergenic
926926460 2:17993141-17993163 GTCCCAAGGCTGAACAGAGCAGG - Intronic
926929639 2:18023950-18023972 GTCCCTAGGCTGCACACAGCAGG + Intronic
927869827 2:26616389-26616411 ATCCCAAGGCTCCACCTCGCAGG - Intronic
928474841 2:31615854-31615876 GTCCCTAGGCTGCACACAGCAGG - Intergenic
929211278 2:39359843-39359865 GTCCCTAGGCTGCACACAGCAGG + Intronic
929406303 2:41646538-41646560 TTCACAAGCCAGCACATGGAAGG - Intergenic
929757727 2:44781312-44781334 TGCCCCAGGCTGAACATTGCAGG + Intergenic
930230108 2:48834840-48834862 GTCCCAAGGCTGCACAGAACAGG - Intergenic
930293974 2:49530369-49530391 GTCCCTAGGCTGCACACTGCAGG + Intergenic
930419550 2:51134083-51134105 TACTCACAGCTGCACATGGCTGG - Intergenic
930427877 2:51234363-51234385 GTCCCTAGGCTGCACACAGCAGG + Intergenic
930512067 2:52358392-52358414 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
930687509 2:54325371-54325393 GTTCCAAGGCTGCACAGAGCTGG - Intergenic
931041404 2:58305066-58305088 CTCCTAAGGCTGCACACAGCAGG - Intergenic
931257388 2:60585230-60585252 TTCCAAAGGCTGCTGATGGGAGG + Intergenic
931494135 2:62783673-62783695 GTCCCAAGGCTGCACACAGCAGG + Intronic
932552506 2:72785672-72785694 ATCCCTAGGCTGCACACAGCAGG + Intronic
932960356 2:76406305-76406327 TTCCCAATGCTGCCCAATGCTGG - Intergenic
933285183 2:80377758-80377780 TTTCCATGGCGACACATGGCCGG + Intronic
934031451 2:88051790-88051812 TTTCCATGGCTTGACATGGCTGG - Intronic
934054965 2:88243855-88243877 GTCCCTAGGCTGCACACAGCAGG - Intergenic
935531207 2:104234579-104234601 TTCCCAAATATGCACATTGCAGG + Intergenic
936257512 2:110929711-110929733 GTCCCTAGGCTGCACACAGCAGG - Intronic
936685538 2:114822357-114822379 GTCCCTAGGCTGCACACAGCAGG + Intronic
936753684 2:115678319-115678341 GTCCCAAGGCTGCACACAGCAGG - Intronic
937450845 2:122001079-122001101 TTCCCAAGGCATGACATGGGTGG + Intergenic
937800580 2:126076786-126076808 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
938084310 2:128388723-128388745 TTCCCCGGACTGCACCTGGCAGG - Intergenic
939110385 2:137999574-137999596 TTTCCAAGGCTGCACATAGCAGG - Intronic
940505317 2:154546503-154546525 GTCCCTAGGCTGCACACAGCAGG - Intergenic
940630681 2:156234502-156234524 TTACCAAAGCAGCACATGACTGG + Intergenic
940691311 2:156923989-156924011 GTTCCAAGGCTGCACACAGCAGG - Intergenic
940717704 2:157246393-157246415 TTCCCAGGGCAGCACCTGGGAGG + Intergenic
941512987 2:166437178-166437200 GTCCCTAGGCTGCACACAGCAGG - Intronic
941526959 2:166618193-166618215 ATCGCAAGGCTGCACACAGCAGG - Intergenic
941682654 2:168415303-168415325 GTCCCAAGGCTGCACACAGCAGG + Intergenic
941967243 2:171312409-171312431 ATCCCAAGGCTGCACACAGCAGG - Intergenic
942749025 2:179267196-179267218 TTTACAAGGCTGCATATGGGGGG - Intergenic
942846189 2:180428785-180428807 GTCCCAAGGTTGCACACAGCAGG + Intergenic
942880753 2:180857897-180857919 ATCCCTAGGCTGCACACAGCAGG + Intergenic
942904769 2:181167091-181167113 GTCCCTAGGCTGCACACAGCAGG + Intergenic
943372079 2:187028165-187028187 ATCCCAAGGCTTCACAGAGCAGG - Intergenic
943568768 2:189547316-189547338 TTCCATAGGCTGCTAATGGCTGG + Intergenic
943804883 2:192111783-192111805 CTCCCTAGCCTGCACATAGCAGG - Intronic
944010174 2:194965285-194965307 GTCCCTAGGCTGAACATAGCAGG + Intergenic
944011489 2:194979727-194979749 GTCCCAAGGCTGCATAGAGCAGG + Intergenic
944477945 2:200126056-200126078 TTCCCAAGGCTGTACACAGAAGG + Intergenic
945336641 2:208600077-208600099 ATCCCAAGGCTGCACAGAGCAGG + Intronic
945456317 2:210056054-210056076 ACCCCAAGGCTGCACAGAGCAGG - Intronic
