ID: 1193844447

View in Genome Browser
Species Human (GRCh38)
Location X:86451235-86451257
Sequence TATGGTATAAGGAAGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 4, 2: 24, 3: 129, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193844441_1193844447 -1 Left 1193844441 X:86451213-86451235 CCATCTTGAATTAATTTTTGTAT 0: 7417
1: 10828
2: 7283
3: 6600
4: 7145
Right 1193844447 X:86451235-86451257 TATGGTATAAGGAAGGGGCCTGG 0: 1
1: 4
2: 24
3: 129
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193844447 Original CRISPR TATGGTATAAGGAAGGGGCC TGG Intronic
900075830 1:816959-816981 TATGGTGAAAGGTAGGGGTCTGG - Intergenic
900925897 1:5705834-5705856 GAGGGTATGAGGAAGGGGACAGG - Intergenic
901695053 1:11001324-11001346 TAAGGGATATGGAAGGGGCTGGG + Intergenic
904445997 1:30573397-30573419 TCTGGTACAAAGAAGGGGCTCGG + Intergenic
905749009 1:40445448-40445470 TATGGTAGAAGGAAGGGACAGGG + Intergenic
906090846 1:43178101-43178123 TAAGGTGTAAGGAAGGGATCCGG - Intronic
906971928 1:50524562-50524584 TATGGTGTAAGGAAAGAGTCCGG + Intronic
907190090 1:52641090-52641112 CAAGGTATAAGGGAGGGGCGTGG - Intronic
907935249 1:59035977-59035999 TGTAATATAAGGAAGGGGCCAGG + Intergenic
908507676 1:64821731-64821753 TATGGTGTAAGGAAGAGGTCTGG - Intronic
908672872 1:66567681-66567703 TAAGGTGTAAGGAAGGGGTCTGG + Intronic
908878361 1:68703019-68703041 TAAGTTATAAGGAAGAGGGCAGG - Intergenic
908904336 1:68990752-68990774 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
909473057 1:76051099-76051121 TAAGGTATAAGGAAGGGGTCCGG + Intergenic
909996656 1:82288655-82288677 TAGGGTTTAAGGTAGGAGCCAGG + Intergenic
910331432 1:86076806-86076828 TAAGGTGTAAGGAAGGGGTCTGG - Intronic
910338893 1:86163528-86163550 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
910797120 1:91108650-91108672 TATGGTGTAAGAAAGGGATCCGG + Intergenic
910810401 1:91229934-91229956 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
911428339 1:97750861-97750883 TTTGGTATATGCAAGGGTCCTGG + Intronic
911474736 1:98361283-98361305 TATGAGATTTGGAAGGGGCCAGG - Intergenic
911971979 1:104450933-104450955 TATGGTGTAAGGAAGGTATCTGG + Intergenic
912061681 1:105680390-105680412 TAAGGTGTAAGGAAGAGGTCCGG + Intergenic
912589791 1:110805386-110805408 TGTGGTGAAAGGAAGGGGTCTGG - Intergenic
912709537 1:111940404-111940426 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
912909363 1:113742325-113742347 TATGGTATAAAAAATGGGGCTGG + Intronic
913491906 1:119388454-119388476 TATTGGCTAAGGTAGGGGCCAGG + Intronic
914345092 1:146792126-146792148 TAAAGTAGAAAGAAGGGGCCAGG - Intergenic
914964216 1:152238969-152238991 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
914966759 1:152266210-152266232 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
914967427 1:152272862-152272884 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
914968941 1:152289249-152289271 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
914969625 1:152295804-152295826 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
915454033 1:156027465-156027487 AATAGTATATGGTAGGGGCCAGG - Intergenic
916594349 1:166228832-166228854 TATGGTATAAGGAAGGGATCTGG + Intergenic
917258670 1:173143345-173143367 TATGGGGTAAGGAAGGGGTCAGG + Intergenic
918156680 1:181854037-181854059 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
918249850 1:182692942-182692964 TATGGTGTAAGAAAGGGGTCTGG - Intergenic
918502256 1:185210399-185210421 TAAGGTGTAAGGAAGGGATCCGG + Intronic
919111032 1:193218723-193218745 TATGGTGAAAGGAAGGGGTTCGG - Intronic
919268905 1:195312884-195312906 AATGGTAAATGGAAGGGTCCTGG + Intergenic
920649383 1:207825377-207825399 TATGGGATAAGGTAGCTGCCTGG - Intergenic
921008870 1:211121493-211121515 TAAGGTGTAAGGAAGGGGTCTGG - Intronic
921082546 1:211754329-211754351 TATGGTATAAGGTTGGCTCCTGG + Intronic
921262376 1:213395512-213395534 TATGGTATAAGAAACTGGGCAGG + Intergenic
922108744 1:222536754-222536776 TATGTAAAAAGGATGGGGCCGGG + Intronic
924613705 1:245594346-245594368 TAAGGTATAAGGAAGGGGTCCGG + Intronic
924771476 1:247084210-247084232 TATGGTGTAAGGAAGGGGTCCGG - Intergenic
1063338442 10:5239728-5239750 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1064318186 10:14277331-14277353 GATGGTATTAGGAAGGGGGGCGG + Intronic
1064563628 10:16617796-16617818 TAAGGTGTAAGGAAGGGGTCTGG - Intronic
1065015742 10:21461226-21461248 TATGGTATTTGGAAGGGGAGAGG + Intergenic
1065164175 10:22957456-22957478 TGTGCTGTAAGGCAGGGGCCTGG + Intronic
1065691890 10:28342695-28342717 TGTGGTGTAAAGAAGGGGGCTGG + Intergenic
1067235916 10:44449414-44449436 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
1067328640 10:45293682-45293704 CACGGCATAAGGAAGGGGACTGG - Intergenic
1067924390 10:50493280-50493302 TATGGCGTAAGGAAGGGGTCCGG - Intronic
1068562215 10:58527600-58527622 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1068586015 10:58799523-58799545 TATGGTGAAAGGTAGGGGTCTGG + Intronic
