ID: 1193846142

View in Genome Browser
Species Human (GRCh38)
Location X:86473503-86473525
Sequence TAGTGGGTGATGGGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1042
Summary {0: 1, 1: 0, 2: 6, 3: 94, 4: 941}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193846142 Original CRISPR TAGTGGGTGATGGGGGAGGA AGG (reversed) Intronic
900037383 1:427476-427498 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
900059013 1:663217-663239 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
900155993 1:1203471-1203493 TGCTGGGTGCTGGGGGAGGACGG - Intergenic
900244138 1:1629919-1629941 TGGGGTGTGATGGGGGAGGAGGG - Intronic
900573269 1:3370517-3370539 TGGTGGGTGGTGGGGCTGGAAGG - Intronic
901885001 1:12216548-12216570 GACTTGGTGCTGGGGGAGGAGGG + Intergenic
902108487 1:14058146-14058168 TAGTGGGGGAAGGTGGAGGGAGG - Intergenic
902262069 1:15233692-15233714 TAGAGGGTGTGGGGGCAGGAGGG - Intergenic
902551117 1:17220122-17220144 GAGTGGGGGATGGGGGAGGTGGG + Intronic
902553350 1:17232343-17232365 CAGGGGGTGAAGTGGGAGGATGG - Intronic
902571100 1:17347588-17347610 TAGGAGGTGATGGGGGGTGAGGG - Intronic
902972374 1:20063089-20063111 TGGAGGGTGAGGTGGGAGGATGG + Intronic
903074417 1:20751615-20751637 GAAAGGGTGAGGGGGGAGGATGG + Intronic
903407645 1:23111730-23111752 CAGGTGGTGATGGGGTAGGACGG - Intronic
903556181 1:24195342-24195364 GAGTAGGTGGTGGAGGAGGAGGG + Intergenic
904255964 1:29255093-29255115 TAGAGGGAGAGGGTGGAGGAGGG + Intronic
904387659 1:30155241-30155263 TATTGGGTGATGGGGGGCTAGGG - Intergenic
904582325 1:31553846-31553868 GAGTGGGGGAGGGGGGTGGAAGG - Intergenic
904609672 1:31718572-31718594 CAGTGGTTGATGGGGGATGGGGG - Intergenic
904788267 1:32998716-32998738 CAGGGGGTGATGGGGGTGGAGGG - Intergenic
905010685 1:34745114-34745136 GAGTGGGTGCTGGGAAAGGAAGG - Intronic
905014510 1:34768082-34768104 CAGTGTGTGGTGGGTGAGGAGGG - Intronic
905137528 1:35811046-35811068 TGGTGGCTGAAGTGGGAGGATGG + Intronic
905183971 1:36183057-36183079 TGGTGGGTGATGGCTGAGGAGGG - Intergenic
905199813 1:36307894-36307916 TAGTGGGGGAAGGGGCAGGGAGG - Intronic
905271076 1:36787858-36787880 AAGTGGAAGATGGGAGAGGAAGG - Intergenic
905359143 1:37406454-37406476 TCGTGGGTGCTGGGTCAGGAGGG + Intergenic
905457380 1:38097458-38097480 TGCTGCGGGATGGGGGAGGAAGG - Intergenic
905793998 1:40805243-40805265 TGGTGGGGGAGAGGGGAGGAGGG - Intronic
905961535 1:42046402-42046424 TGGGGGGTGATGGGGATGGAAGG + Intergenic
906390997 1:45416185-45416207 TAGAGGCTGAGGTGGGAGGATGG - Intronic
906530304 1:46520087-46520109 GAATGAGTGATGGGGGTGGAGGG - Intergenic
906639218 1:47431669-47431691 TGGTGGTGGATGGGGGAGGGTGG + Intergenic
906787727 1:48630511-48630533 CTGTGGCTGATGGGAGAGGAAGG - Intronic
907838901 1:58137553-58137575 TAGAGGGTGATAGAGGTGGATGG - Intronic
907973583 1:59409037-59409059 AATTGTGAGATGGGGGAGGATGG - Intronic
908029510 1:59984875-59984897 TTGTGTGTGTTGTGGGAGGAGGG + Intergenic
908580860 1:65515105-65515127 TGGTGGGTGATGGTTGAGGGAGG + Intronic
909524384 1:76606561-76606583 CAGAGGGTGGAGGGGGAGGAGGG + Intronic
909899377 1:81113223-81113245 GAATGGGTGATAGGGTAGGAGGG + Intergenic
910931481 1:92446748-92446770 TGGTGGCTGCTGAGGGAGGAGGG - Intergenic
911121847 1:94304140-94304162 TTTTGGGGGATGGGGGAAGAAGG + Intergenic
911174309 1:94803966-94803988 TGGTGGGGCATGGGGGAGGGAGG - Intergenic
911226315 1:95309227-95309249 TAGTGGCGGATGGGGAGGGAGGG + Intergenic
911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG + Intergenic
911849660 1:102802058-102802080 CAGTGGGAGATGGGGGTGAACGG - Intergenic
911995194 1:104758034-104758056 AAGAGGGGGATGGGGGAGGTGGG + Intergenic
912228997 1:107770279-107770301 TAGAGAGTGATGGGGGGGGAGGG - Intronic
912271941 1:108220209-108220231 AAGTGAGGGATGGGGGAGGGGGG + Intergenic
912448788 1:109757382-109757404 TGGAGGGGGATGGGGGAGCAGGG - Intronic
912512216 1:110197364-110197386 GAGATGGTGATGGGGGAAGAGGG + Intronic
912521563 1:110249115-110249137 TAGTTGGCCATGGGGCAGGAAGG - Intronic
913406906 1:118504365-118504387 GTGTGGGAGATGGGGGAGTAGGG + Intergenic
914329912 1:146658171-146658193 TGGTGGCTGAGGTGGGAGGATGG - Intergenic
914839720 1:151238455-151238477 TCTGGGGAGATGGGGGAGGAAGG - Intronic
915152114 1:153842076-153842098 TAGTGGCTGAGGTAGGAGGATGG - Intronic
915653069 1:157333782-157333804 TAGAGAGTGATGGGGGTGGGCGG - Intergenic
915665314 1:157439153-157439175 CAGAAGGTGATGGGGAAGGAAGG + Intergenic
915838869 1:159199765-159199787 TGGTAGGTGCTGGAGGAGGAGGG - Exonic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
916025737 1:160831838-160831860 TAATGGGTAGTGGGGGAGGTTGG + Intronic
916169290 1:161988586-161988608 TGGTGGAAGCTGGGGGAGGAAGG - Intronic
916225652 1:162487478-162487500 TAGTTGGTGCTGGGAGAGAAAGG + Intergenic
916266283 1:162892611-162892633 TAGTGGGTGGTAGGGGTGAAGGG + Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916695516 1:167231993-167232015 GTGTGTGTGTTGGGGGAGGAGGG - Intronic
916759012 1:167800149-167800171 TAGTGGGTGGTGGGGGCTGGGGG + Intergenic
917151530 1:171950654-171950676 TAGTGGTTTTTGGTGGAGGATGG + Intronic
917306801 1:173634837-173634859 TAGTGGGTGAGGGGTGAGGAAGG - Intronic
917728281 1:177848561-177848583 GAGAGGGAGATGGGGCAGGAGGG - Intergenic
917876538 1:179291891-179291913 TGGTGGGGGATGGGGGGTGAGGG - Intergenic
918202435 1:182279943-182279965 GAAAGGGGGATGGGGGAGGAGGG - Intergenic
918267739 1:182861518-182861540 TAGTGGTAGAAGGGAGAGGAAGG - Intronic
918314649 1:183313101-183313123 GCGTGCGTGTTGGGGGAGGAGGG - Intronic
918610025 1:186478753-186478775 TGGTGGGAGAGGGGTGAGGAAGG + Intergenic
918620761 1:186602080-186602102 TGGTGGGGGATGTGGGGGGAGGG - Intergenic
918701309 1:187611836-187611858 TAGTGGGGGATGGGAGGGCATGG + Intergenic
918801686 1:188980732-188980754 TATTGGGGGATGGGGGATGAGGG - Intergenic
919009178 1:191937502-191937524 TGGGGGGTTATGGGGGAGGTGGG + Intergenic
919297232 1:195718406-195718428 GAGTTGGTGCTGGTGGAGGAGGG + Intergenic
919518028 1:198551027-198551049 TAGTGGGAGAAGGAGGAGGAAGG + Intergenic
919697656 1:200595014-200595036 TAGTGGCAGATGAGGGAGGTTGG - Intronic
920039548 1:203086388-203086410 TGGTGGGTATAGGGGGAGGAGGG + Intergenic
920098157 1:203499970-203499992 AGGTGGGTGATGGTGGAGGTGGG - Intronic
920412432 1:205772910-205772932 GAAGGGGTGATGGGGGAGAAGGG + Intronic
920487106 1:206381210-206381232 GAGTGGGGGATGGGGGAAGAAGG - Intronic
920904047 1:210142755-210142777 CAGTGGGAAATGGGGGAGGAAGG - Intronic
921183019 1:212646188-212646210 GAGTGGGAGAAGGGGGCGGAGGG - Intergenic
922144504 1:222926094-222926116 TAGTGGTTGCTGGGGGCTGAGGG - Intronic
922178069 1:223212540-223212562 TGGTGGGAGGTGGGGGTGGAGGG + Intergenic
922196501 1:223364238-223364260 GGGCGGGTGTTGGGGGAGGACGG + Intergenic
922240917 1:223755184-223755206 TGGTGGGAGATGGCAGAGGATGG - Intronic
922383300 1:225055681-225055703 TATTGTGTGGTGGGGGAGGGGGG - Intronic
922591310 1:226779382-226779404 TAGTGGGTGAAACGGGATGAAGG + Intergenic
923462888 1:234222538-234222560 TATGGGGGGATGGGGGAGTATGG - Intronic
924599211 1:245473565-245473587 TAATGGGGGTTGGGGGAGAAAGG + Intronic
924884721 1:248202257-248202279 TACCGTGTGATGGGGGAGGCAGG - Intergenic
924931675 1:248737814-248737836 CAGTGGGTCATGGGGGATGGTGG + Intronic
1062878224 10:958817-958839 TAGTGGGTGATGTGGGCAGCAGG - Intergenic
1062939897 10:1413243-1413265 GAGTGGGAGATGGTGCAGGAAGG + Intronic
1062972569 10:1660138-1660160 AAGGGGGCGATGGAGGAGGAGGG - Intronic
1062991264 10:1821465-1821487 GATTAGGTGATGGGGTAGGATGG - Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1063548721 10:7007692-7007714 TCGTGGGTGGTGGGGGAGGCAGG - Intergenic
1063958180 10:11284489-11284511 GAGTGTGTGGTGGGGGATGAGGG + Intronic
1064058784 10:12119668-12119690 CCGAGGGTCATGGGGGAGGAGGG + Intronic
1064971928 10:21074906-21074928 GGGTGGCTGATGTGGGAGGATGG - Intronic
1065624235 10:27614402-27614424 TCGGGGGTGAAGGAGGAGGAAGG - Intergenic
1066209701 10:33224709-33224731 TAGCGGGGTATGTGGGAGGACGG - Intronic
1066498399 10:35965112-35965134 GAGTGGCTGAGGTGGGAGGATGG - Intergenic
1066551840 10:36567554-36567576 TAGTGGGGTATGTGGGAGGAGGG - Intergenic
1067159614 10:43813247-43813269 TAGAGGGTGATGTGGGTGCAGGG + Intergenic
1067250102 10:44578762-44578784 TTCTGTGTGCTGGGGGAGGAAGG + Intergenic
1067394662 10:45903608-45903630 TAGTGGGTCATGGTGGGGGTGGG - Intergenic
1067691303 10:48504038-48504060 AAGTGCGGGATGGGGAAGGAGGG + Intronic
1067862985 10:49872739-49872761 TAGTGGGTCATGGTGGGGGTGGG - Intronic
1068244743 10:54350269-54350291 TACTGGCTGACAGGGGAGGATGG + Intronic
1068267850 10:54677273-54677295 CAGAGGCTGATGGGGGAGGATGG + Intronic
1068393894 10:56436229-56436251 GGGAGGCTGATGGGGGAGGATGG - Intergenic
1069688254 10:70333245-70333267 TACAGTGTGTTGGGGGAGGAGGG - Intronic
1069938319 10:71935063-71935085 TGGCGGGTGGTGGGGAAGGATGG - Intergenic
1070127897 10:73636558-73636580 TGGAGGGTGAGGTGGGAGGATGG - Intronic
1070252699 10:74786952-74786974 GGGTGGGTGGTGGGGGAGGGGGG - Intergenic
1070373494 10:75807367-75807389 TGGTGAGCGATGGGGCAGGATGG + Intronic
1070826215 10:79391875-79391897 TAGTGGGGGATGGAGGAGCCAGG - Intronic
1070952855 10:80444763-80444785 TTCTGTGTGTTGGGGGAGGAAGG - Intergenic
