ID: 1193842615

View in Genome Browser
Species Human (GRCh38)
Location X:86426151-86426173
Sequence GTGTACACATAAAGTTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193842614_1193842615 -9 Left 1193842614 X:86426137-86426159 CCTATATGGACTTTGTGTACACA 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1193842615 X:86426151-86426173 GTGTACACATAAAGTTAGCTAGG 0: 1
1: 0
2: 1
3: 10
4: 178
1193842613_1193842615 -8 Left 1193842613 X:86426136-86426158 CCCTATATGGACTTTGTGTACAC 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1193842615 X:86426151-86426173 GTGTACACATAAAGTTAGCTAGG 0: 1
1: 0
2: 1
3: 10
4: 178
1193842612_1193842615 -2 Left 1193842612 X:86426130-86426152 CCTCTTCCCTATATGGACTTTGT 0: 1
1: 0
2: 0
3: 19
4: 162
Right 1193842615 X:86426151-86426173 GTGTACACATAAAGTTAGCTAGG 0: 1
1: 0
2: 1
3: 10
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193842615 Original CRISPR GTGTACACATAAAGTTAGCT AGG Intronic
902523416 1:17036472-17036494 CTCTACAAAAAAAGTTAGCTGGG - Intronic
904656060 1:32048336-32048358 GTCTCTACAAAAAGTTAGCTGGG + Intronic
908841698 1:68286436-68286458 ATATAAAAATAAAGTTAGCTGGG - Intergenic
910346045 1:86239822-86239844 GTGTACATATAAAGTAAACAGGG - Intergenic
910977010 1:92917401-92917423 ATGTACACATATAGATAGATAGG + Intronic
911566537 1:99468979-99469001 ATGTACAAAAAAAATTAGCTGGG - Intergenic
917862995 1:179165954-179165976 GTGAATACAAAAAATTAGCTGGG - Intronic
918393315 1:184088991-184089013 GTGTACACAGCAAATGAGCTTGG + Intergenic
919224148 1:194672864-194672886 GTATAAAAATAAAGTTAGATTGG - Intergenic
919279684 1:195472696-195472718 GTATATACATAAAGTTAGACAGG + Intergenic
919653621 1:200176342-200176364 GGGTACACATTAGGTAAGCTGGG + Exonic
922010679 1:221582263-221582285 GTGAACAAAGAAAGTTAGTTAGG + Intergenic
922031451 1:221803855-221803877 GTGTCTACAAAAAATTAGCTGGG - Intergenic
922116934 1:222622194-222622216 GGGTACCCATAAAATCAGCTGGG - Intronic
924537784 1:244952205-244952227 AAATAAACATAAAGTTAGCTGGG + Intergenic
1064389235 10:14927220-14927242 GAAAACACAAAAAGTTAGCTCGG + Intronic
1065343477 10:24726227-24726249 GTACAAACAAAAAGTTAGCTGGG + Intergenic
1066207946 10:33208219-33208241 GTCTCCACAAAAAATTAGCTCGG - Intronic
1066343349 10:34557771-34557793 GTAAAAACATAAAATTAGCTAGG + Intronic
1068249285 10:54416122-54416144 GTGTATATATATATTTAGCTTGG - Intronic
1070824922 10:79385540-79385562 GGGTCCACATCAAGATAGCTGGG - Exonic
1071347238 10:84704356-84704378 GTGGTCACAGAAAGTCAGCTGGG - Intergenic
1074603932 10:114941636-114941658 TTGTAAACATAAAGTGAGCCGGG - Intronic
1078243667 11:9553130-9553152 CTCTACACAAAAAGTTAGCTGGG + Intergenic
1082077690 11:47987045-47987067 GTCTATACAAAAAATTAGCTGGG + Intronic
1087044828 11:93836256-93836278 GTGTAGACAGTAAGTTAGCGGGG - Intronic
1087375089 11:97329737-97329759 CTCTATACAAAAAGTTAGCTGGG + Intergenic