1068814122 10:61290800-61290822 TATGGTGTAAGAAAGGGGTTTGG + Intergenic
1068891437 10:62152192-62152214 TATGGTGTAAGGAAGGAGTCCGG + Intergenic
1069234088 10:66048439-66048461 TGTGGTATAAGGAAGAGGTCCGG - Intronic
1069333677 10:67323394-67323416 TACGGTGTAAGGAAGGGGTCCGG + Intronic
1071765690 10:88662484-88662506 TAAGGTATAAGGAAGGGGTCTGG - Intergenic
1072618059 10:97062853-97062875 TGTAGTATAAGCCAGGGGCCAGG + Intronic
1072925234 10:99611278-99611300 TGTGGCAAAATGAAGGGGCCGGG - Exonic
1073194404 10:101676747-101676769 TATGGTGTGAGGTAGGGGTCAGG - Intronic
1074017728 10:109551254-109551276 TAAGGTGTAAGGAAGGGATCTGG - Intergenic
1074334775 10:112560444-112560466 AATGTTATGAGGAAGGGGCTTGG - Intronic
1075764916 10:124885558-124885580 GCTAGCATAAGGAAGGGGCCTGG - Intergenic
1078810599 11:14757981-14758003 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1079426518 11:20347598-20347620 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1079654315 11:22969406-22969428 TAAGGTGTAAGGATGGGGTCCGG + Intergenic
1079749849 11:24183833-24183855 TAAGGTATAAGGAAGGGATCCGG - Intergenic
1079965952 11:26980075-26980097 TAAGATGTAAGGAAGGGGTCTGG + Intergenic
1081079775 11:38727296-38727318 TAAGGTGTAAGGAAGGGGACAGG + Intergenic
1081081164 11:38740921-38740943 TAAGGTGTAAGGAAGGGGTCAGG + Intergenic
1081846155 11:46241911-46241933 TATGGTCTCAGGAAGCTGCCCGG - Intergenic
1083473495 11:62900361-62900383 TGTGGTAGAAGCAAGGGGTCGGG + Intergenic
1084311780 11:68321084-68321106 TATGGTATGAGGTAGGGGTCTGG + Intronic
1085003851 11:73066311-73066333 TAAGGTGTAAGGAAGGGATCCGG - Intronic
1085145839 11:74196427-74196449 TATGGTGTGAGGAAGGGGTCTGG + Intronic
1085496447 11:76973901-76973923 TGTGGTATGAGGTAGGGGTCTGG + Intronic
1086048524 11:82561472-82561494 TAGGGTTTAAGGATGGGGACAGG - Intergenic
1086777445 11:90857272-90857294 TATACTGTAAGGAAGGGGTCCGG + Intergenic
1086827283 11:91515034-91515056 TATAGAATAAGAAAAGGGCCAGG - Intergenic
1086907145 11:92431689-92431711 TAAGGTATAAGGAAGGGATCCGG + Intronic
1086991513 11:93308801-93308823 TACAGTATAAGGAAGGGGTCCGG - Intergenic
1087442261 11:98201573-98201595 TAAGGTGTTAGGAAGGGGTCAGG + Intergenic
1087481001 11:98700187-98700209 TAAGTTTTAAGGAAGGGGTCCGG - Intergenic
1087794721 11:102443509-102443531 TAATGTATAAGGAAGGGATCCGG - Intronic
1087800915 11:102503146-102503168 TAAGGTGTAAGGAAGGGGTCTGG + Intergenic
1087828495 11:102793579-102793601 TCTGATGTAAGGAATGGGCCTGG - Intronic
1087835876 11:102874249-102874271 AATGCTATAAAGATGGGGCCTGG + Intronic
1088270707 11:108031471-108031493 TATGGTATAAGAAAGGGGTCTGG + Intronic
1089856828 11:121552787-121552809 TATGGAATCAGGAAGTGGGCAGG + Intronic
1089951147 11:122527967-122527989 TATGGTGTAAGGAAAGGGTCTGG + Intergenic
1090114838 11:123957785-123957807 TATGGTGTAAGTAAGTGGTCCGG + Intergenic
1090495122 11:127204409-127204431 TATGGTGTAAGGAAGGGGTCCGG + Intergenic
1091536001 12:1410002-1410024 TAAAGTATATGGGAGGGGCCAGG - Intronic
1092010691 12:5109484-5109506 TATGGTATAAGGTAGTGGTTAGG - Intergenic
1092943255 12:13429768-13429790 TATTGCATAATGATGGGGCCTGG + Intergenic
1093004889 12:14040739-14040761 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
1093659143 12:21734378-21734400 TATGGTGTAAGAAAGGGGTCTGG - Intronic
1094225818 12:28044602-28044624 TATGGTGTAAGGGAGGAGTCCGG + Intergenic
1095091023 12:38105353-38105375 TATGGTGTAAAGAAGGGGTCTGG + Intergenic
1096937482 12:55298396-55298418 TATGGTGTAAGGAAGGGATGTGG - Intergenic
1096952563 12:55488837-55488859 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1097685818 12:62689929-62689951 TATGTTAGCAGCAAGGGGCCTGG - Intronic
1098434650 12:70455645-70455667 TAAGGTGTAAGGAAGAGGTCCGG + Intergenic
1098695067 12:73542145-73542167 TAAGGTATAAAGAAGGGGTCAGG - Intergenic
1099323319 12:81179107-81179129 TGTGGTGAAAGGAAGGGGTCTGG - Intronic
1099701483 12:86088186-86088208 TATGCTATAAGGAAGGGCTCCGG - Intronic
1100025846 12:90126950-90126972 TATGGTATAAGGAAGCAGTCAGG - Intergenic
1101088688 12:101262278-101262300 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1101301228 12:103484835-103484857 TAAGGTGTAAGGAAGGGATCTGG + Intronic
1101784025 12:107865994-107866016 TGAGGTGTAAGGAAGGGGTCCGG - Intergenic
1103159686 12:118718587-118718609 TATGGCAAAAGGAAGGGCTCTGG + Intergenic
1103468708 12:121162776-121162798 TCTGGGGGAAGGAAGGGGCCAGG - Intronic
1103583864 12:121936722-121936744 TAGGGTTTCAGGGAGGGGCCTGG + Intronic
1105721280 13:23117091-23117113 TATGGTGTGAGGATGGTGCCAGG - Intergenic
1106372536 13:29149697-29149719 TATAGTGTAAAGAAGGGGCCTGG + Intronic
1106376928 13:29198247-29198269 TAAGGTGTAAGGAAGGGGTCTGG + Intronic
1107522490 13:41197231-41197253 TATGGTGTAAGGTAGGGGCAAGG - Intergenic
1108673576 13:52716525-52716547 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
1109047240 13:57428641-57428663 TAAGGTGTAAGGAAGGGTCCAGG - Intergenic