1071713722 10:88074531-88074553 GTGTGTGTGATGGGGGAGGGAGG + Intergenic
1071971415 10:90911501-90911523 TAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1072392380 10:95000308-95000330 TAGAGGGAGATGGGGTGGGAAGG + Intergenic
1072545753 10:96436788-96436810 GGGAGGGTGAGGGGGGAGGATGG - Intronic
1072911808 10:99508872-99508894 GAGTGGGAGAAGGAGGAGGATGG - Intergenic
1073069472 10:100784084-100784106 GAGTGGGGGAAAGGGGAGGAGGG - Intronic
1073476346 10:103756441-103756463 CAGCGGGTGATGGTGGTGGAGGG - Intronic
1073599388 10:104831840-104831862 AAGTAGGTGATGGGGGAGGGGGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1073896595 10:108167572-108167594 TCATGGGAGATGGGGGAGCAGGG - Intergenic
1074333291 10:112542411-112542433 TGGTGAGGGATGGGGGAGCAAGG - Intronic
1074885425 10:117689290-117689312 TGCTGGGTGAAGGGAGAGGAGGG + Intergenic
1075015643 10:118908445-118908467 CAGTGGGGGCTGGGGGAGGGAGG - Intergenic
1075223450 10:120603872-120603894 TTGTGTGTGTTGGGGGAGGGGGG - Intergenic
1075494900 10:122911578-122911600 TAGTGGCTGTGTGGGGAGGAAGG + Intronic
1076571625 10:131437199-131437221 TGGAGGGTGATGGGGGTGGGAGG - Intergenic
1076933930 10:133555188-133555210 AAGGTGGTGATGGGGCAGGAGGG - Intronic
1076934738 10:133559778-133559800 TAGCGGGTGAGGGGGAAGGAAGG + Intronic
1076964109 11:65399-65421 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
1079135641 11:17774782-17774804 CAGTTGGTGACGGGGGAGGCAGG - Intronic
1079165998 11:18044038-18044060 TAGTTGGTGTGGGGAGAGGAGGG + Intergenic
1079309939 11:19356265-19356287 TATAGGGTCAGGGGGGAGGATGG + Intronic
1079819665 11:25109558-25109580 TAGAGGGTGAAGGGAGAGGAAGG - Intergenic
1081155417 11:39683943-39683965 TTGTGTGTGTTGGGGGTGGAAGG - Intergenic
1081199511 11:40199389-40199411 TTGTGGTTGTTGGGGAAGGAGGG + Intronic
1081232155 11:40598799-40598821 CAGAGGGTGCTGGGGGAGGGAGG + Intronic
1081549567 11:44098758-44098780 TGGTGGGTGGTGGGAGAGGAGGG + Intronic
1081583668 11:44369644-44369666 GATTGGGGGATGGGGGATGAAGG - Intergenic
1081672196 11:44948792-44948814 TCTTGGGGTATGGGGGAGGAGGG - Intronic
1082052762 11:47786026-47786048 TAGTGGATGATGGGGGCTGATGG + Intronic
1082259736 11:50069528-50069550 AAGAGGCTGAGGGGGGAGGATGG + Intergenic
1082998137 11:59268759-59268781 CAGTGGGTGCTGGGTGATGAAGG + Intergenic
1083659319 11:64244964-64244986 TAGCAGAGGATGGGGGAGGAAGG + Intronic
1083746701 11:64741110-64741132 TGCTGGGTGATGGTGGGGGAAGG - Intronic
1083774660 11:64888570-64888592 GTGTGGGTGATGGGGCATGATGG + Intergenic
1083900006 11:65638936-65638958 TAGTGTGTGAAGGAGTAGGAGGG - Intronic
1083945271 11:65919711-65919733 AAGGGGGTGCTGGGGGAGGAAGG - Intronic
1084296190 11:68214343-68214365 TAGTGGGTGCTGGGGGCGGCGGG - Intergenic
1084309762 11:68310165-68310187 TAGTGGGTGGTGGTGGTGGGGGG + Intergenic
1084488538 11:69464857-69464879 GAGTGGGTGATGGGTGGGGCCGG + Intergenic
1084551257 11:69843487-69843509 GAGTGGGTGGTGGCTGAGGATGG + Intergenic
1084801115 11:71544868-71544890 TGGTGGGGGATGGGGGGTGAGGG - Intronic
1084870901 11:72097993-72098015 TAGATGGTGATGGAGAAGGAGGG + Intronic
1085309526 11:75507919-75507941 GGGTGGGTGTTGGGGGATGATGG - Intronic
1085672849 11:78485230-78485252 TATTGGGGGATGGGGGACAAGGG + Intronic
1087046402 11:93847366-93847388 TAGTGGAAGGTGGGGGCGGATGG - Intronic
1087367053 11:97233373-97233395 TGGTGGCTGAGGTGGGAGGATGG - Intergenic
1087815701 11:102656121-102656143 TAGTGGGAGATGGGGGATAAAGG - Intergenic
1088444423 11:109909410-109909432 GAGAGGGTGAGGTGGGAGGATGG - Intergenic
1088645051 11:111911357-111911379 AAACAGGTGATGGGGGAGGAAGG + Intronic
1089020538 11:115209619-115209641 TGGTGGTTGTTGTGGGAGGAGGG + Exonic
1089116456 11:116099167-116099189 TACTGGGGTAGGGGGGAGGATGG - Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089174309 11:116537316-116537338 ACGTGGGTGTTGGGGGACGAGGG - Intergenic
1089198258 11:116707867-116707889 TATTAAGTGATGGGGGCGGAGGG + Intergenic
1089200622 11:116722767-116722789 GAGTGGGTGTTGGGGTGGGAAGG - Intergenic
1089400130 11:118159733-118159755 TAGGAGGTGCTGGGGAAGGAAGG - Intergenic
1089418863 11:118316022-118316044 TAGGGAGTGTTGGGGGAGGGAGG - Exonic
1089557335 11:119321528-119321550 TGAAGGGTGATGGGGGCGGAGGG + Intergenic
1089561493 11:119345552-119345574 CAGTGGGTGTTGGGGGGGTAAGG + Exonic
1089695432 11:120213262-120213284 TAGTGGCTGATGGCGGGGGTGGG + Intronic
1089718414 11:120387235-120387257 TTGTGTGTGGTGGGGGGGGAGGG + Intronic
1089832389 11:121339983-121340005 TATTGGGGGATCTGGGAGGAAGG + Intergenic
1089905227 11:122031424-122031446 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1090198816 11:124839552-124839574 TAGCGGCTGATGGAGGAGGCGGG + Intergenic
1090239322 11:125170959-125170981 CAGTGGGGGAGGGGGGAGGCTGG + Intronic
1090348334 11:126089255-126089277 GGGTGGGTGATGGGGCAGCAGGG - Intergenic
1090457950 11:126866148-126866170 TAGAGAGTGATGGGGGAGGGAGG + Intronic
1090488933 11:127140767-127140789 TAGAGGCTGAGGTGGGAGGATGG + Intergenic
1090832870 11:130431270-130431292 TGGTGGGTGGTGGGGGTGGTGGG - Intergenic
1090933747 11:131323611-131323633 GAGTGGATGATGGTGGTGGATGG + Intergenic
1091338287 11:134790199-134790221 TACTGTGTGATGAGAGAGGAAGG - Intergenic
1091822961 12:3490479-3490501 TGGTGGGGGAAGGGTGAGGAGGG + Intronic
1092174534 12:6394111-6394133 CACAGGGAGATGGGGGAGGATGG + Intergenic
1092288108 12:7141564-7141586 TAGTGGGAGATACGGGAGGGAGG - Intronic
1092846465 12:12589590-12589612 TGGTGGGTTGTGGGGAAGGAAGG + Intergenic
1092846492 12:12589698-12589720 TAGTGGGTTGTGCGGAAGGAAGG + Intergenic
1092846552 12:12589934-12589956 TGGTGGGTTGTGGGGAAGGAAGG + Intergenic
1092846584 12:12590062-12590084 TGGTGGGTTATGTGGAAGGAAGG + Intergenic
1092846623 12:12590226-12590248 TGGTGGGTTGTGTGGGAGGAAGG + Intergenic
1093057473 12:14568990-14569012 CAGTGGGAGAGGGGGAAGGAGGG + Intergenic
1093542105 12:20299338-20299360 ATTTGGGTGAAGGGGGAGGAAGG - Intergenic
1093617655 12:21247527-21247549 TAGTGGGAGTAGGGGGTGGATGG + Intergenic
1094174181 12:27524511-27524533 TTGGGGGTGGTGGGGGTGGAGGG + Intronic
1094706768 12:32921996-32922018 TCGTGGGTCATGGGGGTAGAGGG - Intergenic
1095177677 12:39111790-39111812 GATAGGGTGATGGAGGAGGAAGG + Intergenic
1095341277 12:41092012-41092034 TAGAGGCTGAAGTGGGAGGATGG - Intergenic
1095552028 12:43454275-43454297 TAGAGTGTCATTGGGGAGGAAGG + Intronic
1096623034 12:52876439-52876461 TGGTGCGTGCTGTGGGAGGAAGG - Intergenic
1096737838 12:53669818-53669840 TTGGGGGTGATGGGTGGGGAGGG - Intronic
1096795038 12:54071467-54071489 TGGTGGGGGGTGGGGGAGTAGGG + Intergenic
1096993238 12:55821882-55821904 TCCTAGGTGTTGGGGGAGGAGGG + Exonic
1097947328 12:65385198-65385220 TGGTGGGAGAAGGAGGAGGATGG + Intronic
1097960936 12:65531496-65531518 TGGTGGTAGATGGGGTAGGAGGG - Intergenic
1098079197 12:66766022-66766044 TAGTGAGTCCTGGAGGAGGATGG - Intronic
1098142469 12:67464397-67464419 TAGGGGGTTGTGGGGGAGGTGGG - Intergenic
1098850782 12:75593730-75593752 TAGTGGGTGGGGGATGAGGATGG - Intergenic
1098901820 12:76118838-76118860 AAGTGGGAGACGGAGGAGGAGGG - Intergenic
1098974062 12:76883882-76883904 ATGTTGGAGATGGGGGAGGATGG - Intergenic
1099883348 12:88496579-88496601 TAGTGGGATATGGGTGAGCATGG + Exonic
1099980727 12:89598884-89598906 AAGTGGGGGATGGGGGAGCTAGG + Intronic
1100188668 12:92165974-92165996 TAGTGGGTGATGGATGTGCAGGG - Intergenic
1100671965 12:96823549-96823571 TAGTGGGAGATGGCTCAGGAAGG + Intronic
1100679064 12:96899035-96899057 TGGGGAGTGATGGTGGAGGAAGG - Intergenic
1100691920 12:97047497-97047519 TAGTGGGTGAAGTGGCAGGGAGG - Intergenic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101940787 12:109097836-109097858 TAGGGGGTGAAGGGGGAGGAAGG + Intronic
1102394355 12:112574540-112574562 GAGGGGGTGATGGAGGAGGGAGG + Intronic
1102532154 12:113554348-113554370 GAGTGGGTGATGGTGGGGGGTGG + Intergenic
1102555005 12:113720947-113720969 GAGTGGGAGAAGGGAGAGGAGGG + Intergenic
1102645478 12:114400924-114400946 GAGTGTGTGAAGGGGGAGGGTGG - Intronic
1102658611 12:114505077-114505099 CATTGAGTGGTGGGGGAGGAAGG + Intergenic
1102793954 12:115672600-115672622 GAGAGGGAGATGGAGGAGGAAGG - Intergenic
1103284956 12:119793074-119793096 TTGTGTGTGGTGGGGGAGGGGGG - Intronic
1103797788 12:123516712-123516734 TGGTGGATGAGGGGGGATGAGGG + Intronic
1103823436 12:123716904-123716926 TAGTGGGTGCTGGGGGGGTGGGG - Intronic
1104413254 12:128577092-128577114 TAGTGGTTGATGGGGGCTGTGGG - Intronic
1104994917 12:132648262-132648284 TACTGAGGGCTGGGGGAGGATGG + Intronic
1105262680 13:18791554-18791576 TAGTGGGAGTTGGGGGTGGGTGG - Intergenic
1105935241 13:25092455-25092477 TGGAGGGTGCAGGGGGAGGAGGG - Intergenic
1106143113 13:27027442-27027464 TAGTGGGAGCTGAGGGAGGGAGG + Intergenic
1106190316 13:27446825-27446847 TAAATGGTGATGGGGGCGGATGG + Intronic
1106210388 13:27637868-27637890 AGGAGGCTGATGGGGGAGGATGG - Intronic
1106342305 13:28842015-28842037 TAGAGGGGAATGGGGGAGAAGGG - Intronic
1106665338 13:31846003-31846025 TAGTGGTTGTTGGGGTGGGAGGG - Intergenic
1107127637 13:36861949-36861971 TAGACGGTGATGGGCAAGGATGG - Intronic
1107417179 13:40211541-40211563 TTGTGGGAGATGGAAGAGGAAGG - Intergenic