1087860125 11:103142803-103142825 GTTTATACTTAAAGTTAGTTGGG - Intronic
1089082150 11:115785456-115785478 GTGTACACACAAATACAGCTGGG - Intergenic
1094646466 12:32329263-32329285 GTCTCCACAAAAAGTTAGCCAGG - Intronic
1095225214 12:39671210-39671232 GTGTATCCATAAAGTTGGTTGGG + Intronic
1106302579 13:28482684-28482706 CTGTAGAAATAAAGTTTGCTTGG - Intronic
1107830123 13:44367642-44367664 CTGTACACAAAAAATTAGCCAGG - Intergenic
1108118575 13:47159034-47159056 ACGTAGACATAAAGTTTGCTTGG - Intergenic
1109595807 13:64552122-64552144 CTGAACACCTAAAGTTAACTGGG - Intergenic
1113368043 13:109696215-109696237 GTGTACAGATGAAGTTGTCTTGG + Intergenic
1114257267 14:21013902-21013924 ATATACACAAAAAGCTAGCTGGG + Intergenic
1116582925 14:46664725-46664747 ATCTATACATGAAGTTAGCTAGG - Intergenic
1116888755 14:50246601-50246623 GTTTCTACACAAAGTTAGCTGGG - Exonic
1118147947 14:63160970-63160992 GTGTATACATAAAGTTTTATTGG - Intergenic
1118587237 14:67366239-67366261 CTCTACAAAGAAAGTTAGCTGGG - Intronic
1118935507 14:70284287-70284309 GTGTACACATAAATGTAGCCAGG - Intergenic
1119686633 14:76637821-76637843 ACGCACACATAAAATTAGCTGGG - Intergenic
1120710457 14:87787972-87787994 GTGTACACATCAGCTTGGCTAGG + Intergenic
1121182744 14:91941887-91941909 GTGTACACATGAAGACAGGTAGG - Intronic
1121277875 14:92679916-92679938 GTGAAGACATCAAGTTAGATTGG + Intronic
1122679315 14:103445454-103445476 GTGAATACATAAAGTTATTTGGG + Intronic
1127525685 15:59790452-59790474 ATATATACATAAAGTTAGCCGGG + Intergenic
1128442687 15:67727316-67727338 GTTTACAAATCAAGTTAGATTGG + Intronic
1128463018 15:67885216-67885238 GTGTACACAAAAAGTCAGGAAGG - Intergenic
1130339095 15:82984191-82984213 AAGTATACATAAAATTAGCTGGG - Intronic
1131773397 15:95765799-95765821 TTCTATATATAAAGTTAGCTTGG + Intergenic
1133955002 16:10434924-10434946 ATACACACAAAAAGTTAGCTGGG - Intronic
1134339079 16:13328571-13328593 GTATACACATATATTTAGCCAGG - Intergenic
1134762888 16:16729685-16729707 CTCTACAAAAAAAGTTAGCTGGG - Intergenic
1134983164 16:18629464-18629486 CTCTACAAAAAAAGTTAGCTGGG + Intergenic
1139951255 16:70672184-70672206 CTAAACACAAAAAGTTAGCTGGG + Intronic
1141223900 16:82097187-82097209 ATATACACAGAAATTTAGCTGGG - Intronic
1150029896 17:61721856-61721878 ATATACACAAAAAATTAGCTGGG - Intronic
1150052060 17:61974241-61974263 GTCTCTACAAAAAGTTAGCTGGG + Intronic
1150723246 17:67631178-67631200 TTGTACACATAAAGGTAACAAGG - Intronic
1152179809 17:78812230-78812252 GTGCACACAGAAAGTTTGCTTGG + Intronic
1153120270 18:1716209-1716231 GGGAACACATAAAGTGAGCCTGG - Intergenic
1154986653 18:21558144-21558166 CTGTACAAAAAAAGTTAGCTGGG - Intronic
1155421482 18:25661301-25661323 GTCTCCACAAAAAGTTAGCCTGG + Intergenic
1155762721 18:29587701-29587723 GTGCACACAGAAAATTTGCTAGG + Intergenic
1157925381 18:51759429-51759451 GAGTACACACATAGTTTGCTAGG - Intergenic