1109098006 13:58142551-58142573 TATGAGATTTGGAAGGGGCCGGG + Intergenic
1110161927 13:72388813-72388835 TATTGTATTAGGAAGTGGCAGGG + Intergenic
1110631468 13:77713023-77713045 TAAGGTGTAAGGAAGGGGTCTGG - Intronic
1110737017 13:78948995-78949017 TAAGGTGTAAGGAAGGCGTCTGG + Intergenic
1111525274 13:89460251-89460273 TGTGGTGTAAGGAAGGGGTCCGG - Intergenic
1112027869 13:95428724-95428746 TAAGGTGTAAGGAAGGGTTCCGG + Intergenic
1113712055 13:112472319-112472341 TATGGTGAAAGGAAGGGGTCTGG - Intergenic
1114158004 14:20129061-20129083 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1114212521 14:20627158-20627180 TATGTGAAAAGGAAGGGGACTGG - Intergenic
1114360973 14:21972257-21972279 TAAGGTATAAGGAAGGGATCCGG - Intergenic
1114425322 14:22616811-22616833 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1114943545 14:27648891-27648913 TAAGGTGTAAGGAAGGGTCCAGG + Intergenic
1114959887 14:27872798-27872820 TATGGTGTAATGAAGGAGTCCGG + Intergenic
1115188872 14:30724863-30724885 TGTGGTGTAAGGAAGAGGTCCGG + Intronic
1115344257 14:32325556-32325578 TAAGGTATAAGAAAGGGGTCCGG - Intergenic
1116157096 14:41219256-41219278 TATGGTATAAGGAAGGGGTCTGG - Intergenic
1117004535 14:51406011-51406033 TATGGTGTAAGGAAGAGGGCTGG + Intergenic
1117755114 14:58966744-58966766 TATTGTATCAGGCAGGGTCCAGG + Intergenic
1118215208 14:63802564-63802586 CATGATATTTGGAAGGGGCCAGG + Intergenic
1118558677 14:67054909-67054931 TAAGGTATAAGGAAAGGGTCCGG - Intronic
1118676110 14:68186176-68186198 TATGGTGAAAGGTAGGGGTCTGG - Intronic
1120357329 14:83451293-83451315 TAGGGTATAGTGAAAGGGCCAGG - Intergenic
1120555401 14:85924062-85924084 GGTGGTATAAGGAAGGAACCTGG + Intergenic
1121687099 14:95844054-95844076 TTTGGTATAAGGAAGGATGCAGG + Intergenic
1122367879 14:101206010-101206032 TAAGGTATAAGGAGGGGATCTGG + Intergenic
1122847572 14:104508575-104508597 TATGGTGTGAGGAAGGGGTTGGG - Intronic
1123725575 15:23098060-23098082 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1124053043 15:26216681-26216703 TAAGGTGTAAGGCAGGGGTCTGG + Intergenic
1124512048 15:30335885-30335907 TGTGATGCAAGGAAGGGGCCAGG + Intergenic
1124730866 15:32194866-32194888 TGTGATGCAAGGAAGGGGCCAGG - Intergenic
1125054149 15:35337994-35338016 TAAGGTGTAAGGAAGGGATCCGG - Intronic
1126201022 15:45986261-45986283 TAAGGTATAAGGAAGGGGTCTGG - Intergenic
1126967699 15:54074056-54074078 TAAGGTGTAAGGAAGGAGTCCGG + Intronic
1127310209 15:57745571-57745593 AATGGCAAAGGGAAGGGGCCGGG - Intronic
1127413306 15:58731321-58731343 TAAAGTATATGGGAGGGGCCAGG + Intronic
1127470880 15:59289017-59289039 TATTGTAGCTGGAAGGGGCCTGG + Intronic
1127921795 15:63500582-63500604 TATAATAAAAGGGAGGGGCCAGG + Intergenic
1128850540 15:70950936-70950958 TATGGTGAGAGGAAGGGGTCTGG + Intronic
1128896198 15:71376320-71376342 TAGGGCATAAGGAAGGAGGCTGG - Intronic
1129042429 15:72701094-72701116 TAGGGAATAAGGAGGCGGCCTGG - Intronic
1129673644 15:77620836-77620858 TAGGGGAGATGGAAGGGGCCTGG + Intronic
1130039102 15:80389665-80389687 TAAGGTGTAATGAAGGGGTCCGG - Intronic
1130386791 15:83419011-83419033 AAAGGTGTAAGGAAGGGGTCTGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1136397510 16:30001202-30001224 TCTGGTATAGGAACGGGGCCAGG + Intronic
1136493115 16:30623917-30623939 TCTGTTTTAAGGAAGGGGTCAGG + Intronic
1137972399 16:52999120-52999142 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1139271635 16:65689230-65689252 TATGGTAGGAGAAAGGAGCCAGG + Intergenic
1139988902 16:70923170-70923192 TAAAGTAGAAAGAAGGGGCCAGG + Intronic
1140030415 16:71333197-71333219 TAAGGCATAAGGAAGGGGTTCGG - Intergenic
1140538802 16:75736011-75736033 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1140929255 16:79611744-79611766 TATGGTATGGGACAGGGGCCTGG + Intergenic
1141391098 16:83664660-83664682 TATGGTGTGAGGTAGGGGTCAGG + Intronic
1143140241 17:4738537-4738559 TCTGGAATGAGGAAGGAGCCGGG - Intronic
1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG + Intronic
1149365908 17:55943911-55943933 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1150874813 17:68959105-68959127 TATGATATTTAGAAGGGGCCAGG + Intergenic
1151325367 17:73376730-73376752 CATGGGAAAAGAAAGGGGCCAGG - Intronic
1154212140 18:12389011-12389033 TTCAGTATAAGGATGGGGCCAGG + Intergenic
1154233214 18:12577108-12577130 TATGGTATGAGGCAGGGGTCTGG - Intronic
1154387199 18:13904862-13904884 TAAGGTATAAGGAAGGGGCCCGG - Intronic
1155304797 18:24468335-24468357 TAAAGTATACGGGAGGGGCCGGG - Intronic
1155746668 18:29362656-29362678 CATGATATTTGGAAGGGGCCGGG + Intergenic
1156190021 18:34708097-34708119 TATGGTACAAAGAAGCAGCCAGG - Intronic
1156233960 18:35183261-35183283 GAAGGTACAAGGAAAGGGCCGGG - Intergenic
1156296392 18:35795552-35795574 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1157010719 18:43645174-43645196 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1157315898 18:46589383-46589405 TCTGTTTTAAAGAAGGGGCCAGG - Intronic