946108278 2:217391140-217391162 GTCCCTAGGCTGCACACAGCAGG + Intronic
946844862 2:223850336-223850358 GACCCTAGGCTGCACATAGCAGG - Intergenic
947024049 2:225716578-225716600 GTCCCAAGTGTCCACATGGCAGG + Intergenic
947886543 2:233576558-233576580 GTCCCTAGGCTGCACACAGCAGG + Intergenic
947893461 2:233646198-233646220 GTCCCTAGGCTGCACACAGCAGG + Intronic
948699693 2:239751870-239751892 TCCCCAAGCCTGCACAGTGCAGG - Intergenic
948878890 2:240845729-240845751 GTTCCAAGGCTGCACACAGCAGG - Intergenic
949037051 2:241820776-241820798 AGGCCGAGGCTGCACATGGCCGG - Intergenic
1169592811 20:7163940-7163962 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1169593961 20:7176960-7176982 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1171568300 20:26217585-26217607 TTCCCAAGGCTGTGCATGTGAGG - Intergenic
1172973547 20:38890348-38890370 TGCACAAGGCTGCACGAGGCTGG + Intronic
1174524958 20:51163350-51163372 GCACCAAGGCTGCAGATGGCTGG + Intergenic
1176172141 20:63700871-63700893 AGCCCGAGGCTGAACATGGCTGG + Intronic
1177259569 21:18712525-18712547 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
1177548737 21:22593924-22593946 TACCCAAGACTCCACATGGCTGG + Intergenic
1177881714 21:26702549-26702571 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1178011359 21:28290354-28290376 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1178037428 21:28600450-28600472 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1178682029 21:34680322-34680344 GTCCCTAGGCTGCACACAGCAGG + Intronic
1178799839 21:35783100-35783122 AGCCTAAGGCTGCAAATGGCTGG + Intronic
1180152982 21:45961563-45961585 GTCCCAAGGCTGCACACTGCAGG + Intergenic
1182024450 22:27107043-27107065 TTCCCAAGGCTTCCCTTGACAGG + Intergenic
1183107618 22:35626191-35626213 CTCCCAAGGCTGTCCATGCCTGG - Intronic
1183935971 22:41262535-41262557 TTAGCAAAGCCGCACATGGCGGG + Intronic
1184338852 22:43874388-43874410 GTCCTAAGGCTGCACACAGCAGG - Intergenic
1184734856 22:46391989-46392011 CTCCCAAGGCCCCACAAGGCCGG + Intronic
1184942359 22:47778366-47778388 CTCCCAAGGCTCCAGAGGGCAGG + Intergenic
950412184 3:12846200-12846222 GTCCCTAGGCTGCACACTGCAGG - Intronic
951640535 3:24830025-24830047 AGCGCCAGGCTGCACATGGCAGG + Intergenic
951801767 3:26603916-26603938 GTCCCTAGGCTGCACACAGCAGG + Intergenic
952624905 3:35392347-35392369 GTCCCTAGGCTGCACACAGCAGG + Intergenic
952831435 3:37568279-37568301 GTCCCTAGGCTGCACAGAGCAGG + Intronic
955203778 3:56876740-56876762 TTCCCATGGGAGCACATGGCTGG - Intronic
955826268 3:62951269-62951291 GTCCCTAGGCTGCACACAGCAGG - Intergenic
956238942 3:67107383-67107405 ATCCCAAGGCTGTGCATGTCAGG + Intergenic
956327544 3:68070388-68070410 ATCCCTAGGCTGCACACAGCAGG + Intronic
956847697 3:73198250-73198272 TGCTCAAGGGTGCACATGGCTGG + Intergenic
957110550 3:75950748-75950770 TTCCCAAGGCTGTGCATGTGAGG + Intronic
957490556 3:80921507-80921529 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
957676802 3:83377629-83377651 GTCCCAAGGCTGCATAGGGTAGG + Intergenic
957765765 3:84621988-84622010 GTCCCAAGGCTGCATACAGCAGG + Intergenic
957982255 3:87525405-87525427 GTCCCAAGGCTGCACAGAGATGG - Intergenic
958890268 3:99775344-99775366 TTCCCAAACATGCACATGGATGG - Intronic
959803553 3:110524748-110524770 GTCCCTAGGCTGCACACAGCAGG - Intergenic
959846570 3:111040391-111040413 GTCCCTAGGCTGCACACAGCAGG - Intergenic
960089826 3:113627947-113627969 CTCCCAAAGCTGCAGATGGAAGG - Exonic
960255346 3:115505719-115505741 GTCTCAAGGCTGCACATAGCAGG - Intergenic