1107867306 13:44715376-44715398 AACTGGGTGATGGGGAAGGAGGG - Intergenic
1107898286 13:44987904-44987926 TTGTAGAAGATGGGGGAGGAGGG - Intronic
1107931391 13:45310537-45310559 TAGTGGGTGCTAGGTGGGGAGGG - Intergenic
1108235585 13:48400945-48400967 GAGAAGGTGATGGGGGAGGAGGG - Intronic
1108395240 13:49985233-49985255 TATAAGGTGGTGGGGGAGGAAGG - Intergenic
1109426650 13:62172719-62172741 TAGTGGGGGATGGAGGGGGTGGG + Intergenic
1110619762 13:77582025-77582047 GAGTGGGGGATGGGGGTGAAAGG + Intronic
1110982853 13:81924176-81924198 CTCTGGGTGATGGGGTAGGACGG - Intergenic
1111366178 13:87248909-87248931 TAGAGGCTGAAGTGGGAGGATGG - Intergenic
1111478234 13:88783315-88783337 CAGTGGGTGAAGTGTGAGGAGGG - Intergenic
1111634552 13:90887185-90887207 TACTGGGGAATGGAGGAGGAGGG + Intergenic
1111888162 13:94049294-94049316 CAGTGGGGGGTTGGGGAGGAGGG - Intronic
1112382346 13:98903955-98903977 TACTAGGGGATGGGGGAAGAAGG + Intronic
1112529920 13:100190990-100191012 TGGAGGCTGATGTGGGAGGATGG + Intronic
1112559358 13:100498661-100498683 TAGGGGTTGCTGGGGGAGGTGGG - Intronic
1112560164 13:100505852-100505874 TTGGGGGGGATGGGGGAGGGTGG - Intronic
1112920694 13:104608583-104608605 TTGTGGGTGATGGGGGAAGCAGG - Intergenic
1113315662 13:109176777-109176799 GAGTGGGTGCTGGGGGAGACGGG - Intronic
1113374196 13:109748985-109749007 TAATGGGTGAGTGGGGAGGAAGG + Intergenic
1113742977 13:112724117-112724139 AAGGGGGCGATGGGGGAGAAGGG - Intronic
1113742996 13:112724162-112724184 AAGAGGGCGATGGGGGAGAAGGG - Intronic
1113799252 13:113078029-113078051 TGGTGCGGGAAGGGGGAGGACGG - Intronic
1113966082 13:114154901-114154923 TGGTGGGGGATGGGGGATGCAGG + Intergenic
1113969107 13:114175203-114175225 TTGTGGGGGATGGGGCAGGTGGG - Intergenic
1114255029 14:20994358-20994380 TAGAGGCTGAAGTGGGAGGATGG - Intronic
1114318050 14:21525226-21525248 GAGGGGGTGGTGGAGGAGGAGGG + Exonic
1114424567 14:22611363-22611385 AAGTGGGGGATGGAGGAGGAAGG - Exonic
1114763959 14:25349480-25349502 TCATGGGTGCTGGGGGAGGATGG - Intergenic
1115282517 14:31679151-31679173 TCTTGGGTGATGGGGAAGGGTGG + Intronic
1115409675 14:33060020-33060042 TAGAGGCTGAGGTGGGAGGATGG - Intronic
1115764910 14:36613714-36613736 TGGAGGGTGATGGGTGAGAAAGG + Intergenic
1115788271 14:36850835-36850857 TAGTGAATGATGGGGTTGGACGG - Intronic
1116458363 14:45144306-45144328 TAGTGGGCGAGGGGGGTGGAGGG - Intronic
1116859072 14:49979259-49979281 TGGTGGGTGGTGGGGGATGGTGG - Intergenic
1116896360 14:50319081-50319103 TTGATGGTGATGGGGGAGGGAGG + Intronic
1117000412 14:51365867-51365889 TAGCAAGGGATGGGGGAGGATGG + Intergenic
1117068920 14:52038836-52038858 TGCTGGGTGGTGGGGAAGGACGG + Exonic
1117790073 14:59331292-59331314 GTGGGGGTGGTGGGGGAGGAAGG - Exonic
1117829762 14:59738998-59739020 CAGACGGTGAAGGGGGAGGAAGG + Intronic
1117836981 14:59818018-59818040 GAGTGGGGAATGTGGGAGGAGGG - Intronic
1118172020 14:63396558-63396580 TGGAGTGTGATGGGGGAAGAAGG - Intronic
1118714334 14:68548462-68548484 GAGCGGGTTGTGGGGGAGGACGG + Intronic
1118778989 14:68993704-68993726 GAGTGGGTGGTGGGTGGGGAGGG - Intergenic
1118848324 14:69565182-69565204 TTGTGGGGGCTGGGGGAGGTAGG - Intergenic
1119024640 14:71142923-71142945 TACTGAGTGAAGGGGAAGGAGGG - Intergenic
1119466073 14:74859810-74859832 TAGGGGCTGATGGGGCAGCAGGG - Intronic
1119726052 14:76922396-76922418 GAGTGGAGGATGGTGGAGGATGG + Intergenic
1119871975 14:78025829-78025851 GTGTGTGTGTTGGGGGAGGAGGG + Intergenic
1119900346 14:78254305-78254327 TAGTTGGGTATGGGGGAAGATGG - Intronic
1120017537 14:79490675-79490697 AAGTGGGGGTTGGGGGAGGTGGG + Intronic
1120154397 14:81076623-81076645 AAGTGGGTGATGAGGAAAGAAGG - Intronic
1120303539 14:82738251-82738273 TAGTGGGTCATAGAAGAGGAAGG - Intergenic
1120415837 14:84216960-84216982 TAGTGGGTCTTGGAGGAGGCTGG + Intergenic
1120762515 14:88298403-88298425 CAGTAGGTGATGGATGAGGAGGG - Intronic
1120911680 14:89672624-89672646 CAGTGGGACATGGGGCAGGAGGG - Intergenic
1120929541 14:89834980-89835002 ATGAGGGTGATGGGGGATGATGG - Intronic
1121128583 14:91425392-91425414 TACTGGGATATGGGGGAGGTGGG + Intergenic
1121202191 14:92127584-92127606 TAGTGGTTGTTGGGGGTTGAAGG + Intronic
1121409351 14:93738434-93738456 AAGGGGATGATGAGGGAGGAAGG + Intronic
1121567747 14:94923490-94923512 GAGGGGGGGAGGGGGGAGGAGGG - Intergenic
1121774806 14:96583658-96583680 GAGTGTGTGTTGGGGGAGGGCGG + Intergenic
1122916066 14:104859536-104859558 TGGTGGGTGGTGATGGAGGATGG - Intergenic
1122916141 14:104859846-104859868 TGGTGGGTGGTGATGGAGGATGG - Intergenic
1122916217 14:104860206-104860228 TGGTGGGTGGTGATGGAGGATGG - Intergenic
1122916262 14:104860412-104860434 TGGTGGGTGGTGATGGAGGATGG - Intergenic
1122916297 14:104860568-104860590 TGGTGGGTGATGATGGAGGGTGG - Intergenic
1122916321 14:104860657-104860679 TAGTTGGTGGTGATGGAGGATGG - Intergenic
1123092090 14:105746402-105746424 TAGTGGGAGGTGGGCGAGCAGGG - Intergenic
1123092111 14:105746479-105746501 TAGTGGGAGATGGGCAAGCAGGG - Intergenic
1123207966 14:106731979-106732001 TTGTGGGGGTTGGGGGAGGGGGG - Intergenic
1123449676 15:20351859-20351881 AGGATGGTGATGGGGGAGGAAGG + Intergenic
1123781490 15:23633194-23633216 TAATGGGGTATGGGGAAGGATGG + Intergenic
1124043918 15:26129962-26129984 TAGAGGCTGAGGTGGGAGGATGG + Intergenic
1124616876 15:31248481-31248503 AATTGGGGGCTGGGGGAGGAAGG + Intergenic
1124839550 15:33229079-33229101 AATTGGGTGATGGGGGCAGAAGG - Intergenic
1124888875 15:33713186-33713208 TGGTGGGTGATGGTAGATGATGG + Intronic
1125108506 15:36003007-36003029 TAGTGGAGAATGGGGAAGGAGGG + Intergenic
1125289597 15:38130984-38131006 TACTGGGGGATGGAGGAGGCGGG + Intergenic
1125733181 15:41905772-41905794 GAGAGGGTGAGGTGGGAGGATGG - Intronic
1125908502 15:43415407-43415429 CTGTAGGGGATGGGGGAGGAGGG + Intronic
1126158478 15:45587153-45587175 TGGTGGGAGCTGGGGGAGGACGG - Exonic
1126679985 15:51193109-51193131 CAGTGGGGCTTGGGGGAGGACGG + Intergenic
1126855464 15:52834660-52834682 AAGTGGGTGGAGGAGGAGGAGGG + Intergenic
1126940497 15:53760312-53760334 TAGTGGGGGGTGGGGGAGTCGGG - Intronic
1127007013 15:54582011-54582033 TTGTGGGAGAAAGGGGAGGAAGG + Intronic
1127459352 15:59183815-59183837 TAGTGGGGGAAGGGGAAGGGAGG - Intronic
1127680445 15:61290939-61290961 TAATGTGTGATGGCAGAGGAGGG + Intergenic
1128072674 15:64807378-64807400 GAGTGGGTCATGGGGGAGCACGG - Intergenic
1128303021 15:66579140-66579162 TAGAGGCTGAGGTGGGAGGATGG - Intergenic
1128307024 15:66605391-66605413 GAGTGTCTGATGGGGGAGGAGGG + Intronic
1128350792 15:66887035-66887057 TTCTGGGTGATGGAGGAGGGAGG + Intergenic
1128371421 15:67042366-67042388 TAGGGGTTGATGGGGGAAGAAGG + Intergenic
1128943709 15:71807973-71807995 TAGTGAGTGGTGGAGGAGGCTGG - Intronic
1129108440 15:73324036-73324058 TGGGGGGTGTTGGGGGAGGAGGG - Intronic
1129166263 15:73779857-73779879 GGGTGGGTGATGGGGGTGGCAGG + Intergenic
1129671066 15:77607895-77607917 TTGTGGAAGTTGGGGGAGGAGGG - Intergenic
1129706059 15:77795243-77795265 AAGTGGGAGATGGGGAAGGAGGG - Intronic
1129872507 15:78949665-78949687 TTGTGGGGGGTGGGGGAGGGGGG - Intergenic
1130025603 15:80268167-80268189 AAGTGGGTGATGGAGAAGAACGG + Intergenic
1130619539 15:85447516-85447538 TATTTGGGGGTGGGGGAGGAGGG - Intronic
1130659375 15:85818142-85818164 GTGTGGGTGGTGGGGAAGGAGGG - Intergenic
1131593574 15:93773992-93774014 TAGGTGTGGATGGGGGAGGAGGG - Intergenic
1132075373 15:98815583-98815605 TGGGGGGTGATGAGGGAGGGAGG + Intronic
1132078977 15:98848440-98848462 TAGTGGATGCTTGCGGAGGATGG - Intronic
1132386099 15:101401013-101401035 TAGTTGGTGGTGGGAGAGGGAGG + Intronic
1132444442 15:101899784-101899806 TAGTGGGGGTTGGGAGAGGTGGG - Intergenic
1133051754 16:3120890-3120912 GAGTGGGAGATGGGGCAGGCAGG - Intergenic
1133095794 16:3444217-3444239 TATTGTGTGCTGGGGGAGGAGGG + Intronic
1133204486 16:4225067-4225089 TAGTGGTTGCTGGGGGAGCAGGG + Intronic
1133624989 16:7562729-7562751 CAGTGGGGGAAGGAGGAGGAAGG + Intronic
1134078234 16:11307409-11307431 TAGTGGTTGCTGGGGCAGGAGGG + Intronic
1134140488 16:11714144-11714166 TAGGGGCTGAGGTGGGAGGATGG - Intronic
1134405713 16:13956769-13956791 TTGTGGGGGATGGGGGTGGAGGG + Intergenic
1134479283 16:14603540-14603562 ATGTGGGTGGTGGAGGAGGAAGG - Intronic
1134588932 16:15435872-15435894 TAGTGGTTCATGGGCTAGGATGG + Intronic
1135316560 16:21451256-21451278 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1135369482 16:21883501-21883523 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1135390545 16:22089621-22089643 TAGTGGGTGGTGGCGGGGGGTGG - Intergenic
1135434825 16:22419922-22419944 CAGTGTGGGATGGAGGAGGAGGG - Intronic
1135442331 16:22487626-22487648 TAGTGAGTGAAGAGGAAGGAAGG + Intronic
1135589584 16:23695395-23695417 AAGTGGGTGATGGCGGGGGCAGG + Intronic
1136069578 16:27779655-27779677 AAGTGGCTGAAGGGGGAGAAGGG - Exonic
1136269405 16:29139592-29139614 AAGTGTGTGAAGGGGGAGAAGGG + Intergenic
1136326673 16:29531735-29531757 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1136344370 16:29665417-29665439 TTGTGGGTGCTGGGTGAGGATGG - Exonic
1136441363 16:30271719-30271741 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1136615220 16:31394356-31394378 TAGTGGAGGTTGGGGAAGGAGGG - Intronic