1158678320 18:59543122-59543144 TTTTACACAAAAAGTTACCTGGG + Intronic
1159062812 18:63533711-63533733 GGGTACACATAAAGGGAGGTGGG - Intergenic
1159763353 18:72455963-72455985 GTGTACACATATGGTATGCTGGG + Intergenic
1160204200 18:76820307-76820329 ATGTCCACAAAAAATTAGCTAGG + Intronic
1162767150 19:12926716-12926738 CTGTACAAATAAAATTAGCTGGG - Intronic
1162916917 19:13879565-13879587 GTGTCTACAAAAAATTAGCTGGG + Intronic
1163128717 19:15258755-15258777 GTCTGCACAAAAATTTAGCTGGG - Intronic
1163308540 19:16497944-16497966 GTTTCTACAAAAAGTTAGCTAGG + Intronic
1163309047 19:16501750-16501772 CTAAACACATAAAATTAGCTGGG - Intronic
1163999817 19:21087684-21087706 GTGAACATATAAAGTTAAATGGG - Intronic
1166967345 19:46537262-46537284 GTCTAGACAAAAAGTTAGCCAGG - Intronic
1168303869 19:55423183-55423205 ATGCACACAAAAAATTAGCTGGG - Intergenic
927906949 2:26865479-26865501 CTCTACACAAAAAATTAGCTGGG - Intronic
928787855 2:34911799-34911821 ATTTAAAAATAAAGTTAGCTAGG - Intergenic
929698829 2:44144101-44144123 GTGAAAAAATAAAGTTATCTAGG - Intergenic
929931303 2:46257784-46257806 GTTTGCAAATAAAGGTAGCTGGG - Intergenic
930109974 2:47670253-47670275 ATATACACAAAAAGTTGGCTGGG - Intergenic
939775478 2:146381852-146381874 GTGTCTACATAAAGATAGTTAGG - Intergenic
940960245 2:159777088-159777110 CTGTACAAAAAAAGTTAGCTGGG + Intronic
941158352 2:162005782-162005804 GTGTACACAGAACGTTACATGGG - Exonic
941356125 2:164494605-164494627 GTGTATGCATAAATGTAGCTGGG + Intronic
942033769 2:171990550-171990572 ATGTATATATAAAATTAGCTGGG - Intronic
943054417 2:182958297-182958319 ATATACAAATAAAATTAGCTGGG - Intronic
943564332 2:189499455-189499477 GTATACAAATAAAGTTATTTGGG - Intergenic
943877374 2:193088257-193088279 GTGTTGACCTAAAGTAAGCTGGG + Intergenic
1169858401 20:10127511-10127533 AAATACACAAAAAGTTAGCTGGG + Intergenic
1170546486 20:17439294-17439316 ATGTCTACAAAAAGTTAGCTGGG - Intronic
1172411922 20:34730873-34730895 GTCTATACAAAAAATTAGCTGGG - Intronic
1172486478 20:35301092-35301114 GTCTCTACAAAAAGTTAGCTGGG - Intergenic
1174471693 20:50766335-50766357 CTCTACAAAAAAAGTTAGCTGGG - Intergenic
1175027935 20:55922713-55922735 GTAAACACATTAAGTGAGCTAGG + Intergenic
1176043687 20:63081531-63081553 GTGTCCACATATGGTGAGCTCGG - Intergenic
1178972028 21:37188193-37188215 GTGTACACATGCAGTTAACCTGG + Intronic
1180618669 22:17145534-17145556 CTCTACAAATAAAGTCAGCTAGG + Intronic
1181347749 22:22232440-22232462 GTCTCCACAAAAAGTTAGCTGGG + Intergenic
1181704231 22:24638947-24638969 GAGTATACATGAAATTAGCTTGG - Intergenic
949734004 3:7149505-7149527 GTGAACACATAAAATTACCTTGG - Intronic
955043999 3:55342817-55342839 GATTACAAATAAAGTTATCTGGG - Intergenic
955268661 3:57474455-57474477 CTAAACACAAAAAGTTAGCTGGG - Intronic
957383338 3:79463212-79463234 AAGTACAAAAAAAGTTAGCTGGG + Intronic
962571717 3:136720013-136720035 GTGAAAATATAAAATTAGCTGGG + Intronic