960341345 3:116478929-116478951 GTCCCTAGGCTGCACACAGCAGG - Intronic
962066974 3:131991798-131991820 ATCCTAAGGCTGCACAGAGCAGG - Intronic
962162200 3:133011849-133011871 GTCCCTAGGCTGCACATAGCAGG + Intergenic
962460985 3:135612564-135612586 GTCCCTAGGCTGCACACAGCAGG - Intergenic
962646447 3:137445270-137445292 GCCCCAAGGCTGCACAGAGCAGG + Intergenic
963516609 3:146316879-146316901 GTCCCAAGGCTGCATAGAGCTGG + Intergenic
963671585 3:148258339-148258361 GTCCCAAGGCTGCACAAAGCAGG - Intergenic
964134786 3:153332618-153332640 ATTCCAAGGCTGTACTTGGCTGG - Intergenic
964605500 3:158556151-158556173 GTCCCTAGGCTGCACAGAGCAGG - Intergenic
965031102 3:163369347-163369369 GTCCCAAGGCTGCACACAGCAGG + Intergenic
965270734 3:166614044-166614066 GTCCCTAGGCTGCACAAAGCTGG + Intergenic
965729891 3:171760686-171760708 TTACCAAGGGAGCACCTGGCAGG + Intronic
965854647 3:173073439-173073461 GTCCCTAGGCTGCACACAGCAGG - Intronic
967216811 3:187218177-187218199 TTTCCAAAGCAGCACTTGGCAGG + Intronic
967331135 3:188290881-188290903 TTCCTCAGTCTGCACATGCCTGG + Intronic
967412531 3:189181109-189181131 GTCCCTAGGCTGCACAAGGATGG + Intronic
967453333 3:189651775-189651797 GTCCCGAGGCTGCACAGAGCAGG - Intronic
967547801 3:190752221-190752243 GTGCCAAGGCTGCACATGTGTGG - Intergenic
968175898 3:196549288-196549310 GTCCCTAGGCTGCACACAGCAGG - Intergenic
969227738 4:5810129-5810151 CTCCCAAGCCTGCACAAGCCAGG - Intronic
970756815 4:19437193-19437215 ATCCCAAGGCTGCACACAGCAGG - Intergenic
970788464 4:19828484-19828506 GTCCCAAGGCTGCACAGAGTAGG - Intergenic
970999244 4:22303843-22303865 ATCCCTAGGCTGCACACAGCAGG - Intergenic
971093197 4:23369520-23369542 TTCCCAAGGCCCCAGCTGGCAGG - Intergenic
971358400 4:25914546-25914568 GTCACAAAGCTGCACATGGCAGG - Intronic
971522779 4:27575485-27575507 TTTCCAAGGTTTCACATAGCTGG - Intergenic
971561550 4:28084598-28084620 GTCCCAAGGCTGCACACAGCAGG + Intergenic
971631447 4:28998462-28998484 CTCCCAAGGCTGCACAGAGCAGG - Intergenic
971681517 4:29706844-29706866 GTCCCTAGGCTGCACACAGCAGG + Intergenic
972174504 4:36386792-36386814 TCCCCAAGGCTCCCCATGGAAGG - Intergenic
972301205 4:37787320-37787342 GTCCCTAGGCTGCACACAGCAGG - Intergenic
972832672 4:42832721-42832743 GTCCCTAGGCTGCACAGAGCAGG - Intergenic
974171235 4:58269958-58269980 GTCCCTAGGCTGCACACAGCAGG - Intergenic
974311003 4:60209806-60209828 GTTCCAAGGCTGCACAGAGCAGG + Intergenic
974322483 4:60369274-60369296 TTCCCTAAGCTGCACACAGCAGG - Intergenic
974666576 4:64969707-64969729 GTCCTGAGGCTGCACATAGCAGG + Intergenic
974742275 4:66022019-66022041 GTTCCAAGGCTGCACAGAGCAGG + Intergenic
974748125 4:66102693-66102715 GTCCCTAAGCTGCACATAGCAGG - Intergenic
974923479 4:68270390-68270412 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
975040471 4:69739518-69739540 GTCCCTAGACTGCACATAGCAGG + Intronic
975361337 4:73475299-73475321 ATCCCAAGGCTTCACACAGCAGG + Intergenic
976442246 4:85089007-85089029 GTCCCAAGGCTGCACACAGCAGG - Intergenic
976952437 4:90850001-90850023 GTCCCAAGGCTGCACAGAGCAGG - Intronic
977041479 4:92024629-92024651 TTTCCTAGGCTGCACACAGCAGG + Intergenic
977349777 4:95867681-95867703 TTCCACAGGCTGTACATGGCAGG - Intergenic
977702538 4:100036331-100036353 ATCCCTAGGCTGCACACAGCAGG + Intergenic
978234963 4:106446962-106446984 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
978697098 4:111595657-111595679 TCCCAACAGCTGCACATGGCAGG + Intergenic
979700041 4:123656892-123656914 GTCCCTAGGCTGCACACAGCAGG + Intergenic