1137063804 16:35815582-35815604 TAGTGTGTGTTGGGGCAGGCAGG - Intergenic
1137450867 16:48572413-48572435 TTCTGGATGATGGGGGAGGGGGG + Intronic
1137598804 16:49742611-49742633 AAGGGGGAGATGGGGGAGCAGGG + Intronic
1137652922 16:50135854-50135876 TAGTGGGGGAGGTGGGAGGTAGG - Intergenic
1137774023 16:51040904-51040926 GAGGGAGGGATGGGGGAGGAAGG + Intergenic
1138678626 16:58669567-58669589 GAGTGGGTTGTGGGGGAAGAGGG + Intronic
1139117663 16:63976246-63976268 GAGTGGGAGATGGGAGTGGAGGG + Intergenic
1139477415 16:67209670-67209692 AAGGGGGTGATGGGCAAGGAAGG - Intronic
1139521432 16:67484687-67484709 TAGAGGCTGAGGTGGGAGGATGG + Intergenic
1139564292 16:67763657-67763679 AAGTGGGTTATGGGGGTGGTAGG - Intronic
1139587987 16:67916613-67916635 TTCTGGGTAATGGAGGAGGAAGG + Intronic
1139887858 16:70224032-70224054 TAGTGAGTGAAGAGGAAGGAAGG - Intergenic
1140003643 16:71052743-71052765 TGGTGGCTGAGGTGGGAGGATGG + Intronic
1140168517 16:72579625-72579647 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1140275976 16:73509343-73509365 TAGGGGGTGGAGGGGGAGAAGGG - Intergenic
1140280200 16:73546818-73546840 TGGGGGGTGAGGGGGGAGGGAGG + Intergenic
1140376179 16:74447019-74447041 AAGGGGGTGATGGGGAAGGGTGG + Intergenic
1140786145 16:78344005-78344027 TGTGGGGTGATGTGGGAGGAAGG - Intronic
1140851009 16:78934602-78934624 TGGTGGGTCATAGGGGAAGAGGG - Intronic
1142072883 16:88100862-88100884 AAGTGTGTGAAGGGGGAGAAGGG + Intronic
1142129247 16:88425283-88425305 CAGGAGGTGATGGAGGAGGAGGG - Intergenic
1142326446 16:89418474-89418496 CAGTGGGTCATGGGAGAGGAAGG - Intronic
1142409010 16:89906972-89906994 GAGTGTGTGGTGGGGAAGGAAGG - Intronic
1142548169 17:720330-720352 TAGTAGGCGATGGGGGAGGATGG + Intronic
1143637488 17:8174481-8174503 TATTTGGGGATGAGGGAGGAAGG - Intronic
1144104162 17:11971244-11971266 TACTAGTTGATGGGAGAGGAGGG - Intergenic
1144115300 17:12083537-12083559 CAGTTGGGGATGGGAGAGGATGG + Intronic
1144143669 17:12376360-12376382 GATGGGGTGAAGGGGGAGGAGGG + Intergenic
1144182964 17:12770091-12770113 TGGTGGGTGGAGGTGGAGGAAGG + Intergenic
1144800005 17:17919635-17919657 AAGTGGGGCATGGGGGAGGAGGG + Intronic
1144938997 17:18923947-18923969 TTGTGGGTGATGTTGGAGGAAGG + Exonic
1145000446 17:19301094-19301116 TGGCAGGTGCTGGGGGAGGATGG + Intronic
1146282611 17:31554784-31554806 CAGTGAGTGGTGGGGGAGGGGGG - Intergenic
1146453301 17:32991371-32991393 TAGTGGGTGCACGGGGATGATGG - Intronic
1146589550 17:34116845-34116867 AAGTGTGTGTGGGGGGAGGAGGG + Intronic
1146755237 17:35425431-35425453 TAGTGGTTACTGGGGGAAGATGG - Intronic
1146953293 17:36921243-36921265 CAGTGGGAGATGGGGAAGGCTGG - Intergenic
1146956768 17:36940548-36940570 AAGCGGGTCCTGGGGGAGGAAGG + Intronic
1146978642 17:37138850-37138872 TGGTGAGTAATGGGGGAGGTGGG + Intronic
1147110162 17:38256503-38256525 TGGAGGGTGTTGGGGGAGGACGG - Intergenic
1147182886 17:38697920-38697942 AAGTGTTTGGTGGGGGAGGAAGG - Intergenic
1147263974 17:39224313-39224335 TACCGGGTGAAGGGGGAGGGAGG + Intronic
1147315922 17:39620188-39620210 TAGTGGGAGATGGGTGGGGATGG + Intergenic
1147761501 17:42800326-42800348 GGGTTGGTGAAGGGGGAGGAAGG + Intronic
1148105121 17:45114840-45114862 TAGAGGGTGATGGGTCAGGCTGG - Intronic
1148419346 17:47531916-47531938 TGGAGGGTGTTGGGGGAGGACGG + Intronic
1148440766 17:47710656-47710678 TTGGGGGTGATAGGAGAGGACGG - Exonic
1148812113 17:50300021-50300043 TACTGGGTGAGGGTGGAGGGAGG - Intergenic
1148859227 17:50595453-50595475 GGGTGGGAGATGGGGGAGTATGG - Intronic
1148868413 17:50641281-50641303 GTGTGGGTGATGGTGGGGGAGGG + Intronic
1149013509 17:51882454-51882476 GTATGGGTGTTGGGGGAGGATGG + Intronic
1149176305 17:53876082-53876104 TAGGGGGTGCAGGGGGAGGAAGG - Intergenic
1149521075 17:57318641-57318663 TTGTGGGGGGTGGGGGCGGAGGG + Intronic
1149673942 17:58441938-58441960 GTGTGAGTGAGGGGGGAGGATGG + Intronic
1149893684 17:60412395-60412417 TAGTGGGGAATGGGGGCGGTGGG + Intronic
1150700758 17:67444929-67444951 TAGTGTGCGCTGTGGGAGGAGGG + Intronic
1151091343 17:71443611-71443633 TATTGGGTGTTGGGGGAGCAGGG - Intergenic
1151700308 17:75739483-75739505 TAGAGGGGGATGGGGGCAGAGGG - Intronic
1151784823 17:76270389-76270411 TGGAAGGTGGTGGGGGAGGAGGG - Exonic
1152103650 17:78316689-78316711 AGCTGGGAGATGGGGGAGGAGGG - Intergenic
1152733244 17:81983746-81983768 TGGGGGGTGCTGGGGAAGGAGGG + Intronic
1153559473 18:6357457-6357479 TAGGGGATGATGGGGGTGGCTGG - Intronic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1155099848 18:22599845-22599867 TAGTGGGGGTAGGGGGAGTAGGG + Intergenic
1155145978 18:23084076-23084098 TAGTGGGAGGTGGGAGTGGAGGG + Intergenic
1155374600 18:25142075-25142097 TTTGGTGTGATGGGGGAGGAGGG - Intronic
1155385837 18:25276214-25276236 GGGTGGGTGGAGGGGGAGGAAGG - Intronic
1156102174 18:33609668-33609690 TAGTGGGTGAAGTGGGGAGAGGG - Intronic
1156234218 18:35185409-35185431 AAGTGGGGCATGGGGTAGGAAGG + Intergenic
1156575856 18:38314064-38314086 TAGTGGCTGGAGGGGCAGGATGG + Intergenic
1157044189 18:44077961-44077983 TAGTGGGGGCTGGGGGATGTGGG + Intergenic
1157231428 18:45920110-45920132 GAGTGGGTAAGGGGAGAGGAAGG - Intronic
1157255564 18:46135791-46135813 GAGTGAGTGATGTGTGAGGACGG - Intergenic
1157605528 18:48923684-48923706 TAGTGGGGGTTGGGGGTTGAGGG - Intronic
1157750545 18:50174347-50174369 TAGGGGCTGATGGGGGCTGATGG - Intronic
1158728524 18:59997569-59997591 TGTTGGGGGATGGGGGACGAAGG - Intergenic
1158928210 18:62293039-62293061 GAGTGTGTGATGGAGGAGAAAGG - Intronic
1158959739 18:62579665-62579687 TAGTGGGGGAAGGGGAGGGAGGG - Intronic
1159213601 18:65362340-65362362 TTGTGGGGGAGGGGGGAGGGAGG + Intergenic
1159872982 18:73779271-73779293 CAGTCGGGGATGGGGGAGGTCGG + Intergenic
1160464835 18:79068383-79068405 CAGCGGGTGATGGAGGTGGAAGG + Intergenic
1160505057 18:79422451-79422473 GAGTGGGTGACGGGGGTGGTGGG + Intronic
1160622669 18:80181624-80181646 CAGTCGCTGATGAGGGAGGATGG - Intronic
1160640912 19:135031-135053 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
1160695669 19:483247-483269 GGGTGGGTGTTGGGGGGGGATGG - Intergenic
1160705187 19:526252-526274 TTGGAGGTGAAGGGGGAGGAAGG - Intergenic
1160971274 19:1768826-1768848 GAGGTGGTGATGGGGGTGGAAGG + Intronic
1161022239 19:2015786-2015808 TAGGGGGAGGAGGGGGAGGAGGG + Intronic
1161050346 19:2160586-2160608 TACTGGGAGCTGGTGGAGGATGG - Intronic
1161764606 19:6199769-6199791 CGGGGGGAGATGGGGGAGGAAGG - Intergenic
1161783550 19:6309591-6309613 TAGTGGGTGATCTTGGAGAAGGG + Intronic
1161794409 19:6378185-6378207 TGGTGGGAGAAGGGGGAGGGAGG + Intronic
1161934933 19:7365745-7365767 TGGTGCCTGATGGGAGAGGAAGG - Intronic
1162147455 19:8621429-8621451 TGGTGAGTGAGCGGGGAGGAAGG + Intergenic
1162449525 19:10746305-10746327 GAGGGGGTGGTGGGGGAGGAGGG + Intronic
1162955076 19:14092882-14092904 AAGTGGGAGAGGGGGCAGGAGGG + Exonic
1162985778 19:14268690-14268712 AAGGGGGCGTTGGGGGAGGAAGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1164754281 19:30678459-30678481 CAGTGGGCGATGGGGAGGGAGGG - Intronic
1165013219 19:32863664-32863686 TGGTGGCTGGTGGGGGAGTAGGG - Intronic
1165257728 19:34589732-34589754 GTGTGGATGATGGAGGAGGAGGG + Intergenic
1165477850 19:36042056-36042078 GCCTGGGTGATGGAGGAGGAGGG + Intronic
1165763450 19:38336003-38336025 TCGTGGGAGCTGGGAGAGGAGGG + Intronic
1165845088 19:38812932-38812954 GAGTGGGAGATGGTGGCGGATGG + Exonic
1166094274 19:40529828-40529850 TACGGGGTGATGATGGAGGAGGG - Intronic
1166301065 19:41912591-41912613 AAGTGAGTGAGGGGTGAGGACGG - Intronic
1166373645 19:42315533-42315555 TCCTGGGTCCTGGGGGAGGAGGG + Intronic
1167056305 19:47113139-47113161 TAGAGGCTGAGGCGGGAGGAAGG + Intronic
1167404411 19:49295081-49295103 TTGTGTGTGATGGGGTATGATGG - Intronic
1167566634 19:50261308-50261330 GAGGGGGTGATGGGGGAGGGAGG - Intronic
1167566683 19:50261421-50261443 GAGGGGGTGATGGGGGAGTGGGG - Intronic
1167568344 19:50271342-50271364 TGGAGTGTGATGGGGAAGGATGG - Intronic
1167712188 19:51119172-51119194 TAGTGGGGGATGATGGAAGAGGG + Intergenic
1167716142 19:51143867-51143889 GAGTTGGTGATGGTGCAGGAGGG + Intronic
1168258846 19:55181633-55181655 TCCTGGGTGCTGTGGGAGGAGGG - Exonic
1168332278 19:55577783-55577805 GGGCGGGCGATGGGGGAGGAAGG + Exonic
925445537 2:3923855-3923877 GAGTTGGTGGTGGGGGTGGAGGG + Intergenic
925553457 2:5101991-5102013 TAGAAGGAGAAGGGGGAGGAGGG + Intergenic
925885386 2:8390661-8390683 TAGGGTGGGATGGGGTAGGATGG + Intergenic
926123969 2:10260115-10260137 TAGGGGGTGATGGAGGAGCCAGG + Intergenic
926343628 2:11925661-11925683 TAGTGGGTGTTGGGGGAGTGGGG - Intergenic
926783801 2:16500281-16500303 TACAGGATGGTGGGGGAGGATGG - Intergenic
927219154 2:20690689-20690711 TGGCGGGGGATGGGGGAGGAGGG + Intronic
927695527 2:25237079-25237101 TAGTGGCTGCTGGGGGAGGGAGG - Intronic
927855892 2:26527807-26527829 AAGTGTGGGATGGGGCAGGAGGG - Intronic
928018377 2:27680548-27680570 GAGTGAGTGAGGTGGGAGGATGG + Intronic
929055419 2:37872523-37872545 TAGTGGGGGAAGGGTGAGGCTGG + Intergenic
929230641 2:39556496-39556518 AAGAGGGTGAGGTGGGAGGATGG - Intergenic
929968698 2:46554638-46554660 GAGTGGCTGAAGGGAGAGGAAGG + Intronic
930136154 2:47905807-47905829 GAGTGGGAGAGGGGGGAGGAAGG + Intergenic
931757816 2:65389386-65389408 AAGGGTGTGTTGGGGGAGGAAGG + Intronic