964341761 3:155715771-155715793 GTTTCCACAAAAAATTAGCTGGG - Intronic
967494778 3:190130501-190130523 ATGTACACATAAAATTACCCTGG + Intergenic
970388440 4:15581045-15581067 GTATCCACATAAAATTAGCCTGG - Intronic
970649848 4:18165178-18165200 ATGTACACAGAACGTTTGCTAGG - Intergenic
971258653 4:25036012-25036034 GTGTGGAGATAAAGTTAGCTTGG - Intergenic
971791618 4:31176917-31176939 AAGTACAAAAAAAGTTAGCTGGG - Intergenic
972958692 4:44424594-44424616 GTGTCCACAAAAAGTAAGTTTGG + Intronic
974335236 4:60535294-60535316 GTGTAAAAATAAAATTATCTGGG - Intergenic
975348041 4:73316271-73316293 GTGTGCCCATAAAGCCAGCTTGG - Intergenic
975644158 4:76529475-76529497 ATATACACAAAAAATTAGCTGGG - Intronic
978635822 4:110804753-110804775 GACTACACATAAATTTTGCTTGG + Intergenic
980404477 4:132338678-132338700 GTGTACACATAGACTTAGAGAGG - Intergenic
981143674 4:141300547-141300569 CTCTACACAAAAAATTAGCTGGG + Intergenic
981405853 4:144368171-144368193 GTGAACACTTAAAATAAGCTTGG - Intergenic
985700739 5:1370614-1370636 GTGTAGACATTAAGGTTGCTTGG + Intergenic
990242899 5:53833652-53833674 GGGTACAGATAAAATTAGATTGG + Intergenic
992397702 5:76382692-76382714 AAGTACACAAAAAGTTAGCCAGG + Intergenic
993719084 5:91304321-91304343 GTGTATACAGAAAGTTAGCTTGG - Intergenic
995372519 5:111434753-111434775 GAGTACACATAAATTTAAGTAGG - Intronic
997829440 5:137137185-137137207 GTGCACACAGAGAGTTAGCCAGG - Intronic
998209456 5:140183303-140183325 GTGAACACAGAAAGTGAGTTGGG - Intronic
998663936 5:144274306-144274328 GTGTAGGAATAAAGGTAGCTTGG + Intronic
1003302302 6:4894519-4894541 GTTCACACATAAAGTTTTCTTGG + Intronic
1006095613 6:31654518-31654540 GTGTCTACAAAAAATTAGCTAGG + Intronic
1006391118 6:33759400-33759422 GTGTATACAAAAAATTAGCCAGG - Intergenic
1008009369 6:46447559-46447581 GTGTACACATAATATTCTCTAGG + Intronic
1009199129 6:60722503-60722525 CTAAACATATAAAGTTAGCTGGG + Intergenic
1010556585 6:77287844-77287866 ATTTACACATAAATATAGCTAGG - Intergenic
1012075598 6:94680827-94680849 GTGTAGACATAAACTCAGCAGGG + Intergenic
1012641260 6:101619116-101619138 GTTTCCAAATAAAGTTAGATTGG - Intronic
1015966435 6:138698952-138698974 GTGCCCACAGGAAGTTAGCTGGG - Intergenic
1016203305 6:141440368-141440390 GTGCACACATATATTTATCTTGG + Intergenic
1019079661 6:169421732-169421754 GGGTACAGATAAAATAAGCTGGG - Intergenic
1019761040 7:2813085-2813107 GTCTACAAATAAAATTAGCTGGG - Intronic
1020937746 7:14488665-14488687 GTATATATATAAAATTAGCTCGG + Intronic
1023670367 7:42570117-42570139 GTTTACACATAACCTGAGCTGGG + Intergenic
1024887055 7:54155438-54155460 GTGTACACCTTAAGTTAGTCTGG - Intergenic
1028912545 7:96224635-96224657 GTGTACATAGAAAGTTGCCTTGG - Intronic
1029403384 7:100358710-100358732 GTGACCCCATAAAGGTAGCTTGG - Exonic
1029405962 7:100374064-100374086 GTGACCCCATAAAGGTAGCTTGG - Exonic
1029669154 7:102017000-102017022 GTGTCCATAAAACGTTAGCTTGG + Intronic