979867630 4:125776369-125776391 GTCCCTAGGCTGCACACAGCAGG - Intergenic
980242240 4:130191610-130191632 GTCCCAAGGCTGCACACAGTTGG + Intergenic
980292421 4:130860283-130860305 GTCCCTAGGCTGCACACAGCAGG - Intergenic
980386046 4:132089035-132089057 GTCCCAAGTCTGCACACAGCAGG - Intergenic
980532599 4:134073894-134073916 GTCCCGAGGCTGCACAGAGCAGG + Intergenic
980646086 4:135644058-135644080 GTCCCTAGGCTGCACAGAGCAGG - Intergenic
982854392 4:160362634-160362656 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
983874726 4:172862917-172862939 GTCCCTAGGCTGCACATAGCAGG - Intronic
984065564 4:175043733-175043755 GTCCTGAGGCTGCACAGGGCAGG - Intergenic
985474095 5:68462-68484 GTCCCTAGGCTGCACATAGCAGG - Intergenic
985541795 5:490832-490854 TTCCCTGGGCTGCACCTGGTGGG + Intronic
985588993 5:755197-755219 CTCCCCAGGCCGCACAGGGCTGG - Intronic
985603673 5:847713-847735 CTCCCCAGGCCGCACAGGGCTGG - Intronic
985710262 5:1423943-1423965 TCCCCAAGGCTGCATTCGGCCGG - Intronic
986495043 5:8333023-8333045 TTACCAAGACTGCACATGTTTGG + Intergenic
986630578 5:9768194-9768216 ACCCGAAGTCTGCACATGGCTGG + Intergenic
986688951 5:10298025-10298047 TTCCCACTGCTGGACCTGGCTGG - Intronic
987216602 5:15743982-15744004 GTCCCAAGGCTGCACACATCAGG + Intronic
987514574 5:18888921-18888943 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
987526676 5:19059600-19059622 TTCACATTGCTGCAAATGGCAGG + Intergenic
988172979 5:27683079-27683101 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
988858569 5:35253093-35253115 GTCCCAAGGCTGCACACAGTAGG + Intergenic
988911247 5:35845913-35845935 ATGCCAAGGCTGCACGTAGCAGG + Intergenic
989170068 5:38465104-38465126 TTCCCAAGGCTGTGCAGGGGTGG + Intergenic
989726884 5:44597535-44597557 GTCCCAAGGCTGCACACAGCAGG + Intergenic
989753385 5:44922519-44922541 GTCCCAAGGCTGCACAGAGTAGG - Intergenic
989787104 5:45345216-45345238 GTCCCTAGGCTGCACACAGCAGG + Intronic
990083374 5:51944695-51944717 GTCCCAAGGCTGCAGAGAGCAGG - Intergenic
990143345 5:52730971-52730993 GTCCTGAGGCTGCACATAGCAGG - Intergenic
990264521 5:54061152-54061174 GTCCCTAGGCTGCACACAGCTGG - Intronic
990903611 5:60779583-60779605 GTCCCTAGGCTGCACACAGCAGG + Intronic
991039157 5:62158595-62158617 GTCCCTAGGCTGCACACAGCAGG - Intergenic
992954173 5:81890827-81890849 GTCCTAAGACTGCACATAGCAGG - Intergenic
993015690 5:82532235-82532257 GTCCCTAGGCTGCACACAGCAGG + Intergenic
993036939 5:82769158-82769180 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
993561630 5:89417707-89417729 GTCCCAAGGCTGCACACAGCAGG - Intergenic
993743337 5:91565526-91565548 GTCCCAAGGCTGCATAGAGCAGG + Intergenic
993776967 5:92012044-92012066 GTCCCTAGGCTGCACACAGCAGG - Intergenic
994018953 5:95001972-95001994 GTCCCAAGGCTGCATAGAGCAGG - Intronic
994696054 5:103074568-103074590 GTCCCTAGGCTGCACAGAGCAGG - Intergenic
994971188 5:106740605-106740627 TTCCCAGATTTGCACATGGCTGG + Intergenic
995212028 5:109551468-109551490 GTCCCTAGGCTGCACACAGCAGG - Intergenic
995393195 5:111661343-111661365 GTCCCTAGGCTGCACACAGCAGG + Intergenic
995424921 5:112010303-112010325 TCTCCAAGGCTGCAAATGACAGG + Intergenic
995995979 5:118299956-118299978 TTCCGCAGGCAGCAGATGGCTGG - Intergenic
996192619 5:120564236-120564258 TTCCCAAAACTGCTCCTGGCTGG + Intronic
996246597 5:121271601-121271623 TTCCATAGGCTGCACACAGCTGG + Intergenic
996255859 5:121402533-121402555 ATCTCTAGGCTGCACATAGCAGG - Intergenic
996356476 5:122601070-122601092 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