1158061953 18:53354952-53354974 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1158126354 18:54103611-54103633 TATGGTTTGAGGAAAAGGCCTGG - Intergenic
1158894892 18:61903529-61903551 TAAGGTGTAAGGAAGGGACATGG + Intergenic
1159452531 18:68620577-68620599 TAAGGTATAAGGAAGGTTTCCGG - Intergenic
1160483596 18:79265915-79265937 TATGGTGTAAAGAAGGGGTCCGG + Intronic
1160962112 19:1726780-1726802 AATAGTAATAGGAAGGGGCCAGG + Intergenic
1162422323 19:10572897-10572919 TATGGAATAAGGAAGAGGTGAGG + Exonic
1162866725 19:13553574-13553596 GATGGTTTCAGGATGGGGCCTGG - Intronic
1164013786 19:21234143-21234165 TATGCTTTAAGGAAAGGGTCTGG - Intronic
1167892817 19:52556162-52556184 TATGTTAAGAGGATGGGGCCAGG + Exonic
1167911308 19:52704127-52704149 TATGTTAAGAGGATGGGGCCAGG - Exonic
926230234 2:10997284-10997306 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
927581754 2:24257019-24257041 TATGGTACAAAGAAGTGGCCAGG + Intronic
927871311 2:26625912-26625934 TAAGGTATAAGGAAGGCATCTGG + Intronic
928750016 2:34459798-34459820 AATGATATTTGGAAGGGGCCAGG + Intergenic
929107672 2:38380003-38380025 TAAGATAGAAGGAATGGGCCAGG + Intergenic
930328148 2:49946560-49946582 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
930586397 2:53272247-53272269 TATGGTGTAAGGAAGGTGTCCGG - Intergenic
930918966 2:56727835-56727857 TATAGTAAAAGGAAGTGGTCTGG - Intergenic
931031189 2:58176593-58176615 TAAGGTGTAAGGAAGGGATCCGG - Intronic
932540114 2:72642577-72642599 TAAGGTGTAAGGAAGGGATCCGG - Intronic
932545369 2:72703100-72703122 TAAGGTGTAAGGAAGGGATCCGG + Intronic
932841087 2:75083103-75083125 TAAGGTGTAAGGAAGGGATCCGG + Intronic
932914339 2:75838933-75838955 TAATGTGTAAGGAAGGGGTCCGG - Intergenic
933059683 2:77722047-77722069 TATGGTGTAAGGAAGGAGTCCGG + Intergenic
933262196 2:80143026-80143048 TATGGAGTAAGGAAGGGCCACGG + Intronic
935257098 2:101320307-101320329 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
935660775 2:105465143-105465165 TATAAGAAAAGGAAGGGGCCAGG - Intergenic
935921045 2:108015443-108015465 TACAGTAGAAGGATGGGGCCAGG + Intergenic
936553544 2:113472663-113472685 TAAGGTGTAAGGAAGGGATCCGG + Intronic
936893763 2:117403686-117403708 AATGTAATAAAGAAGGGGCCAGG + Intergenic
937188743 2:120071741-120071763 TAAGGTGTAAGGAAGGGTCCAGG - Intronic
937540822 2:122950655-122950677 TATGATGTAAGGAAGGGATCTGG + Intergenic
937553240 2:123121256-123121278 TATGGTAAAAGGCGGGGGTCTGG - Intergenic
937640130 2:124202917-124202939 TATGAGATTTGGAAGGGGCCAGG - Intronic
938250368 2:129811168-129811190 GGTGGTAAAAGGAAGAGGCCAGG - Intergenic
939022462 2:136975363-136975385 TAAGGTGTAAGGAAGGGGTCTGG + Intronic
939111142 2:138008739-138008761 TATAGTATAAGGAAGGAGACTGG - Intronic
939640442 2:144634407-144634429 TAAGGTGTAAGGAAGGGGTCTGG + Intergenic
940417646 2:153441125-153441147 TGAGGTGTAAGGAAGGGGTCCGG + Intergenic
940438601 2:153685829-153685851 TAAGGTATAAGGAAGGGGACCGG + Intergenic
940783513 2:157958526-157958548 CATGGGATTTGGAAGGGGCCAGG - Intronic
940880735 2:158944232-158944254 TGTGGAATAGGGAAGGGACCAGG - Intergenic
941319792 2:164040741-164040763 TATGATATTTGGGAGGGGCCGGG - Intergenic
941559205 2:167023633-167023655 TAAGGTGTAAGGAAGGGATCTGG + Intronic
941608645 2:167632974-167632996 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
941973751 2:171381219-171381241 TAAGGTCTAAGGAAGGAGTCCGG - Intronic
942372266 2:175297812-175297834 TAAGGTGTAAGGAAAGGGTCCGG - Intergenic
943635324 2:190300830-190300852 TATAGTGTAAGCAAGGGGTCCGG + Intronic
944336320 2:198539566-198539588 GAAGGTGTAAGGAAGGGGTCCGG + Intronic
944371019 2:198984125-198984147 TATGGTGTAAGGAAGGGGTCCGG - Intergenic
944478976 2:200135778-200135800 CATGGTATAGGGGAGGGGCGTGG + Intergenic
944764770 2:202853015-202853037 TAAGGTGTAAGGAAGGGTTCTGG - Intronic
945623063 2:212166905-212166927 TAAGGTGTAAGGAAGAGGTCCGG - Intronic
946462888 2:219885606-219885628 TATACTATAAGGAAGGGCCTGGG - Intergenic
946596194 2:221308248-221308270 TGTGGTGTTAGGAAGGTGCCAGG - Intergenic
947143130 2:227038244-227038266 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
947146376 2:227069682-227069704 TAAGGTGTAAGGAAGGGATCTGG - Intronic
947978660 2:234389062-234389084 GAAGGTGTAAGGAAGGGGTCCGG - Intergenic
948699276 2:239750287-239750309 CAGGGTACAAGGAAGGGGTCTGG - Intergenic
949081886 2:242107747-242107769 TATGGTGAAAGGTAGGGGTCTGG + Intergenic
1168933059 20:1639798-1639820 TAAGGTGTAAGGAAGGGGTCTGG + Intronic
1169959885 20:11147883-11147905 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
1170437827 20:16348985-16349007 TATGGTACCAGGATGGGACCAGG - Intronic
1172112398 20:32554768-32554790 TAGGGGACAAGGAAGGGGCTAGG + Intronic
1173554539 20:43956227-43956249 CATGGTCTAGGGAAGGGGACAGG - Intronic
1175536096 20:59714366-59714388 TATGGTATGAGGGAGGGATCAGG + Intronic
1177118346 21:17111739-17111761 TAAGGTATAAGGAAGGGGTTTGG - Intergenic
1177758727 21:25378427-25378449 TATGGTATAAGGAAGGGGTCTGG - Intergenic