931882818 2:66583770-66583792 AAGTAGCAGATGGGGGAGGAAGG + Intergenic
931994608 2:67828028-67828050 AAGTGGGTGATTGGGGTGGAAGG - Intergenic
932335927 2:70931399-70931421 TTATAGGTGATGGGGTAGGAGGG + Intronic
932476443 2:72009307-72009329 TAGTGGCTGGGGTGGGAGGAGGG - Intergenic
932620045 2:73259821-73259843 ATGTGGCTGAAGGGGGAGGAAGG + Intronic
932892805 2:75611299-75611321 TGGTGGGAGATGATGGAGGATGG - Intergenic
932892833 2:75611394-75611416 TGGTGGGAGATGATGGAGGATGG - Intergenic
932892856 2:75611475-75611497 TGGTGGGAGATGATGGAGGATGG - Intergenic
932892883 2:75611570-75611592 TGGTGGGAGATGATGGAGGATGG - Intergenic
933412609 2:81945024-81945046 TATTGGGGGATGGGGGATTAGGG - Intergenic
933483380 2:82885594-82885616 CATTTGGGGATGGGGGAGGAAGG + Intergenic
933836046 2:86246310-86246332 GATTTGGGGATGGGGGAGGATGG + Intronic
934692826 2:96374873-96374895 TAGTGGGTTCTGGGGGTGGGGGG + Intergenic
934723951 2:96602930-96602952 TAGTTGGTGGTGAGGGTGGATGG - Intronic
935693715 2:105752685-105752707 TGAAGGGTGATGGGGTAGGAAGG - Intronic
936487388 2:112937963-112937985 GAGTGGGTGATGGAGGAAGGAGG + Intergenic
936888830 2:117344993-117345015 TAGAGGCTGAGGTGGGAGGATGG + Intergenic
938270422 2:129965366-129965388 TCCTGGATGATGGGGGAGGTGGG + Intergenic
938840298 2:135154870-135154892 TAGAGGGAGATGAGGGAGGCTGG - Intronic
938891725 2:135712366-135712388 AAGTGGCTGAGGTGGGAGGATGG - Intronic
938924229 2:136024571-136024593 TAGAGGCTGAGGCGGGAGGATGG - Intergenic
939501263 2:142987949-142987971 CAGAGGGTGAAGGGGGAGGCAGG - Intronic
939957294 2:148537891-148537913 TAGTGGGGGGTGGGGGGGAAGGG - Intergenic
940154699 2:150643201-150643223 GTGTGTGTGCTGGGGGAGGATGG - Intergenic
940867894 2:158835608-158835630 GAATGGGTGTTGGGGGAGTAGGG + Intronic
941038174 2:160590477-160590499 GGGAGGGTGAAGGGGGAGGAGGG - Intergenic
941091765 2:161184993-161185015 AAGTGGGAGATGGAGAAGGAAGG + Intronic
941199102 2:162487468-162487490 TGGGGGGTGAGTGGGGAGGAGGG + Intronic
941692389 2:168514480-168514502 TAGTGTGTGGTGGGGAAGGTGGG - Intronic
942307321 2:174621499-174621521 GTGTGGGCGATGGGGGTGGAGGG - Intronic
942745226 2:179224621-179224643 TAGTGGGGGTAGGGGGAGGTTGG - Intronic
943161134 2:184252651-184252673 TCGTGGGGCATGGGGGAGGGAGG + Intergenic
943694434 2:190909464-190909486 AAGTGGGGGAGGGGGGAGAAGGG - Intronic
944135899 2:196398873-196398895 GGGAGGGTGATGTGGGAGGATGG + Intronic
944286442 2:197955534-197955556 TGATGGGGGATGGGGGAGTAAGG - Intronic
944365458 2:198913748-198913770 CAGTGGGTGATGGGGAGGAAGGG + Intergenic
944822605 2:203445731-203445753 GCCTGGGTGATGGGAGAGGAAGG + Exonic
944845545 2:203664485-203664507 TGCTGGGGGATGGGGGATGAGGG - Intergenic
944864806 2:203849911-203849933 TGGTGGGTGATGTGGGAGTCTGG - Intergenic
944923329 2:204437798-204437820 GAGTGGGTGGAGGGCGAGGAAGG + Intergenic
945268791 2:207917975-207917997 TAGGGGGTGAGGGGAGAAGAGGG + Intronic
945391336 2:209268837-209268859 GGTTGGGTGATGGGGGAAGAAGG - Intergenic
945505710 2:210637856-210637878 CAGTGGGGGATGGGGGAAAAGGG - Intronic
945882134 2:215336367-215336389 GAGAGGCTGATGTGGGAGGATGG + Intronic
945993177 2:216413143-216413165 TGGTGGGGGAGGGGGGAGGGGGG + Intronic
946015405 2:216600233-216600255 TGGGGAGTGATGGTGGAGGAGGG - Intergenic
946183193 2:217961106-217961128 TATAGGCTGCTGGGGGAGGATGG - Intronic
946563894 2:220941995-220942017 TGGTGGGTGAGGGTAGAGGATGG + Intergenic
946666047 2:222050761-222050783 TATTGGGTGATGGCCAAGGAAGG - Intergenic
946907552 2:224431008-224431030 CAGTGGGTGATGGGGAAGGTGGG - Intergenic
947526181 2:230878102-230878124 CAGGGGGTTCTGGGGGAGGAGGG - Exonic
947643321 2:231719662-231719684 TGGAGGCTGAGGGGGGAGGATGG - Intergenic
948246078 2:236487336-236487358 GAGAAGGTGATGGGGAAGGATGG - Intronic
948458569 2:238118492-238118514 TGGTGGGAGATGGAGGAGGGTGG + Intronic
1169104887 20:2986287-2986309 TAGAGGAAGATGGGAGAGGAAGG - Intronic
1169107379 20:3008459-3008481 TAGTGGTTGCTGGGGGAGGGAGG + Intronic
1169210872 20:3765717-3765739 GAGTGGGAGAAGGGGGAGGCAGG - Intronic
1169217093 20:3800231-3800253 GGGTGGGTGATGGGTGCGGAGGG + Intronic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1170218370 20:13915902-13915924 AGGTGGGTGATGGGGGAGGAAGG + Intronic
1170286708 20:14717856-14717878 TAGTTGGAGCTAGGGGAGGAAGG + Intronic
1170668247 20:18405822-18405844 TGCTGGGGGATGGGGAAGGATGG - Intronic
1171227144 20:23451334-23451356 TGGTGGGTGAGGGTGGATGAGGG - Intronic
1172009647 20:31839012-31839034 GAGTGAGTGAGGGGGAAGGAAGG + Intergenic
1172104916 20:32511080-32511102 TCGTGGGAGGAGGGGGAGGAGGG - Intronic
1173347500 20:42214438-42214460 ATGAGGGTGATGGGGCAGGAGGG - Intronic
1173666394 20:44766335-44766357 CAGAGGGTGAAGGGGGAGCAGGG + Intronic
1173676499 20:44840335-44840357 TAGAGGTTGAGGTGGGAGGATGG - Intergenic
1173793038 20:45840559-45840581 GTGTGGGGGATGGGGAAGGATGG + Intronic
1173907184 20:46637858-46637880 TCCTGGGGGATGGAGGAGGAGGG - Intronic
1174132430 20:48355440-48355462 TGGTGCTTGCTGGGGGAGGAGGG + Intergenic
1174303627 20:49600100-49600122 TTGTGGGGAATGGGGGACGAGGG - Intergenic
1174560564 20:51428034-51428056 TAGTGGGTGAGAGGGAAGGAGGG + Intronic
1174894356 20:54433173-54433195 TGGTAGTTGTTGGGGGAGGAGGG - Intergenic
1175147050 20:56904842-56904864 TGGTGGCTGGTGGGGGTGGAGGG + Intergenic
1175268873 20:57719972-57719994 TAGTGGGAAGTGGGAGAGGAGGG + Intergenic
1175375291 20:58519834-58519856 TGGTGGGGGCTGGGGGATGATGG + Intergenic
1175382164 20:58570849-58570871 TGGTGGGGGGTGGGGGAGGGGGG - Intergenic
1175823577 20:61924666-61924688 GAGTGGGTGGAGGGGGAGCATGG - Intronic
1176113547 20:63421498-63421520 CTGTGGCTGATGGGGCAGGAAGG - Intronic
1176172430 20:63702001-63702023 TAGTGGGTGACGGGGGGGGGGGG - Intronic
1176219453 20:63963159-63963181 CAGTGGGTGCAGGGGAAGGAGGG + Exonic
1177020400 21:15848535-15848557 TATTGGGTAGTGGGGGAGGGGGG + Intronic
1177319146 21:19497630-19497652 GAGTGTGTGCTGGGCGAGGATGG - Intergenic
1177882165 21:26707229-26707251 TAATGGGTCTTGGGGGAGGGAGG - Intergenic
1178084047 21:29094951-29094973 TGGAGGCTGATGTGGGAGGATGG + Intronic
1178351395 21:31874585-31874607 TGGTGGGTGATGAGGGGGCAGGG - Intronic
1178584408 21:33860382-33860404 CAGTGGGGGCTGGGGGAGGCGGG + Intronic
1178789270 21:35683784-35683806 GAGTGGGTGAAGGTGGAAGAGGG - Intronic
1178806700 21:35845463-35845485 TAGGGGGAGGTGGGGGAGAAGGG - Intronic
1179359258 21:40690023-40690045 GCCTGGGTGATGGGGGAGGGAGG + Intronic
1179409417 21:41150921-41150943 GTGTGTGTGATGGGGGAGAATGG + Intergenic
1179489310 21:41729932-41729954 TAGTGGGTGGTGGGAGGCGATGG - Intergenic
1179516767 21:41913935-41913957 AAGTGGGTGAAGGGGGATGTAGG - Intronic
1179961940 21:44772543-44772565 CAGTAGGTGATGGAGTAGGACGG - Intronic
1180024952 21:45155795-45155817 TAATGGGTAATGGGTGATGATGG - Intronic
1180024973 21:45155881-45155903 TAATGGGTGATGAGGGTGGGTGG - Intronic
1180024989 21:45155931-45155953 TGATGGATGATGGGGGATGATGG - Intronic
1180025066 21:45156227-45156249 TGATGGGTGATGGGTGATGATGG - Intronic
1180025078 21:45156275-45156297 TGATGGGTGATGGGTGATGATGG - Intronic
1180025090 21:45156319-45156341 TGATGGGTGATGGGTGATGATGG - Intronic
1180025101 21:45156363-45156385 TGATGGGTGATGGGTGATGATGG - Intronic
1180025141 21:45156519-45156541 TGATGGGTGATGGGTGATGATGG - Intronic
1180049641 21:45325344-45325366 TCGTGGGCGATGGGGGAAGCTGG - Intergenic
1180607360 22:17068800-17068822 CAGTGGGTGAAGGGGGAGAAGGG - Intergenic
1181002626 22:19994913-19994935 TGGGGGGGGATGGTGGAGGATGG + Intronic
1181056402 22:20262392-20262414 GAGTGGGTGATGGGCCAGGCTGG + Intronic
1181065103 22:20301953-20301975 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1181546516 22:23605515-23605537 TAGTGGGAGGAGGAGGAGGAGGG + Intergenic
1182384049 22:29920971-29920993 TAGGGGGTGGTGGGGGTGGCGGG + Intronic
1182658794 22:31910509-31910531 TGGAGGATGATGGAGGAGGAAGG - Intergenic
1183487599 22:38097779-38097801 AAGTAGGAGATGGGGGAGGTGGG + Intronic
1183502463 22:38189036-38189058 TGGTGGGGGATGGTGGGGGATGG + Intronic
1183502479 22:38189076-38189098 TGGTGGGGGATGGTGGGGGATGG + Intronic
1183502484 22:38189086-38189108 TGGTGGGGGATGGTGGGGGATGG + Intronic
1184193731 22:42912353-42912375 TGGTGGGTGATGGGGGCGAGGGG + Intronic
1184248838 22:43249013-43249035 CAGGGGGTGCTGGTGGAGGAAGG + Intronic
1184582467 22:45426750-45426772 TAGGGGCTGAGGGGGAAGGAAGG + Intronic
1184742115 22:46434579-46434601 ATGTGTGTGATGGTGGAGGATGG - Intronic
1184754481 22:46508325-46508347 GTGAGGGTGATGGGGGTGGAGGG + Intronic
949160018 3:870378-870400 AACTGGGGGATGGGGGAGAACGG - Intergenic
949408525 3:3739699-3739721 GTGTGTGTGTTGGGGGAGGAAGG - Intronic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
949863991 3:8532392-8532414 GAGTGGGTGAGGGTGGGGGATGG + Intronic
950018568 3:9770379-9770401 TGGTGGGGGATGGGGGAGTGAGG + Intronic
950106747 3:10393357-10393379 TTTTGGGTGGAGGGGGAGGAAGG + Intronic
950535319 3:13574951-13574973 TAGAGTCTAATGGGGGAGGAGGG - Intronic
950719749 3:14874538-14874560 TAGTGGTTGCCGGGGGTGGAGGG + Intronic
950859718 3:16137363-16137385 CAGTGGGGTATGGGGGGGGAGGG - Intergenic
950944353 3:16929184-16929206 TCGTGGGAGAGAGGGGAGGAGGG + Intronic