996897618 5:128503960-128503982 GTCCCAAGGCTGCATAGAGCGGG - Intronic
997052374 5:130398295-130398317 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
997637913 5:135428277-135428299 CTCCCCAGGCTGCCCATGGCTGG + Intergenic
998980005 5:147691556-147691578 TACCCAAGGCTGCACAAAGCTGG + Intronic
998980533 5:147697582-147697604 GTCCCCAGGCTGCACACAGCAGG - Intronic
1002159805 5:177308312-177308334 TTCCCATGACAGCACATGCCTGG - Intronic
1002824538 6:761146-761168 TTCCCTAGGCTGCAGGGGGCAGG + Intergenic
1003879626 6:10468178-10468200 TTGCCAACACTTCACATGGCTGG - Intergenic
1004834542 6:19516140-19516162 ATCCCTAGGCTGCACAGAGCCGG - Intergenic
1005783391 6:29217479-29217501 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1007223445 6:40296534-40296556 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1007723345 6:43899184-43899206 TTCCCAAGGCCTCAGATGGGAGG - Intergenic
1008332765 6:50262687-50262709 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1009501560 6:64420269-64420291 TTCCCTAGGCTGCATACAGCCGG + Intronic
1009699715 6:67160775-67160797 TTTCCAAGGCTGCACAGAGCAGG - Intergenic
1009795121 6:68456465-68456487 TTCCTAAGGCTTCCCTTGGCTGG + Intergenic
1009982436 6:70741989-70742011 GTCCCTAGGCTGCACACAGCAGG + Intronic
1010055101 6:71556072-71556094 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1010594612 6:77748489-77748511 GTCCCTAGGCTGCACAGAGCAGG + Intronic
1010631838 6:78207707-78207729 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1010900524 6:81422626-81422648 GTCCCAAGGCTGTACAGAGCAGG - Intergenic
1011031703 6:82931022-82931044 ATCCCTAGGCTGCACATAGCAGG - Intronic
1011041124 6:83031770-83031792 GTCCCTAGGCTGCACACAGCAGG - Intronic
1011347676 6:86389689-86389711 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1011513843 6:88130401-88130423 CTGCCAAAGCTGCATATGGCTGG - Intergenic
1012202560 6:96424348-96424370 GTCACTAGGCTGCACATTGCAGG + Intergenic
1012690787 6:102308354-102308376 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1012706529 6:102538764-102538786 GTCCCAAGGCTGCACACAGCAGG - Intergenic
1013680028 6:112514828-112514850 TTCCCACAGCTGAACATTGCTGG - Intergenic
1014407442 6:121068968-121068990 ATCCCAAGGCTGCGCACAGCAGG - Intergenic
1014951177 6:127558055-127558077 GTCCCTAGGCTGCACACAGCAGG - Intronic
1015013212 6:128376436-128376458 GTCCCTAGGCTGCACAGAGCAGG + Intronic
1015713143 6:136163412-136163434 GTCCCAAGGCTGCACAGAGCTGG + Intronic
1016175206 6:141071517-141071539 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1016682365 6:146845429-146845451 GTCCCCAGGCTGCACATAGCAGG + Intergenic
1016790247 6:148060269-148060291 GTCCTAAGGCTGCACACAGCAGG + Intergenic
1016987868 6:149908702-149908724 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1018086318 6:160303962-160303984 GTCCCAAGGCTGCACATAGCAGG + Intergenic
1018585155 6:165349725-165349747 GTCCCAAGGCTGCATAGAGCAGG - Intronic
1018867675 6:167758681-167758703 TTCCCAAGGCTTCACTGGGATGG + Intergenic
1020407711 7:7855559-7855581 ATCCCAAGGCTGCACACAGCAGG + Intronic
1020958762 7:14776472-14776494 GTCCCTAGGCTGCACACAGCAGG - Intronic
1021323511 7:19239990-19240012 GTCCTGAGGCTGCACATAGCAGG + Intergenic
1021326347 7:19273708-19273730 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1022563116 7:31370763-31370785 CTGCCTGGGCTGCACATGGCAGG - Intergenic
1022607824 7:31833974-31833996 GTCCCTAGGCTGCACACAGCAGG - Intronic
1023208395 7:37776149-37776171 TTCCCTAGGCTGCACACAGCAGG - Intronic