1177956140 21:27601599-27601621 TAAGGTTTAAGGAAGGGGTCCGG + Intergenic
1178824850 21:36006331-36006353 TATGGGAGAATGAAGTGGCCTGG - Intergenic
1181588624 22:23868710-23868732 TGTGGAAGAAGGAAGAGGCCCGG + Intronic
1181809783 22:25396460-25396482 TATGGTATGAGGTAGGGGTCTGG - Intronic
1183164544 22:36137817-36137839 TATGGTATCAGGAATGGGGATGG - Intergenic
1183248410 22:36711282-36711304 TATAGTGCAAGGATGGGGCCCGG + Intergenic
1184110971 22:42394820-42394842 TAAGGTATAAGGATTGGGCCGGG + Intronic
1184830900 22:46986085-46986107 TATGGTGTAAGGAAGATGTCAGG + Intronic
1185034388 22:48464051-48464073 TAAGGTAAAAGGCAGGGGTCAGG + Intergenic
1185039180 22:48495741-48495763 TATGGTTCAGGGCAGGGGCCTGG - Intronic
949175623 3:1059003-1059025 TAAGGTGTAAGGAAGTGGTCCGG + Intergenic
949874393 3:8616334-8616356 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
950569265 3:13790150-13790172 GATGGTGTAAGGAAGAGACCTGG + Intergenic
950805943 3:15603199-15603221 TATGATATTTGGGAGGGGCCAGG - Intronic
951177044 3:19614603-19614625 TATGATATTTGGGAGGGGCCGGG - Intergenic
952043284 3:29285654-29285676 CCTGGTATGAAGAAGGGGCCAGG + Intronic
952159316 3:30677932-30677954 TAAGGTATAAGGAAGAGGGAAGG + Intronic
952755053 3:36858554-36858576 TATGCTACAAGTGAGGGGCCAGG + Intronic
952831293 3:37567427-37567449 GATGATATTTGGAAGGGGCCGGG - Intronic
954976667 3:54702074-54702096 TATGGTGAAAAGAAAGGGCCTGG - Intronic
955246916 3:57233704-57233726 TATAGTATAAAGAAGGGGAAAGG - Intronic
955789451 3:62573175-62573197 TAATGTATATGGGAGGGGCCAGG - Intronic
957092631 3:75747041-75747063 TAAGGTGTAAGGAAGGGATCTGG + Intronic
958157091 3:89769300-89769322 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
958413531 3:93847936-93847958 TAAGGTGTAAGGAAGGGATCTGG + Intergenic
958832829 3:99110338-99110360 TATGGAATAAGGAAGGGGCATGG - Intergenic
959841857 3:110985318-110985340 TCTGTTTTAAAGAAGGGGCCAGG - Intergenic
959930479 3:111977004-111977026 TAAGATATAAGGGATGGGCCAGG + Intergenic
962139003 3:132768214-132768236 TGTGGTGTAAGGAGGGGGTCCGG + Intergenic
962622575 3:137194332-137194354 TGTGGGAAAAGGAAAGGGCCTGG + Intergenic
963053577 3:141163779-141163801 TATGGTGTAAGGTAGGGGTGAGG - Intergenic
963979695 3:151523630-151523652 TATGGTGTAAGGAAGGAGTCCGG - Intergenic
964639063 3:158888887-158888909 TAAGGTGTAAGGAAGTGGTCCGG + Intergenic
964715703 3:159719196-159719218 TGAGGTATAAGGAAGGGATCGGG - Intronic
965120876 3:164554654-164554676 TATGGTATAGAGTACGGGCCAGG - Intergenic
967761479 3:193230847-193230869 TATGGTATAGGGACTGGGGCTGG + Intergenic
970155805 4:13140864-13140886 CATGATATTTGGAAGGGGCCAGG + Intergenic
970695462 4:18671739-18671761 TATGGTATAAGGAAGAGGTGTGG + Intergenic
970969743 4:21968146-21968168 TATAGCATAAGGAAGGGGTTTGG - Intergenic
971690037 4:29821950-29821972 TAAGGTGTAAGGAAGGGGTCTGG + Intergenic
972106695 4:35496538-35496560 TATGGTGTAAGTAAGTGGTCTGG - Intergenic
972233699 4:37104450-37104472 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
972881411 4:43427751-43427773 TAAGATGTAAGGAAGGGGTCTGG + Intergenic
972919487 4:43920576-43920598 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
973678586 4:53291942-53291964 TAAGGCATAAGGAAGGGGTCTGG - Intronic
973701043 4:53537682-53537704 AATGGTACAAAGAAGGTGCCCGG - Intronic
974531694 4:63116322-63116344 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
974663390 4:64924342-64924364 TATGGTGTAAGAAAGGGGTTTGG - Intergenic
975036878 4:69695278-69695300 TAAGGTGTAAGGAAGGGATCTGG + Intergenic
975058197 4:69962548-69962570 TAAGGTGTAAGGAAGGGACCCGG - Intergenic
975247207 4:72133178-72133200 CATGGTATAAGGAAGGGGTGTGG + Intronic
975511657 4:75200160-75200182 TAAGGCGTAAGGAAGGGACCCGG + Intergenic
976813578 4:89122153-89122175 CATGGTATAAGGCAGTGTCCAGG - Intergenic
976993868 4:91405272-91405294 TAAGGTGTAAGGAAGGGATCTGG - Intronic
977184827 4:93923907-93923929 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
977968966 4:103190606-103190628 TAAGGTGTAAGGAAGGGATCTGG - Intronic
978277871 4:106973913-106973935 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
979007031 4:115312256-115312278 TATGGTGTAAGCAGGGGGTCTGG - Intergenic
979219224 4:118201963-118201985 TATGGTGAAAGGTAGGGGTCTGG + Intronic
980456730 4:133053985-133054007 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
980477470 4:133336074-133336096 GATGGTGTAAGGAAGGTGTCCGG + Intergenic
980531767 4:134065795-134065817 TATGGTGTAAGGAAGGGATCCGG + Intergenic
980707178 4:136514015-136514037 GAGGGTATTAGGAATGGGCCTGG - Intergenic
980727960 4:136788622-136788644 CATGATATATGGGAGGGGCCAGG + Intergenic
980803989 4:137788607-137788629 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
981068800 4:140513158-140513180 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
981791078 4:148537091-148537113 TTTGGTATAAGGAAGGAGATTGG - Intergenic
982994900 4:162330629-162330651 TATGGTGTAAGGAAGGGGTTCGG + Intergenic