950960844 3:17105192-17105214 GAGTGGGTGTTGGGGAAGGTGGG + Intergenic
951088392 3:18542134-18542156 TAGAAAGTGATGGGGGAGGTGGG + Intergenic
951531842 3:23705311-23705333 TAGTAGGTGGTGGAGGAAGATGG + Intergenic
951609339 3:24473948-24473970 TGTTGGGTGTTGGGGGATGAAGG + Intronic
952320537 3:32273670-32273692 TAGTGCGTGCTGGGAGAGGGAGG + Intronic
952621000 3:35342389-35342411 AAGTGGGGGAGGGGGGAAGAAGG + Intergenic
953022318 3:39122651-39122673 TATTGGGTGTTGGGGCAGGAGGG + Intronic
953927188 3:46988492-46988514 GAGTGGGGGACGGGGGAGGGAGG - Intronic
954418580 3:50406450-50406472 TGGTGGGTGATGGGGGTGATAGG - Intronic
954579698 3:51696601-51696623 TAGTGGGGGCTGGGGATGGAAGG - Intronic
954638602 3:52085008-52085030 CAGTGGCTGATGGGGCAAGATGG + Intronic
956732059 3:72205350-72205372 TAGAGGGTTATGGAGAAGGAAGG - Intergenic
957103586 3:75858524-75858546 TAATGGTTGATGGGGGAGGGGGG - Intergenic
957997280 3:87706482-87706504 GAGTGGGAGATGTGGGAAGATGG - Intergenic
958110403 3:89135200-89135222 TAGGAGGTGGTGGGGCAGGAGGG - Intronic
958253592 3:91298889-91298911 GAGTGAGTGATGGGAGAGGGAGG - Intergenic
958668651 3:97174018-97174040 TAGTGGGGGACTGGGGGGGAAGG - Intronic
958843627 3:99239067-99239089 GAGTGGGGGGAGGGGGAGGATGG - Intergenic
959504566 3:107143317-107143339 TACTGGGGGCTAGGGGAGGAAGG + Intergenic
959920846 3:111866538-111866560 TAGTGTGGGATGGGGCAGGATGG + Intronic
960759549 3:121058122-121058144 TGTTGGGTGATGGGGGTGTAGGG - Intronic
961167786 3:124775659-124775681 TAGTGGGTGACTGGAGAGGCAGG + Intronic
961384530 3:126516355-126516377 TGGTGGGTGCTGGGGGACGAGGG - Intronic
961384566 3:126516453-126516475 TGGTGGGTGCTGGGTGATGAGGG - Intronic
961427831 3:126861799-126861821 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961427840 3:126861823-126861845 GAGGTGGTGATGGTGGAGGAAGG - Intronic
961427848 3:126861847-126861869 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961427857 3:126861871-126861893 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961427886 3:126861967-126861989 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961427903 3:126862012-126862034 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961427912 3:126862036-126862058 GAGTTGGTGATGGTGGAGGAGGG - Intronic
961427920 3:126862060-126862082 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961427943 3:126862132-126862154 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961427952 3:126862156-126862178 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961428049 3:126862504-126862526 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961428081 3:126862615-126862637 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961428096 3:126862663-126862685 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961428105 3:126862687-126862709 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961428145 3:126862825-126862847 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961428185 3:126862963-126862985 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961428248 3:126863182-126863204 AAGGTGGTGATGGTGGAGGAGGG - Intronic
961428264 3:126863230-126863252 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961428367 3:126863608-126863630 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961428382 3:126863656-126863678 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961428519 3:126864186-126864208 GAGGTGGTGATGGTGGAGGAGGG - Intronic
961441863 3:126958151-126958173 CAGTTGGGGGTGGGGGAGGAAGG - Intronic
961468526 3:127096761-127096783 CAGGGAGTGATGGGGGAGGCTGG - Intergenic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
962312597 3:134337028-134337050 TTGGTGGGGATGGGGGAGGAGGG + Intergenic
962425620 3:135266786-135266808 TAGTGTATGCTGGAGGAGGAAGG - Intergenic
962951357 3:140222322-140222344 TAGTGAGGGATGGGGGTGGAAGG + Intronic
963076081 3:141347529-141347551 GAGTAGGTGAAGGGTGAGGAAGG - Intronic
964140223 3:153390039-153390061 TAGTGGGTGTAGGGGGAAAAGGG - Intergenic
964313659 3:155420628-155420650 TGGTTGGGGATGGGGGAGGGAGG - Intronic
964406972 3:156359410-156359432 CAATGGGTTATGGGGGAGGATGG - Intronic
964441101 3:156711175-156711197 TTGTGGAAGATGGGGGAGAATGG + Intergenic
964490715 3:157233062-157233084 GAGTGGGTGATGCTGAAGGAAGG + Intergenic
964649244 3:158992387-158992409 TAGTGGGGGGAGGGGGAGAATGG - Intronic
964700506 3:159560676-159560698 TTGAGAGTGATGGGGGAGAATGG - Intronic
964887677 3:161503193-161503215 AAGGGGGAGATGGGGGAGAAGGG + Exonic
965169740 3:165247542-165247564 TAGAAGGTGAAGGGGAAGGAAGG + Intergenic
965500793 3:169454034-169454056 AAATGGGTGATGGAGGAGGGTGG - Intronic
965527617 3:169738201-169738223 TAGTGGGGGCAGGGGGAGGTTGG + Intergenic
965688745 3:171333143-171333165 TAGTTGGTGTTGGGGGTGGGAGG + Intronic
966793525 3:183694164-183694186 CAGTGGCTGATGGTGGATGATGG - Intergenic
966854830 3:184186670-184186692 TAGGGGTTGATGGGGGCGAAGGG + Intronic
966911110 3:184560871-184560893 AAGTAGGTGTTGGGGGAAGAAGG - Intronic
967158826 3:186717850-186717872 TGGTGGGTGATGGTGGTGGGTGG - Intronic
967158857 3:186717940-186717962 TGGTGGGTGATGGTGGTGGGTGG - Intronic
967158878 3:186718000-186718022 TGGTGGGTGATGGTGGTGGGTGG - Intronic
967158933 3:186718162-186718184 TGGTGGGTGATGGTGGTGGGTGG - Intronic
967158955 3:186718225-186718247 TGGTGGGTGATGGTGGTGGGTGG - Intronic
967158972 3:186718269-186718291 TGGTGGGTGATGGTGGTGGGTGG - Intronic
967159025 3:186718411-186718433 TAGTGCGTGATGGTGGTGGGTGG - Intronic
967605196 3:191436675-191436697 TAGTGGGAGATGGGAGGAGAGGG - Intergenic
967925994 3:194648233-194648255 CAGGGGCTGATGGGAGAGGAAGG + Intronic
968571454 4:1344047-1344069 TTTTGGGTGGAGGGGGAGGAGGG + Intergenic
969490130 4:7494889-7494911 AAGTGGGTGATGGAGCAGGAAGG + Intronic
969490733 4:7497961-7497983 AAGCGGGTGATGGAGAAGGAAGG + Intronic
969939979 4:10722367-10722389 TAGCGGGAGATGGGGCTGGAAGG - Intergenic
970510600 4:16777972-16777994 TGGAGAGGGATGGGGGAGGAAGG - Intronic
970693740 4:18649943-18649965 TAGTTGGTGATGGGAAATGAGGG + Intergenic
972497582 4:39648196-39648218 GGGAGGGTGATGTGGGAGGATGG + Intergenic
973227328 4:47801565-47801587 TGCTGGGGGATGGGAGAGGATGG - Intronic
973818848 4:54644646-54644668 TAGTGGGGGAGGTGGGAGGCTGG + Intergenic
975536855 4:75460152-75460174 TCGTGGGGGATGGGGCAGGCTGG - Intergenic
975748713 4:77500629-77500651 TAGTGGGTGATTAGGAAGAAGGG + Intergenic
976050271 4:81003833-81003855 CAATGGGTGATGGAGGAGGGAGG + Intergenic
976114255 4:81710194-81710216 TGGGGGGTGAGGGGGGAGGTGGG - Intronic
976177873 4:82373231-82373253 ACGTGTGTGATGGGGGAGGGGGG + Intronic
976545154 4:86327073-86327095 TGGAGGCTGATGTGGGAGGATGG - Intronic
976686351 4:87819478-87819500 TAGTGGGGGATGGTGGATTATGG + Intergenic
976771132 4:88653635-88653657 TAGTGGGTCAAGGGGGAAGCTGG + Intronic
977227131 4:94405988-94406010 GTGTGTGTGATGGGGGAGGATGG - Intergenic
977231274 4:94453037-94453059 TAGTGGGTGAGAGGGGAGAAAGG - Intronic
977248871 4:94666112-94666134 AAGTGAGTGATGGGGCAGGAAGG - Exonic
977496942 4:97788207-97788229 TAGTGGGTCATAGGGGAAGCGGG - Intronic
977685011 4:99837408-99837430 TAGAGGGTGATGGGGTAAGTAGG + Intronic
978628466 4:110714910-110714932 AAGTGGCTGAGGTGGGAGGATGG + Intergenic
978876535 4:113646465-113646487 GGGTGGGGCATGGGGGAGGAAGG + Intronic
979379068 4:119987038-119987060 TAGTGGGAGGTGGGGGATGGTGG + Intergenic
980513661 4:133825398-133825420 TAGTGGGTCATGAGGGGTGAGGG - Intergenic
980933155 4:139200683-139200705 GTGTGGGTGATGGCGGAGGGCGG - Intergenic
981837988 4:149077835-149077857 GAGTGGGGGTGGGGGGAGGAGGG - Intergenic
981946091 4:150345915-150345937 TATTGGGTGCTGTGGGAGGTGGG - Intronic
982913539 4:161175905-161175927 AAGTGGATGAAGGGGGAGGAGGG + Intergenic
983217182 4:165012931-165012953 TAGTGGTTGACGGGGTTGGAGGG + Intergenic
985749706 5:1667283-1667305 GAGGGGGGGAGGGGGGAGGAGGG - Intergenic
986464807 5:8010676-8010698 TAGTGGTTCATTGGAGAGGAAGG - Intergenic
986490337 5:8282737-8282759 TATTGGGGGATGGGGGGTGAGGG - Intergenic
986541773 5:8851968-8851990 TAGTGAGTGTGGTGGGAGGATGG - Intergenic
986835434 5:11631833-11631855 AAGTGGGCGATGGGGCTGGATGG - Intronic
987373469 5:17214140-17214162 TGGTGGGTGATGTGGGAGGTGGG + Intronic
987416871 5:17671131-17671153 TGGGGGGTGGTGGGGGAGGGAGG - Intergenic
987614231 5:20251638-20251660 TGGTGGGGGATGAGGCAGGAGGG + Intronic
987826864 5:23042430-23042452 TAGGGGATGGTGTGGGAGGAGGG - Intergenic
988294141 5:29333020-29333042 CAGAGGGTGGAGGGGGAGGAAGG - Intergenic
990754778 5:59056595-59056617 TGGTGGGGGTTGGGGGAGCAAGG - Intronic
991082484 5:62616050-62616072 GAGGGGGAGGTGGGGGAGGAAGG + Intronic
991469052 5:66948093-66948115 GAGTGGGTGATGAAGGAGGCTGG + Intronic
991927502 5:71719516-71719538 GAGTGGGGGTGGGGGGAGGAGGG - Intronic
992079637 5:73222921-73222943 TGGTGGGTCAGGGAGGAGGAGGG + Intergenic
992081026 5:73234319-73234341 TGGGCGGTGATGGGGGAGGAGGG - Intergenic
992738019 5:79743241-79743263 TATGGGGTGATAGGGGAGCATGG - Intronic
993195780 5:84743609-84743631 TAGTGGGGGCTGGGGAGGGAAGG - Intergenic
993308601 5:86299796-86299818 AAGTGAGGGATGGGGGAGGGGGG - Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994888032 5:105591757-105591779 TTGTCCGTGCTGGGGGAGGATGG + Intergenic