1023804076 7:43858931-43858953 GTCCCTATGCTGCACATAGCAGG - Intergenic
1024383553 7:48725635-48725657 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1024384723 7:48738567-48738589 GTCCCAAGACTGCACAGAGCAGG - Intergenic
1024415966 7:49107647-49107669 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1024667241 7:51559232-51559254 GTCCCAAGGATGCACAGAGCAGG - Intergenic
1024792752 7:52985350-52985372 GTCCCTAGGCTGCACAAAGCAGG - Intergenic
1024948198 7:54833169-54833191 GTCCCCTGGCTGCACAGGGCGGG - Intergenic
1025021893 7:55486822-55486844 TGCCCAGGGCAGCACAGGGCAGG + Intronic
1025190997 7:56895771-56895793 TACCCAAGGATGCTCGTGGCAGG - Intergenic
1025680948 7:63681158-63681180 TACCCAAGGATGCTCGTGGCAGG + Intergenic
1026946402 7:74319041-74319063 TTCACAAGGCTGCACTGGGCAGG - Intronic
1027463692 7:78487221-78487243 TTTCTAAGGCTGCACAGGGAAGG + Intronic
1027778293 7:82492929-82492951 TTCTCAAGGCTTCCCTTGGCTGG + Intergenic
1027993577 7:85395428-85395450 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1028048363 7:86152136-86152158 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1028143767 7:87299106-87299128 GTCCCTAGGCTGCACAAAGCAGG + Intergenic
1028178954 7:87693912-87693934 TTCCCAAAGTTGCAGATGGCTGG + Exonic
1028524604 7:91769611-91769633 TTCCCAAGCCTGCTCCTGGTTGG - Intronic
1028708096 7:93874395-93874417 GTCCCTAGGCTGCACACAGCAGG - Intronic
1030108830 7:106009326-106009348 GTCCCAAGGCTGCATAAGGGCGG + Intronic
1030415455 7:109238065-109238087 GTCCCAAGGCTGCACACAACAGG - Intergenic
1030722415 7:112885147-112885169 GTCTCAAGGCTGCACAGGGCAGG + Intronic
1030851079 7:114487335-114487357 GTCCCTAGGCTGCACACAGCAGG + Intronic
1031194176 7:118591130-118591152 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1031238653 7:119210760-119210782 TTCTCCAGGCTGCACACAGCAGG - Intergenic
1031287303 7:119886145-119886167 CTCCCTAGGCTGCACACAGCAGG + Intergenic
1031473134 7:122191261-122191283 GTCCCTAGGCTGCACATAGTGGG - Intergenic
1033517942 7:142128554-142128576 GTCCCTAGGCTGCACAGAGCAGG - Intronic
1033777525 7:144629276-144629298 ATCCCGAGGCTGCACAGAGCAGG - Intronic
1033953305 7:146812840-146812862 CTCCCGAGGCTGCACAGAGCAGG - Intronic
1034040766 7:147874520-147874542 GTCCCTAGGCTGCACACAGCAGG + Intronic
1034209324 7:149349148-149349170 GTCCCAAGGCTGCATAAAGCAGG + Intergenic
1034672745 7:152870520-152870542 CTCCCAGGGCTGGACATGGAAGG + Intergenic
1034718391 7:153264592-153264614 GTCCCTAGGCTGCACATAGCAGG + Intergenic
1035224444 7:157425630-157425652 TTCCCAGGGCTGCTCCTGTCTGG + Intergenic
1035289916 7:157831321-157831343 TATTCACGGCTGCACATGGCGGG - Intronic
1036106501 8:5846278-5846300 GTCCCAAGGCTGCATAGAGCAGG + Intergenic
1037108374 8:15137541-15137563 GTCCCTAGGCTGCACACAGCAGG - Intronic
1037946952 8:22995770-22995792 TGCCCCAGCCTGCACATGGCAGG + Intronic
1038357163 8:26840046-26840068 TTCTCAAGTTTGCACTTGGCTGG + Intronic
1039210200 8:35204807-35204829 ACCCCAAGCATGCACATGGCTGG + Intergenic
1039498425 8:37998573-37998595 TGCACAAGGTTGCACATGGATGG - Intergenic
1039511345 8:38094590-38094612 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1040644978 8:49387822-49387844 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1041497539 8:58503351-58503373 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1041849836 8:62378543-62378565 GTCCCAAGACTGCACACAGCAGG - Intronic