983276068 4:165619433-165619455 TAAGGTATAAGGAAGGGGTCTGG - Intergenic
983439148 4:167758830-167758852 TATGGTGTGAGGAAAGGACCTGG - Intergenic
983566869 4:169162778-169162800 TCTGGAATAAGGAGGGGGGCTGG - Intronic
984590262 4:181609120-181609142 TAGGGAGTAAGGCAGGGGCCAGG + Intergenic
984625678 4:182005246-182005268 TAAGATGTAAGGAAGGGGTCCGG + Intergenic
985317874 4:188677678-188677700 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
985745136 5:1642584-1642606 TTTAGTAAAAGGGAGGGGCCTGG + Intergenic
985910662 5:2877906-2877928 GATGGTATCAGAAAGTGGCCTGG - Intergenic
986419077 5:7558860-7558882 TGTGGTGTAATGAAGGGGTCTGG + Intronic
986620815 5:9672104-9672126 TATGATGTAAGGAAGGGGTCCGG - Intronic
987584128 5:19832705-19832727 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
987966848 5:24888707-24888729 TATGGCTAAAGGAAGGGGTCTGG - Intergenic
988238742 5:28580330-28580352 TATGGCAAAAGGAAGGGGTGTGG - Intergenic
988406757 5:30833893-30833915 TAAGGTATAAAGAAGGGATCTGG - Intergenic
988489999 5:31698197-31698219 TAAGAAATAAGGAAGGGGCCGGG - Intronic
988867268 5:35349210-35349232 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
989734056 5:44681533-44681555 TATGGTGTAAGGAAGGGTTCTGG - Intergenic
990104452 5:52239800-52239822 TATGGCATGAGGTAGGGGTCTGG + Intergenic
990127660 5:52538186-52538208 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
990151201 5:52819825-52819847 TAAGGTGTAAGGAAGGGATCCGG + Intronic
991110290 5:62892055-62892077 TAAGGTGTAAGGAAGGGGTCTGG + Intergenic
991504810 5:67313542-67313564 TATGGCACAAGGAAGAGGTCAGG - Intergenic
992418337 5:76574953-76574975 TATAGTATAATGAAGGGGATGGG + Intronic
992603980 5:78436401-78436423 TAAGGTATAAGGAAGGGATCCGG + Intronic
992928340 5:81614762-81614784 GATGGTATTATGAAGGGGCTAGG - Intronic
994241427 5:97425795-97425817 TAAGGTATAAGGAACGGGGATGG + Intergenic
994409125 5:99384071-99384093 TATGGTCTAAGGAAGGGGTCCGG - Intergenic
994602433 5:101923619-101923641 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
994652998 5:102552738-102552760 TATGGTGTAAAAAAGGGGTCCGG + Intergenic
994779809 5:104075536-104075558 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
995309753 5:110697261-110697283 TAAGGTGTAAGGAAGGGATCTGG - Intronic
995507920 5:112879769-112879791 TAAAGTATATGGAAGAGGCCGGG - Intronic
996778064 5:127154556-127154578 TGTGGTGTAAGGAAGGGGTCCGG + Intergenic
996850585 5:127947132-127947154 TATGGTGTAAGGACAGGGTCCGG + Intergenic
997099395 5:130952442-130952464 TATGTTACAAGAAAGGGGTCCGG + Intergenic
998724000 5:144988096-144988118 TAAGTTGTAAGGAAGGGGTCCGG - Intergenic
998776150 5:145605350-145605372 TACGGTGTAAGGAAGGGGTCAGG + Intronic
999082158 5:148854963-148854985 TAGAGTGTGAGGAAGGGGCCTGG + Intergenic
999125515 5:149243180-149243202 TCTGGGGCAAGGAAGGGGCCAGG - Intronic
999452253 5:151687035-151687057 TATGGGAGAAGGAGGAGGCCGGG - Exonic
999489387 5:152034482-152034504 TAAGGTATAAGGAAGGGGTCCGG + Intergenic
999670502 5:153955317-153955339 TATGGAATAAGAAAGAGCCCAGG + Intergenic
1000279598 5:159770956-159770978 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1000786806 5:165555057-165555079 TATAGTGTAAGGAAGGGGTCCGG - Intergenic
1002007496 5:176247784-176247806 TAAGGTGTAAGGAAGGGGCCCGG + Intronic
1002449931 5:179312973-179312995 TATGGTAGAAGAATGGGGCTGGG + Intronic
1004352248 6:14900427-14900449 TAAGGCGTAAGGAAGGGGTCCGG - Intergenic
1006821176 6:36896830-36896852 TATAGTATAAAGAAAGGGACAGG + Intronic
1007193883 6:40042465-40042487 TATGTGCCAAGGAAGGGGCCAGG - Intergenic
1008164791 6:48123025-48123047 TATGGTGTAAGGAAGGGGTCTGG + Intergenic
1008293611 6:49750521-49750543 TATGGTGTAAGGAAGGGGTCTGG + Intergenic
1009028200 6:58025124-58025146 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
1009264559 6:61536721-61536743 TAAAGTGTAAGGAAGGGGTCCGG - Intergenic
1009274437 6:61657142-61657164 TTTGGTATCAGGAAAGGGACAGG - Intergenic
1009321382 6:62293958-62293980 TGTGGTATGAAGCAGGGGCCCGG - Intergenic
1009804773 6:68589576-68589598 TATGGTAAAAGGAAAGAGCCTGG + Intergenic
1009855344 6:69255880-69255902 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1010540185 6:77083653-77083675 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1010691869 6:78920598-78920620 TATGGTGAAAGGAATGAGCCTGG - Intronic
1011105239 6:83772466-83772488 TATGGTATCAGGAAAGGGTCTGG + Intergenic
1011235912 6:85216761-85216783 TAAGGTGTAAGGAAGGAGTCCGG - Intergenic
1011327040 6:86159910-86159932 TATGATGCAAGGAAGGGGTCCGG - Intergenic
1011542291 6:88444288-88444310 TATGGTGTGAGGTAGGGGCTAGG + Intergenic
1012074820 6:94670493-94670515 CATGGGATTTGGAAGGGGCCAGG + Intergenic
1012148930 6:95721095-95721117 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1012187184 6:96233414-96233436 AATGGAATCAGGAAGAGGCCTGG - Intergenic
1012485728 6:99720895-99720917 TATAGTGTAAGGAAGGGTTCTGG + Intergenic