994974895 5:106790338-106790360 TAGTCAGTGATGGGGTAGGATGG + Intergenic
995262224 5:110117764-110117786 TAGTGGGGGCTTGGGGAGGTAGG - Intergenic
995729522 5:115223148-115223170 TGGTGGGGGATGGGGGCGGTAGG + Intronic
997445278 5:133935727-133935749 CAGTGGGGGTTTGGGGAGGAGGG - Intergenic
997476744 5:134146875-134146897 CAGTGGGGGATGGGGGAGATGGG - Exonic
997500698 5:134371377-134371399 GTGTGAGTGCTGGGGGAGGAGGG - Exonic
997584788 5:135037870-135037892 TACTGGGTAAGTGGGGAGGAGGG + Intronic
997932479 5:138083895-138083917 CAGTGGGGGATCTGGGAGGAGGG - Intronic
998034019 5:138898146-138898168 TGGGGGGGGGTGGGGGAGGAAGG - Intronic
998036720 5:138923627-138923649 TAGAGGCTGAGGCGGGAGGATGG - Intronic
998131938 5:139655742-139655764 TGGTGGGGGAGGGGGCAGGAAGG - Intronic
998887008 5:146705445-146705467 GGGTGGGTGGTGGGGGAGGTAGG + Intronic
999007211 5:147996282-147996304 GAGTGGTTGAGTGGGGAGGAGGG + Intergenic
1000360724 5:160444223-160444245 CAGAGAGTGATGGGAGAGGAAGG + Intergenic
1001519974 5:172384522-172384544 TGGTGGTTGCTGGGGGAGGGTGG - Intronic
1001827801 5:174760081-174760103 TATTGGGTGATGGTGGCAGAGGG + Intergenic
1002345457 5:178545169-178545191 TAGTTCCTGATGGGGGAGGCGGG + Intronic
1002437231 5:179238968-179238990 TGGAAGGTGGTGGGGGAGGAAGG + Intronic
1002712176 5:181201978-181202000 AAGTGAGTGATGAGGTAGGAAGG + Intronic
1002736438 5:181391390-181391412 TAGTGGGGGTTGGGAGAGGTGGG - Intergenic
1002748259 6:83434-83456 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
1003122437 6:3329158-3329180 TTGTGGGGGATGAGGGAGGTGGG - Intronic
1003421092 6:5959193-5959215 CAGTGGGTGGCGGGGGAGGGGGG + Intergenic
1003683305 6:8277043-8277065 TAGTGGGGGATGTGGGAGGCAGG - Intergenic
1004110202 6:12710299-12710321 TAGTTGGTGGTAGGGGAGGAAGG - Intergenic
1004112418 6:12732071-12732093 TCCTGGGAGGTGGGGGAGGAGGG + Intronic
1005036022 6:21555556-21555578 AAGTGGGTGAAAGGGAAGGATGG + Intergenic
1005989222 6:30892920-30892942 CAGTGGGGGCTGGGGGAGCAGGG - Intronic
1006059066 6:31405696-31405718 TAGTGGGGAGTGGGGGAGCAGGG - Intronic
1006242379 6:32695576-32695598 TAGTGGGGGATCAGGGAGGGAGG + Intergenic
1006442204 6:34059685-34059707 GAGTGGGTGATGGAGGGAGATGG + Intronic
1006642981 6:35497915-35497937 GGGTAGGTGATGGGGGACGAGGG - Exonic
1006807537 6:36798296-36798318 AATTGGGCGATGGGGGAGGTGGG - Intronic
1006943094 6:37765852-37765874 TCCTGGGGGATGGTGGAGGAAGG + Intergenic
1007049850 6:38816229-38816251 TGGTGGGGGATGGGGGTGAAGGG - Intronic
1007326610 6:41066229-41066251 TAGAGGTTGAGGCGGGAGGATGG - Exonic
1007395497 6:41575541-41575563 TAGGGGGTGTAGGGGGAGGAAGG + Intronic
1007447029 6:41914753-41914775 GTGTGGATGATGGGGGATGATGG - Intronic
1007615208 6:43175808-43175830 TAGTTGGTGATGGGAAAGGAGGG - Exonic
1007625260 6:43243073-43243095 TGGTGGGTGATGGGGACGTATGG + Intergenic
1007928460 6:45668987-45669009 CTGTGGCTGATGGGGGATGAGGG - Intergenic
1008020083 6:46566397-46566419 TAGAAGGTGAAGGGGAAGGAAGG + Intronic
1008174242 6:48247092-48247114 TAGTGGGAGGTGGGGGGAGAAGG + Intergenic
1008380871 6:50838602-50838624 TAGGGGAAGATTGGGGAGGAGGG + Intronic
1008409225 6:51153841-51153863 AAGTGGGTGATGGGGAAGCTTGG + Intergenic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008868909 6:56248245-56248267 TTGTGTGTGTTGGGGTAGGAGGG - Intronic
1008964053 6:57296601-57296623 TAGTGGGTGGTGGTGGTGGTAGG + Intergenic
1009190879 6:60628139-60628161 GAGTGAGTGATGGGAGAGGGAGG + Intergenic
1010896945 6:81376493-81376515 TTTTGGGTGGTGGGGGATGAGGG + Intergenic
1011412103 6:87076455-87076477 TAGAGAGTAATGGGGTAGGATGG - Intergenic
1011499165 6:87968934-87968956 GAGAGGGAGATCGGGGAGGAGGG - Intergenic
1012006271 6:93716593-93716615 AAGGTGGTGATGGGGGATGATGG + Intergenic
1012262411 6:97102979-97103001 TGGTGGAGGGTGGGGGAGGAGGG - Intronic
1012985303 6:105868999-105869021 TAATGGGTGTTGGAGGAGGTGGG + Intergenic
1013032832 6:106352357-106352379 GAGAGGGTGTTGGGGGAGAAAGG - Intergenic
1013112075 6:107072126-107072148 TGGTGGGTGTCGGGGGAGCAGGG + Intronic
1013206166 6:107947848-107947870 TGGTGGGTGGAGGGGGAGGTTGG - Intronic
1013253045 6:108354044-108354066 TGGTGGGAGATGGGGAAGCAGGG + Intronic
1013257030 6:108397598-108397620 TAGTGGGGGATGGGGGAAGGTGG - Intronic
1014783788 6:125594674-125594696 TAGACTGGGATGGGGGAGGATGG + Intergenic
1016252029 6:142055011-142055033 CAGGGTGTGATGGGGGAGGGGGG + Intergenic
1016440930 6:144082621-144082643 AAGTGGGTGTGGGGGGAGGGGGG + Intergenic
1016977831 6:149826286-149826308 CAAAGGGTGATGGAGGAGGAGGG - Exonic
1017236175 6:152119589-152119611 AAGTGAGTGCTGGGTGAGGAAGG - Intronic
1017453323 6:154575007-154575029 GAGTGGTTGGTGGGGGAAGAAGG + Intergenic
1017637303 6:156456075-156456097 GAGTGGAGGAGGGGGGAGGAGGG - Intergenic
1017689420 6:156948409-156948431 CAGTGGGTGGTGGGGGTGGAGGG + Intronic
1017751061 6:157490986-157491008 TAGGGAGGGAAGGGGGAGGAGGG + Intronic
1017824204 6:158069747-158069769 CAGAAGGGGATGGGGGAGGAGGG - Intronic
1017944382 6:159081876-159081898 TGGAGGGGGATGGGGGATGAGGG - Intergenic
1017956896 6:159186205-159186227 TGGCGGGTGGTGGGGAAGGAGGG + Intronic
1018001238 6:159580501-159580523 CAGAGGGCGATGGGTGAGGAGGG + Intergenic
1018699564 6:166415992-166416014 GTGGGGGTGATGGAGGAGGATGG - Intronic
1018871964 6:167790376-167790398 TGGTGGGGGGTAGGGGAGGATGG - Intronic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019241536 6:170666919-170666941 TAGTGGGGGTTGGGAGAGGTGGG - Intergenic
1019500511 7:1362297-1362319 AAGTGGGGGAAGGGGGAGGTGGG - Intergenic
1019521165 7:1461099-1461121 TAGTGGGGGATGGGGGACACAGG + Intergenic
1019579215 7:1751714-1751736 GACTGGGTGATGGGGGAGGCTGG + Intergenic
1019705690 7:2496161-2496183 TTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1019901385 7:4023232-4023254 TAATGGGGGATGGTGGATGAAGG - Intronic
1019936722 7:4262795-4262817 TAGGGGGTGATGAGGTAGAAGGG - Intronic
1019936781 7:4262935-4262957 TGGTGGGTGATGAGGTAGAAGGG - Intronic
1020187524 7:5970494-5970516 ACGTGCGTGATGGGCGAGGAGGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020295394 7:6754276-6754298 ACGTGCGTGATGGGCGAGGAGGG + Intronic
1021609478 7:22443775-22443797 TCTTAGGTGATGGGGCAGGAGGG - Intronic
1022087164 7:27079735-27079757 TAGTGAGGGATGGGAGGGGAAGG - Intergenic
1022228379 7:28387630-28387652 CAGAGGGTGGAGGGGGAGGAGGG + Intronic
1022602943 7:31778867-31778889 TACTGAGTGTTGTGGGAGGAGGG + Intronic
1022973714 7:35538636-35538658 TACAGGGTGCTGTGGGAGGAAGG - Intergenic
1023114417 7:36847611-36847633 TAGTGGGGGGTGGGGGACTAGGG + Intergenic
1023527818 7:41123306-41123328 AAGTGGGTCATGTGGGATGAAGG - Intergenic
1023562548 7:41491072-41491094 TAGAGAGTGCTGGGGGAAGAAGG - Intergenic
1023850180 7:44146018-44146040 TTGTGAGTGATGTGAGAGGATGG + Intronic
1024254206 7:47527801-47527823 GAGTGGCTGAGGTGGGAGGATGG + Intronic
1024258727 7:47558572-47558594 AAGTAGGTGATGGGAGAGGTGGG - Intronic
1024272587 7:47653938-47653960 CAGCGGGTGATGGGAGAGGGAGG - Intergenic
1025609611 7:63066863-63066885 TAGTGAGGGATGGGGGAGGAAGG + Intergenic
1026029822 7:66781510-66781532 TATTGGGTGGTGGGGGACAAGGG - Intronic
1026105748 7:67419372-67419394 GGGTGGGTGGTGGGGGAGGCTGG + Intergenic
1026185790 7:68081873-68081895 GAGAAGGTGGTGGGGGAGGAAGG + Intergenic
1027113220 7:75457379-75457401 TTGTGGGGGTTGGGGGATGAAGG - Intronic
1027250561 7:76396152-76396174 GAGTGGGGAATGGGGCAGGAGGG + Intronic
1027269770 7:76513054-76513076 TGGGAGGTGGTGGGGGAGGAGGG - Intronic
1027285470 7:76641974-76641996 TTGTGGGGGTTGGGGGATGAAGG - Intergenic
1027320481 7:77006949-77006971 TGGGAGGTGGTGGGGGAGGAGGG - Intergenic
1027529481 7:79312887-79312909 CGGTGGGTGGAGGGGGAGGAGGG - Intronic
1028420325 7:90625697-90625719 TGCTGGGGGATGGGTGAGGAGGG - Intronic
1028593943 7:92528394-92528416 TGGCGGGTGCTGGGGGAGGCGGG - Exonic
1029181506 7:98705283-98705305 TAGTAGGGGTTGGGGGAGGCGGG - Intergenic
1029457008 7:100676397-100676419 TGGTGGGGGAAGGGGGAGGGAGG + Intronic
1029596929 7:101542875-101542897 TCTTGGGGGATGGAGGAGGAGGG + Intronic
1030014619 7:105206205-105206227 GTGTGTGTGCTGGGGGAGGAGGG + Intronic
1030809283 7:113955542-113955564 TGGTGGTTGGTGGGGGTGGAAGG + Intronic
1030872511 7:114774577-114774599 TAGTGGGGGTTGGGGAAGGGAGG + Intergenic
1031493334 7:122416728-122416750 GAGGGGGTTGTGGGGGAGGAAGG + Intronic
1031560891 7:123236759-123236781 TAGGGAGAGGTGGGGGAGGAAGG - Intergenic
1032083696 7:128872823-128872845 GATCTGGTGATGGGGGAGGAGGG - Intronic
1032093799 7:128927375-128927397 TGGTGGGTGGTGGGGGGGTATGG + Intergenic
1032370200 7:131341648-131341670 TGGGGTGTGATGGGGGAGGATGG + Intronic
1033327369 7:140390704-140390726 TATTGGGGGATGGAGGAGAAGGG - Intronic
1033343483 7:140509800-140509822 TCGAGGGTGAGGTGGGAGGATGG - Intergenic
1033908409 7:146235255-146235277 TGGTGGGTTTTGGGGGAGGGTGG + Intronic
1034308625 7:150067786-150067808 AAGGGGGTGGTGGGGGGGGATGG + Intergenic
1034617799 7:152435004-152435026 TGCTGGGTGTTGGGGGAGGGGGG + Intronic
1034865133 7:154635269-154635291 AAGTGGGTGGTGGGGGTGGGTGG - Intronic
1035245655 7:157560717-157560739 AATTGGGTGAGGTGGGAGGAGGG - Intronic