1033001764 7:137513208-137513230 GAGTACAGATACAGATAGCTTGG - Intronic
1034832588 7:154322151-154322173 GTGGACACATAACTTTAGCCAGG - Intronic
1036144618 8:6243512-6243534 GTCTCCACAGAAAATTAGCTGGG + Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1041142522 8:54837882-54837904 GTCTACACATAAAGTTTTATTGG - Intergenic
1041962793 8:63638120-63638142 GTGTAGACACAAGGTGAGCTGGG + Intergenic
1042536448 8:69863391-69863413 AAATACAAATAAAGTTAGCTGGG + Intergenic
1042961455 8:74308027-74308049 TTTAACACATAAAGTTGGCTGGG - Intronic
1043226512 8:77738082-77738104 GTGTACACATAAATTTTTCAAGG + Intergenic
1044255583 8:90056725-90056747 GTCTCTACAAAAAGTTAGCTAGG - Intergenic
1045833295 8:106490517-106490539 ATGCACACACAAAATTAGCTGGG - Intronic
1047800725 8:128307039-128307061 GTGCACACATAAATTTAATTTGG + Intergenic
1047950899 8:129933711-129933733 GTGAAAATATAAAATTAGCTGGG + Intronic
1048809788 8:138275532-138275554 GTGAATATATAAAATTAGCTGGG + Intronic
1049506177 8:143000371-143000393 GGGGACACATGGAGTTAGCTAGG - Intergenic
1050041976 9:1505258-1505280 GTGTACAGATAAAGTATGATAGG + Intergenic
1051424388 9:16918892-16918914 GTGTCTACAAAAAATTAGCTGGG + Intergenic
1056939635 9:90944326-90944348 CTGTACAGACAAAGTTTGCTGGG + Intergenic
1058882187 9:109295298-109295320 TTGTTTACATAAAATTAGCTTGG - Intronic
1061300112 9:129699261-129699283 ATATACACACAAAATTAGCTGGG + Intronic
1061703667 9:132435659-132435681 GTGTAGACATTAAGTCTGCTTGG - Intronic
1185910179 X:3973735-3973757 GTGTATACATCAGGTTACCTAGG + Intergenic
1186463050 X:9763923-9763945 GTCTACAAATAAAGTTTGATGGG - Intronic
1187359258 X:18609611-18609633 GTGTGCACATAAAGTGAGAGAGG - Intronic
1187545580 X:20248641-20248663 GTTTATACAAAAAATTAGCTGGG - Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189490310 X:41466257-41466279 TTGTCTACATAAAATTAGCTGGG + Intronic
1189791567 X:44610130-44610152 CTGTACACATAATGTTGGCCAGG + Intergenic
1189807811 X:44752849-44752871 GTCTCTACAAAAAGTTAGCTGGG + Intergenic
1190191160 X:48278341-48278363 GTGTCTACAAAAAATTAGCTGGG + Intergenic
1190667217 X:52706517-52706539 AAATACACAAAAAGTTAGCTGGG + Intronic
1190672201 X:52751891-52751913 AAATACACAAAAAGTTAGCTGGG - Intronic
1190863423 X:54364427-54364449 CTCTACAAAAAAAGTTAGCTGGG + Intergenic
1192622160 X:72689005-72689027 GAGTACACATAAAATGAGATAGG + Intronic
1193842615 X:86426151-86426173 GTGTACACATAAAGTTAGCTAGG + Intronic
1194384599 X:93237201-93237223 GTGTATACATCAGGTTACCTAGG + Intergenic
1195005903 X:100685660-100685682 ATATACACAGAAGGTTAGCTCGG + Intronic
1195196402 X:102501539-102501561 GTCTCCACAAAAAATTAGCTGGG - Intergenic
1195623972 X:106988776-106988798 GTTTACACATCAAGGTGGCTTGG + Intronic
1196821895 X:119708173-119708195 GTCTACACAAAAAACTAGCTGGG - Intergenic
1197539259 X:127735323-127735345 GAGTACACTTAAAGTAGGCTAGG - Intergenic