1012801324 6:103833004-103833026 TACAGTGTAAGGAAGGGGTCTGG - Intergenic
1012814041 6:103999360-103999382 CATGGTGTAAGGAAGGGGTCCGG - Intergenic
1013666289 6:112352371-112352393 TGTGGTGTAAGGAATGGGTCTGG - Intergenic
1014039833 6:116813571-116813593 TAAGGTGTAAGGAAGGGATCCGG - Intronic
1014070820 6:117179801-117179823 TAAGGTGTAGGGAAGGGGTCCGG - Intergenic
1014367455 6:120562530-120562552 TATGGTGTAAGGAAAGGGTCCGG + Intergenic
1014367665 6:120564126-120564148 TGTGGTGTAAGGAAAGGGTCCGG - Intergenic
1016238019 6:141891169-141891191 TATGGTGTAAAGAAGGGGTCTGG - Intergenic
1016256193 6:142108744-142108766 CATGATATTTGGAAGGGGCCAGG - Intergenic
1016368537 6:143344928-143344950 TATAGTGTAAGGAAGAGGTCTGG + Intergenic
1016604882 6:145908927-145908949 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
1016730853 6:147426111-147426133 TAAGGTATAAGAAAGGGGTCTGG + Intergenic
1017302792 6:152882115-152882137 TAAGGTGTAAGGAAGGGATCTGG - Intergenic
1017729768 6:157305138-157305160 GAAGGAATAAGGAAGAGGCCGGG + Intronic
1017836054 6:158179023-158179045 TAAGGTGTAAGGAAAGGGTCCGG + Intronic
1018466239 6:164048065-164048087 TATGATATTTGGGAGGGGCCAGG + Intergenic
1019086683 6:169484984-169485006 TATGGCTAAAGGAAGGGGTCCGG - Intronic
1019528367 7:1491406-1491428 TATGGTGTGAGGCAGGGGTCCGG - Intronic
1019672949 7:2292277-2292299 TATGGTGTGAGGGAGGGGTCCGG - Intronic
1019984587 7:4646459-4646481 TATGTTATATGGAAGGGGCAAGG + Intergenic
1020694548 7:11397374-11397396 TAAGGTGTAAGGAAGGGGTCCGG - Intronic
1021004019 7:15371078-15371100 TATGGTGAAAGGTAGGGGTCTGG - Intronic
1021015120 7:15522659-15522681 TAAGGTGTAAGGAAGGGGTCCGG - Intronic
1021776811 7:24062357-24062379 TAAGGTATAAGGAAAAGGTCCGG - Intergenic
1022058384 7:26765646-26765668 TAATGTGTAAGGAAGGGGTCCGG + Intronic
1025160240 7:56652799-56652821 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
1027506667 7:79024296-79024318 TATGGTGTAAGGAAGGGGTCCGG - Intronic
1028025785 7:85837014-85837036 TATGGGATTAGAAAGGGGGCTGG - Intergenic
1029460408 7:100691088-100691110 TTTAGTCCAAGGAAGGGGCCAGG - Intergenic
1030012106 7:105180389-105180411 TATGGTGTAAGGAAGGGGTGCGG - Intronic
1031703129 7:124949790-124949812 TATGGTGTAAGCAAGGTGTCCGG - Intergenic
1032496880 7:132369298-132369320 TATGATATCAGCAAGGGGTCTGG - Intronic
1033102471 7:138486514-138486536 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1033836361 7:145316995-145317017 TAAGGTGTAAGGAAGGAGTCCGG - Intergenic
1034589237 7:152125970-152125992 TGTGGTATAAGGTAGTGGCAGGG - Intergenic
1034693968 7:153037797-153037819 TATGGTATGAGAGAGGGGTCAGG + Intergenic
1034893267 7:154858895-154858917 GTTGGTACAAGGAAGGGGCCTGG - Intronic
1035834836 8:2738901-2738923 TGTTGTGTAAGGAAGGGGTCCGG + Intergenic
1037003253 8:13747014-13747036 CATGAGATATGGAAGGGGCCAGG - Intergenic
1037758725 8:21727949-21727971 TATGGTAGAAGGAGTGTGCCTGG - Intronic
1039084410 8:33765711-33765733 TATGGTGTGAGGTAGGGGCCAGG - Intergenic
1040426969 8:47298631-47298653 TAAGGTGTAAGGAAGGGATCTGG + Intronic
1041747166 8:61220336-61220358 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
1042125712 8:65535239-65535261 AATGGTTTAAGCAAGTGGCCAGG + Intergenic
1042664306 8:71189494-71189516 AACGGAAGAAGGAAGGGGCCAGG - Intergenic
1043324976 8:79038885-79038907 TATGGTGTAAGGAAGGGATCCGG - Intergenic
1043774109 8:84243017-84243039 TAAGGTGTAAGGAAGGGGTCCGG + Intronic
1044508980 8:93053461-93053483 AAAGGTATAAGGAAGGGGTCTGG + Intergenic
1044736942 8:95288569-95288591 TAACATATAAGGAAGGGGTCCGG + Intergenic
1045706702 8:104931669-104931691 AAAGGCAGAAGGAAGGGGCCAGG + Intronic
1045980977 8:108187114-108187136 TATGGTGTGAGGGAGTGGCCAGG + Intergenic
1046189775 8:110778379-110778401 TCTTGTGTAAGGAAGGGGTCCGG - Intergenic
1046223088 8:111240648-111240670 CATGGTATAAGCATGGGGCATGG - Intergenic
1046279519 8:112007331-112007353 TATGGTATAATGAAGGGGTCTGG + Intergenic
1046644957 8:116776082-116776104 CAGGGTATGGGGAAGGGGCCAGG - Intronic
1046979696 8:120323594-120323616 TATGGTATAAGGAAGGGGTCCGG + Intronic
1048134325 8:131732764-131732786 CAAAGTATAAAGAAGGGGCCAGG + Intergenic
1048321430 8:133403624-133403646 GATGGTGTGAGGAGGGGGCCAGG + Intergenic
1048669256 8:136697633-136697655 TATGGTGTAAGAAAGGGGTCTGG + Intergenic
1048716026 8:137271013-137271035 TATTGTGTAAGGAAGAGGTCTGG - Intergenic
1048897697 8:139007875-139007897 TCTGTTTTAAGGAAGGGGCCAGG + Intergenic
1049436541 8:142588721-142588743 CATGGAACAAGGAAGGGGCAGGG - Intergenic
1049899460 9:144509-144531 TAAGGTGTAAGGAAGGGATCTGG - Intronic
1052443864 9:28533505-28533527 TATCTTATAAGGAAGGAGTCAGG + Intronic
1052596830 9:30572271-30572293 TAAGATGTAAGGAAGGGGTCCGG - Intergenic
1053222171 9:36321260-36321282 TATGATATAAGGAAGGGGTCTGG - Intergenic
1053275228 9:36778292-36778314 TATCATATGGGGAAGGGGCCAGG - Intergenic