1042080630 8:65047136-65047158 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1042529041 8:69796028-69796050 GTCCCAAGATTGCACAGGGCAGG + Intronic
1043308186 8:78823356-78823378 GTCCCTAGGCTGCACATAACAGG - Intergenic
1043370307 8:79583737-79583759 GTTCCAAGGCTGCACAGAGCAGG - Intergenic
1043426080 8:80150088-80150110 GTCCCTAGGCTGCACACAGCAGG - Intronic
1044051794 8:87515047-87515069 GTCTCAAGGCTGCACAGAGCAGG - Intronic
1045422181 8:102027030-102027052 GTCCCAAGGCTGCACAGGGCAGG + Intronic
1045785724 8:105918444-105918466 GTCTCAAGGCTGCACACAGCAGG - Intergenic
1045884445 8:107079011-107079033 GTCCCGAGGCTGCACATAGCAGG + Intergenic
1046170352 8:110497763-110497785 GTCCCAAGGCTTCACACAGCAGG - Intergenic
1046264587 8:111814445-111814467 GTCCCAAGGCTGCATAGAGCAGG + Intergenic
1046600863 8:116315489-116315511 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1046607536 8:116388331-116388353 ATCCCAAGGCTGCACACAGCAGG - Intergenic
1046917373 8:119691951-119691973 GTCCCAAGGCTGCACACAGCAGG - Intergenic
1047918078 8:129604044-129604066 GCCCCAAGGCTGCACAGAGCAGG + Intergenic
1047996723 8:130343526-130343548 TTTCCTAGGCTGCCCAGGGCTGG + Intronic
1048107542 8:131427756-131427778 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1048213719 8:132478266-132478288 TTCCCCAGACTGGACAAGGCAGG + Intronic
1048554976 8:135466912-135466934 TTCCCTCATCTGCACATGGCAGG + Intronic
1048658555 8:136571240-136571262 GTCCCAAGGCTGCACACAGCAGG - Intergenic
1048729218 8:137418977-137418999 GTCCCAAGGCTGCACATGCAGGG + Intergenic
1049095510 8:140545917-140545939 TTCCCCAGGCAGCACGTGGGAGG + Intronic
1050924517 9:11247238-11247260 TTCCCAAGGATTTAAATGGCTGG + Intergenic
1052053988 9:23882856-23882878 GTCCCTAGGCTGCACATAGCAGG + Intergenic
1052093473 9:24357303-24357325 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1052272015 9:26636948-26636970 GTCCAAAGGCTCCACATTGCAGG + Intergenic
1052621078 9:30911077-30911099 TTCCCAAGGATGAATAGGGCAGG + Intergenic
1052625986 9:30978253-30978275 GTCCCTAGGCTGCACAAAGCAGG - Intergenic
1053384203 9:37673855-37673877 GTCCCTAGGCTGCACACAGCAGG + Intronic
1056325503 9:85475121-85475143 GTCCCAAGGCTGCATAGGTCAGG - Intergenic
1057285373 9:93749267-93749289 GTCCCAAGGCTGCACACAGCAGG + Intergenic
1058149889 9:101452561-101452583 GTCCCTAGGCTGCACAGGGCAGG - Intergenic
1059045444 9:110861593-110861615 GTCCCTAGGCTGCACACAGCTGG - Intergenic
1059069528 9:111120659-111120681 GTCCCGAGGCTGCACACAGCAGG + Intergenic
1059082618 9:111266174-111266196 ATCCCTAGGCTGCACACAGCAGG + Intergenic
1059392336 9:114007130-114007152 TCCCCAAGGCTGCTCATCACCGG + Intronic
1060657041 9:125379122-125379144 TTCCCATGGCTCCCCATGGAGGG + Intergenic
1061620843 9:131810399-131810421 TTCCCCAGGCTGTTCATCGCTGG + Intergenic
1062321169 9:135991121-135991143 TTCCCCAGGCTCCCCATGGCAGG + Intergenic
1062512447 9:136914233-136914255 TCCCCCAGGCTGCCCACGGCAGG - Intronic
1185797705 X:2981197-2981219 GTTCCAAGGCTGCACACAGCAGG - Intergenic
1186453545 X:9692729-9692751 TTAACAAGGCTGCATTTGGCAGG + Intronic
1187133623 X:16526202-16526224 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1187781778 X:22834912-22834934 TACTCAAGGCTCCACTTGGCTGG + Intergenic
1187894452 X:23967155-23967177 GTCCCTAGGCTGCACACGGCAGG + Intergenic
1188169886 X:26911580-26911602 GTCCCTAGGCTGCACATAGCAGG - Intergenic
1188187331 X:27130977-27130999 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1188624303 X:32265179-32265201 GTCCCTAGGCTGCACATAGCAGG - Intronic
1188755190 X:33953195-33953217 GTCCCTAGGCTGCACATAGCAGG + Intergenic