1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035506580 8:141177-141199 TAGTGGGGGTTGGGAGAGGTGGG + Intergenic
1035855674 8:2973846-2973868 TAGAGGATGATGGTAGAGGATGG + Intronic
1035855681 8:2973885-2973907 TAGAGGATGATGGTAGAGGATGG + Intronic
1035855694 8:2973950-2973972 TAGAGGATGATGGTAGAGGATGG + Intronic
1035855706 8:2974015-2974037 TAGAGGATGATGGTAGAGGATGG + Intronic
1036004606 8:4647561-4647583 TATTGGGGGGTGGGGGATGAGGG - Intronic
1036258959 8:7225817-7225839 AGGTGGGGGAGGGGGGAGGATGG - Intergenic
1036311012 8:7684413-7684435 AGGTGGGGGAGGGGGGAGGATGG - Intergenic
1036598927 8:10240940-10240962 TGGTGGGTGCTGGGGGAGTCTGG + Intronic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1036784808 8:11679308-11679330 GACTCGGGGATGGGGGAGGAAGG + Intronic
1037139178 8:15499079-15499101 TAGTGGGTGATGGAGTCTGATGG - Intronic
1037464188 8:19143429-19143451 TGGTTGTTGCTGGGGGAGGAAGG + Intergenic
1038491878 8:27977320-27977342 CAGTGGGTGATGGGGGGGCCTGG - Intronic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1039055697 8:33534619-33534641 TAGTGAGAGATGGGGAAGGGAGG - Intergenic
1039132054 8:34276153-34276175 TAGTAGGTTATAGGGGAGGAGGG - Intergenic
1039826031 8:41174693-41174715 TGGAGGTTGATGTGGGAGGAGGG + Intergenic
1040102338 8:43516717-43516739 TGGTGGGTGAGGGTGGAGGATGG + Intergenic
1041098742 8:54375145-54375167 CAATGGATGATGGGGCAGGAGGG - Intergenic
1041680397 8:60583038-60583060 GGGTGGGGGATGGGGGAGGGAGG + Intronic
1041776488 8:61528720-61528742 CTGTGGGTGAAGGGGCAGGAAGG - Intronic
1041944599 8:63427069-63427091 TATTGGGGGTTGGGAGAGGAAGG + Intergenic
1042217157 8:66438326-66438348 TAAAGGGTGAGGGAGGAGGAAGG + Intronic
1042713721 8:71748065-71748087 TGGTTGGTGATTGGGGAGGGTGG - Intergenic
1042739372 8:72026247-72026269 CAGTGGGTGAGGTGAGAGGAAGG - Intronic
1044449911 8:92322599-92322621 TAGAGGTTGGTGGGGGAGGGTGG + Intergenic
1045263364 8:100596851-100596873 AAGAGGGTGATGTGGGGGGAGGG + Intronic
1045305218 8:100951938-100951960 GAGTGGGTGGTGGCGGCGGACGG + Exonic
1045362483 8:101445768-101445790 CAATGGGTGAGGGGGAAGGAGGG + Intergenic
1046000060 8:108409632-108409654 GGGAGGGTGATGGGGTAGGATGG + Intronic
1047157536 8:122337594-122337616 CGGTGGGTGGTGGGGGAAGATGG + Intergenic
1047355184 8:124114214-124114236 TTTTGGGGGGTGGGGGAGGAGGG - Intronic
1047367061 8:124221419-124221441 CAGAGGGTGAATGGGGAGGAGGG - Intergenic
1047431735 8:124798895-124798917 TAGTTGGTGGTGAGGGAGGCGGG - Intergenic
1047451816 8:124972048-124972070 TATTTGGGGATGGGGGTGGAGGG + Intergenic
1047569223 8:126079511-126079533 TGGTGGGTGTCTGGGGAGGAAGG + Intergenic
1048656574 8:136544460-136544482 TAGTTGGAGATGGGGCAGGTAGG - Intergenic
1049268370 8:141681457-141681479 GAGGGGGTGATGGGGGAGGAGGG + Intergenic
1049454842 8:142681594-142681616 GAGTGGCAGATGGAGGAGGATGG - Intronic
1049491466 8:142905482-142905504 TGGTGGGTGCTGGGGATGGAGGG - Intronic
1049520042 8:143083196-143083218 TGTTGGGTGATGGGGAAGGACGG + Intergenic
1050352549 9:4754193-4754215 AAGAGGGTGAAGTGGGAGGATGG + Intergenic
1050687252 9:8185754-8185776 AACTGGAGGATGGGGGAGGAGGG - Intergenic
1051091650 9:13416695-13416717 TGATGGGTGTTGGGGGAGAAGGG - Intergenic
1051387544 9:16525067-16525089 GAGTGGGGGAGGGGGGGGGAAGG + Intronic
1051491565 9:17672631-17672653 TATTGGGTGAAGGGGGTGGGTGG - Intronic
1052394709 9:27924880-27924902 TTGTTGGTGAAGGGAGAGGAGGG - Intergenic
1052962150 9:34308073-34308095 TATTGGCTGAAGTGGGAGGATGG - Intronic
1053056381 9:34995340-34995362 TAGTGGGGGATGTGGGGAGACGG - Intronic
1053316823 9:37059155-37059177 TTGTTGGGGGTGGGGGAGGAGGG - Intergenic
1054374951 9:64442448-64442470 CAGTGGGAGATGGGGGTGGGAGG + Intergenic
1054521791 9:66080060-66080082 CAGTGGGAGATGGGGGTGGGAGG - Intergenic
1055781904 9:79829625-79829647 GAATGGGAGATGGAGGAGGAAGG - Intergenic
1055821337 9:80267960-80267982 TTGCGGGTGATGGGGGGGAAGGG + Intergenic
1056073547 9:83014862-83014884 TAGTGGGTGGAGGGGAAGGGAGG - Intronic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056313343 9:85365224-85365246 TGGTGGGTGGTGGGGGAGCAAGG - Intergenic
1056719143 9:89058441-89058463 TGGAGGATGATGGTGGAGGATGG + Intronic
1056836141 9:89957151-89957173 GAGTGGGTGATGGGGCACCAGGG + Intergenic
1056873026 9:90302817-90302839 GAGTGGGGCATGGTGGAGGAGGG - Intergenic
1057598727 9:96438722-96438744 CAGGGGTTGATGGGGGAGGGTGG + Intergenic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1057745234 9:97745858-97745880 TAGTGGGTGAAGAGGAAAGAGGG - Intergenic
1058198084 9:102003352-102003374 CAGTGTGTGTTGGGGGAGGGTGG - Intergenic
1058202478 9:102061691-102061713 GGGTGGGGGCTGGGGGAGGAGGG - Intergenic
1058744267 9:107974681-107974703 TAGATGGGGTTGGGGGAGGAGGG - Intergenic
1059053274 9:110952384-110952406 TAGAGGGTGAGGGGGAAGGTGGG - Intronic
1059095283 9:111406796-111406818 TAGGAGGTGAGGTGGGAGGATGG + Intronic
1059394352 9:114024728-114024750 TAATGGGGGATGGGGGTGGGGGG - Intronic
1059457077 9:114406463-114406485 CAGAGGGTGATGGGGGCAGAAGG + Exonic
1059479549 9:114578097-114578119 AGGCGGGTGATGGGGGAGTAGGG - Intergenic
1059480562 9:114586262-114586284 TAGTGGGGGATGGAGGCGGTGGG - Intergenic
1059768186 9:117403549-117403571 TGGTGGCTGAGGGCGGAGGAGGG - Intronic
1059865790 9:118512630-118512652 TAGTGGGTGATGGGGGCTGCTGG - Intergenic
1059887892 9:118767526-118767548 TAGTGGGTAATGGAGGTGGGGGG - Intergenic
1059940426 9:119353971-119353993 TAGTGGGTCAAGGGAGAGGGAGG - Intronic
1060446883 9:123697683-123697705 AAGTGGGGGAAGGGGGAGGAAGG - Intronic
1060917094 9:127397838-127397860 GAGTGGGTGGAGGGGGAGGATGG + Intronic
1061623510 9:131826715-131826737 TAGGGAGGGATGGGGGAGGTGGG - Intergenic
1062255785 9:135620006-135620028 AAGAGGGAGATGGGGGAGTAGGG - Intergenic
1062255816 9:135620087-135620109 TAGGGGGAGATGGGGGAGACTGG - Intergenic
1062255823 9:135620105-135620127 TAGGGGGAGAAGGGGGAGTAGGG - Intergenic
1062255836 9:135620138-135620160 TAGAGGGGGAAGGGGGAGAAGGG - Intergenic
1203601728 Un_KI270748v1:16153-16175 TAGTGGGGGTTGGGAGAGGTGGG - Intergenic
1185763938 X:2709094-2709116 CTGAGGGTGATGGAGGAGGATGG + Intronic
1186008457 X:5102240-5102262 TAGGGGGTGGAGGGGGAGGTGGG - Intergenic
1186413231 X:9361793-9361815 CAGAAGGTGAAGGGGGAGGAGGG - Intergenic
1186438520 X:9564800-9564822 GGGTGGGTGTTGCGGGAGGAAGG + Intronic
1186523632 X:10228222-10228244 GAATGGGGGAGGGGGGAGGAGGG - Intronic
1186529220 X:10278513-10278535 TTGTGGGTGGCGGGGGAGAAAGG + Intergenic
1186597803 X:11002818-11002840 GTGTGGATGTTGGGGGAGGAGGG - Intergenic
1187266013 X:17734457-17734479 AAATGGGTGCTGGGGGTGGAGGG + Exonic
1187380216 X:18794794-18794816 TACTGGGAGCTGGGGGAAGAAGG + Intronic
1187504186 X:19865418-19865440 TAGAGGGTGGAGGTGGAGGAGGG + Intronic
1187916968 X:24162860-24162882 TAGTGGTTGCTAGGGGATGAAGG - Intronic
1189532192 X:41896923-41896945 TAGTGGGGGAGGAGGGAGTAGGG - Intronic
1190328057 X:49218774-49218796 TGGTGGGGGTTGGGGGAGGTGGG + Intronic
1190481715 X:50883973-50883995 TGGTGGGAGTTGGGGCAGGAGGG + Intergenic
1190741031 X:53288960-53288982 CAGTTGGTGATGGGGGTGGGGGG - Intronic
1191102052 X:56740971-56740993 TAATGGGTGGTGGGGGAGAGTGG - Intergenic
1191604296 X:63044441-63044463 AAGTGGGAGATGGGGAAGAATGG - Intergenic
1191976503 X:66877762-66877784 GAGTGGGAGAAGGGAGAGGAGGG - Intergenic
1192428537 X:71097357-71097379 GGGTGGGAGGTGGGGGAGGAGGG - Intronic
1192446739 X:71216587-71216609 AGGTGGGTGATGGAGGAGTAAGG + Intronic
1192452989 X:71254743-71254765 TAGTGAGTGACAGCGGAGGACGG + Intronic
1193252750 X:79310981-79311003 TTGTGGGTGGTGGGGGGGTAGGG - Intergenic
1193846142 X:86473503-86473525 TAGTGGGTGATGGGGGAGGAAGG - Intronic
1194598698 X:95892565-95892587 ATGTGTGTGTTGGGGGAGGAAGG + Intergenic
1194846605 X:98817257-98817279 TAGAAGTTGATGGGGAAGGAGGG - Intergenic
1195352827 X:104010850-104010872 CAGTGGGTGATTGAGGAGAAGGG - Intergenic
1195648881 X:107264029-107264051 AAGTGGGTGAGGTGGGAGGTAGG - Intergenic
1195928410 X:110049372-110049394 AGGTGGGGGGTGGGGGAGGATGG + Intronic
1196105136 X:111887204-111887226 TAGTGGGTAATGCCAGAGGAAGG + Intronic
1196919789 X:120574081-120574103 GGGCAGGTGATGGGGGAGGAGGG - Intronic
1197645379 X:129011309-129011331 TGGTGTGTTATGGGGGAGGGAGG + Intergenic
1198170366 X:134099428-134099450 TGGTGGGGGGTGGGGGCGGAAGG - Intergenic
1198287195 X:135202888-135202910 CAGTGGGGGATCGGGGAGAAAGG - Intergenic
1198416660 X:136427029-136427051 TAGTTGCTAATGAGGGAGGAAGG + Intergenic
1199204825 X:145136573-145136595 TATTGTGTGATGGGGGAGTGTGG - Intergenic
1199601510 X:149543967-149543989 GAGTGGGTGGTGGGGGGGGTGGG + Intronic
1199606925 X:149585470-149585492 AAGTGTGTGTTGGGGGTGGAGGG + Intronic
1199632198 X:149783898-149783920 AAGTGTGTGTTGGGGGTGGAGGG - Intronic
1199648867 X:149935517-149935539 GAGTGGGTGGTGGGGGGGGTGGG - Intronic
1200053473 X:153446614-153446636 CAGTGGCTGCTGGGGAAGGAAGG + Intronic
1200374658 X:155767279-155767301 GAATGGGTTATAGGGGAGGATGG - Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201559457 Y:15300734-15300756 AAGTGGCTGAGGTGGGAGGATGG - Intergenic
1201572736 Y:15431905-15431927 TTGTGGGAGTTGGGGGAGGGGGG + Intergenic
1201699496 Y:16864756-16864778 GGGTGGGGGAGGGGGGAGGAGGG + Intergenic