1054347784 9:63984632-63984654 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1054445508 9:65310976-65310998 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1054484761 9:65710532-65710554 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1055895271 9:81167400-81167422 TAAGGTGTAAGGAAGGGATCTGG - Intergenic
1056456194 9:86763415-86763437 TATGGTATATGAAAGGGGTGAGG + Intergenic
1056603073 9:88061630-88061652 TAAGGAGTAGGGAAGGGGCCAGG - Intergenic
1057030558 9:91772089-91772111 AATCATATAAGGAAGGGGCCAGG + Intronic
1058095913 9:100860294-100860316 TATGGTGAAAGGAAGGGGTCTGG + Intergenic
1058183001 9:101820787-101820809 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1058511999 9:105729258-105729280 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1059089530 9:111341052-111341074 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1059383524 9:113946841-113946863 GATGGCATCAGGAAGGGTCCTGG - Intronic
1060596278 9:124851039-124851061 TAGGGTATAAGAAATGGGGCAGG + Intergenic
1187315556 X:18190568-18190590 TATGGAATAAAGATGAGGCCAGG + Intronic
1187494256 X:19780621-19780643 TAAGGTGTAAGGAAGGGATCCGG + Intronic
1187966667 X:24618916-24618938 TAAAGTATCAGAAAGGGGCCGGG - Intronic
1188362386 X:29272083-29272105 CATGGTGTAAGGAAGGGGTCCGG + Intronic
1190374983 X:49780284-49780306 TAAGGTGTAAGGAAGGGATCAGG - Intergenic
1190650259 X:52562803-52562825 TGGGAGATAAGGAAGGGGCCTGG - Intergenic
1190717880 X:53119444-53119466 TGTGGTATAAGGTAGGGAGCTGG + Intergenic
1190901296 X:54676131-54676153 TGTGGTATAAGGAAGGGGTCTGG - Intergenic
1191071568 X:56406115-56406137 TAAGGTGTAAGGAAGGAGTCCGG + Intergenic
1191591936 X:62895612-62895634 TGTGGTGTAAGGAAAGGGTCAGG + Intergenic
1191656369 X:63603244-63603266 TGTGGTATAAGGAGGGTGTCTGG + Intergenic
1191935097 X:66418953-66418975 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1192242045 X:69339941-69339963 TAAGGTGTAAGGAAGGGATCGGG + Intergenic
1192256008 X:69459715-69459737 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1192921878 X:75715406-75715428 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
1193051157 X:77101257-77101279 TAAGGTGTAAGGAAGGGATCCGG + Intergenic
1193072778 X:77323831-77323853 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1193153555 X:78148877-78148899 TATGAGATTTGGAAGGGGCCAGG + Intergenic
1193340872 X:80347850-80347872 TAGTGTGTAAGGAAGGGGTCTGG + Intronic
1193359433 X:80562852-80562874 TAAGGTGTAAGGAAGGGATCCGG - Intergenic
1193381707 X:80823396-80823418 TAAGGTGTAAGGAAGGGGTCTGG + Intergenic
1193552096 X:82907134-82907156 TAAGGTGTAATGAAGGGGTCCGG - Intergenic
1193577891 X:83226305-83226327 TATGATGTAAGGAAGGTGGCTGG + Intergenic
1193844447 X:86451235-86451257 TATGGTATAAGGAAGGGGCCTGG + Intronic
1194099172 X:89680581-89680603 TTTGGTATATGGAATGGGCAAGG + Intergenic
1194396390 X:93392505-93392527 TAAGGTGTAAGGAAAGGGTCCGG - Intergenic
1194555543 X:95354045-95354067 TAAGGTGTAAGGAAGGGGTCCGG + Intergenic
1194852396 X:98885742-98885764 TAAGGTGTAAGGAAGGGGTCTGG - Intergenic
1195171244 X:102270727-102270749 TAAAGTGTAAGGAAGGGGTCTGG + Intergenic
1195187616 X:102416372-102416394 TAAAGTGTAAGGAAGGGGTCTGG - Intronic
1195601730 X:106756550-106756572 TAAGGTGTAAGGAAGGGATCCGG - Intronic
1195639795 X:107160594-107160616 TAAGGTGTAAGGAAGGGATCCGG - Intronic
1196100284 X:111840320-111840342 TAAAGTATATGGAATGGGCCAGG - Intronic
1196109678 X:111932572-111932594 TATGGTGAAAGGAAAGGGCCAGG - Intronic
1196528932 X:116760296-116760318 TATGGTGTAAGGAATGGGTCTGG - Intergenic
1197003891 X:121473107-121473129 TAAGGTATAAGGAAGGGATCCGG + Intergenic
1197023358 X:121717412-121717434 TATGAGATACGGGAGGGGCCAGG - Intergenic
1197123846 X:122921555-122921577 TATGGTGTGAGGAAGGAGTCCGG + Intergenic
1197418409 X:126205654-126205676 TATGGTATAAGAAAGGGGTCTGG + Intergenic
1197497252 X:127200103-127200125 TATGCTGTAAGGAAGGGATCTGG + Intergenic
1197506450 X:127310753-127310775 TAAGGTGTAAGGAAGGGGTCCGG - Intergenic
1198960640 X:142178913-142178935 TATGGTGTAAGGAAGGGATGTGG + Intergenic
1199079942 X:143565891-143565913 TAAGGTGTAAGGAAGGAGTCCGG - Intergenic
1199161532 X:144617787-144617809 TAAGGTATAAGGAAGGGGTCCGG + Intergenic
1199235624 X:145488925-145488947 TATGTGACAAGGAAGGGACCAGG - Intergenic
1199449450 X:147963192-147963214 TATGGTTTAATGAATGGGTCTGG - Intergenic
1199547601 X:149022916-149022938 TATGGTGTAAGGAAGGTGTCCGG - Intergenic
1199868676 X:151877044-151877066 TATGATATTTGGGAGGGGCCAGG - Intergenic
1200452188 Y:3341960-3341982 TTTGGTATATGGAATGGGCAAGG + Intergenic
1201352281 Y:13057030-13057052 TATGGTATAAAGAAGGGGACCGG + Intergenic
1201507135 Y:14714597-14714619 TAAGGTGTAAGGAAAGGGTCCGG - Intronic
1201522328 Y:14889020-14889042 TAAGGTGTAAAGAAGGGGTCCGG + Intergenic
1201676434 Y:16590519-16590541 TAAGGTGTAAGGAAGGGGACTGG - Intergenic
1201709049 Y:16969338-16969360 TAAGGTGGAAGGAAGGGGTCTGG + Intergenic
1201769399 Y:17604390-17604412 TATGGTGTAAAGAAGGGGTCTGG - Intergenic
1201832155 Y:18301595-18301617 TATGGTGTAAAGAAGGGGTCTGG + Intergenic