1188781777 X:34294845-34294867 GTCCCAAGGCTGCACACAGCGGG - Intergenic
1188926494 X:36050848-36050870 ATCCCTAGGCTGCACACAGCAGG - Intronic
1189071329 X:37866815-37866837 GTACCAAGGCTGCACAGAGCAGG + Intronic
1189152882 X:38725986-38726008 TTCCCAAGGCTGCACCTCATTGG - Intergenic
1189176586 X:38963636-38963658 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
1190485056 X:50915874-50915896 CACCCAGGGCTCCACATGGCAGG - Exonic
1191598477 X:62974488-62974510 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1191680014 X:63831223-63831245 GTCCCAAGGCTGTACAGAGCAGG - Intergenic
1192713609 X:73616778-73616800 GTCCCTAGGCTGCACACAGCAGG + Intronic
1192810949 X:74546940-74546962 TGGCCAAGGCTGGTCATGGCTGG - Intergenic
1193210485 X:78801729-78801751 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1193320374 X:80114740-80114762 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1193475652 X:81962153-81962175 TTCACATTGCTGCAAATGGCAGG - Intergenic
1193543029 X:82794773-82794795 CTCCCTAGGCTGCACAGAGCAGG - Intergenic
1193816231 X:86107645-86107667 GTCCCAAGGCTGCACACAGCTGG + Intergenic
1193840719 X:86405044-86405066 TTCCCAAGGCTGCACATGGCAGG + Intronic
1193865093 X:86721051-86721073 GTCCCTAGGCTGCACACAGCAGG + Intronic
1193887980 X:87006696-87006718 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1194253998 X:91613861-91613883 GTCCCTAGGCTGCACACAGCAGG + Intergenic
1194413092 X:93579087-93579109 CTCCCATGGCTGCCCATGGGAGG + Intergenic
1194495897 X:94616223-94616245 GTCCCAAGGCTGCACAGAGCAGG + Intergenic
1194560291 X:95411683-95411705 GTCCCAAGGCTGCACACAGCAGG - Intergenic
1194624595 X:96213504-96213526 GTCCCAAGGCTGCACAGATCGGG + Intergenic
1194905920 X:99576272-99576294 CTCCCAAGGCTGCACAGAGCAGG - Intergenic
1194929391 X:99867774-99867796 GTCTCAAGGCTGCACAGAGCAGG - Intergenic
1196136919 X:112220380-112220402 GTCCCAAGGCTGCACACAGTAGG + Intergenic
1196313532 X:114196769-114196791 ATCCCAAGGCTGCAAACAGCAGG + Intergenic
1196565188 X:117196721-117196743 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1197023494 X:121718275-121718297 ATCCCTAGGCTGCACATAGCAGG + Intergenic
1197442868 X:126512101-126512123 GTCTCTAGGCTGCACATAGCAGG + Intergenic
1197583246 X:128311090-128311112 GTCCAAAGGCTGCACAGAGCTGG + Intergenic
1197863562 X:130995472-130995494 TGCATAAGGGTGCACATGGCAGG - Intergenic
1198566038 X:137906593-137906615 GTCCCAAGGCTGCATAGAGCAGG - Intergenic
1198803939 X:140475239-140475261 GTCCCAAGGCTCCACACAGCAGG - Intergenic
1199060586 X:143351075-143351097 GTCCCTAGGCTGCACAGAGCAGG + Intergenic
1199083686 X:143605794-143605816 GTCCCAAGGCTGCACAGAGCAGG - Intergenic
1199317737 X:146400478-146400500 GTCCCTAGGTTGCACATAGCGGG - Intergenic
1199330139 X:146549912-146549934 TTTCATAGGCTGTACATGGCTGG + Intergenic
1199458741 X:148059536-148059558 GTCCCAAGACTGCACATAGCAGG + Intergenic
1199560687 X:149159665-149159687 GTCCCAAGGCTGCATAGAGCAGG + Intergenic
1199580745 X:149357792-149357814 GTCCCTAGGCTGCACACAGCAGG - Intergenic
1199585572 X:149412727-149412749 TTCCCACAGCTTCACAAGGCAGG - Intergenic
1199858871 X:151781717-151781739 CTCCCATGGCTGCCCATTGCAGG + Intergenic
1199928399 X:152493916-152493938 GTCCCTAGGCTGCACATAGCAGG - Intergenic
1200130949 X:153845472-153845494 GTCCCAAGGATGCAGAGGGCGGG - Intergenic
1200356988 X:155562348-155562370 TTCCCAAGGCTGCACAGAGCAGG + Intronic
1200572782 Y:4853438-4853460 GTCCCTAGGCTGCACACAGCAGG + Intergenic