ID: 1193846540

View in Genome Browser
Species Human (GRCh38)
Location X:86479030-86479052
Sequence GTTGGGGAGCAGAAGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1257
Summary {0: 1, 1: 0, 2: 6, 3: 100, 4: 1150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193846540 Original CRISPR GTTGGGGAGCAGAAGGGGGA TGG Intronic
900090255 1:917172-917194 GCTTGGGAGCTGAAGGGGGGTGG + Intergenic
900121498 1:1050334-1050356 GTGGGGCAGGAGCAGGGGGAAGG + Intronic
900141594 1:1141284-1141306 GATGGGGTGAAGAAGGGGTAGGG - Intergenic
900947081 1:5837136-5837158 GGTGGGCAGGAGGAGGGGGAGGG - Intergenic
900961399 1:5923370-5923392 GCTGGGAAACAGAAGAGGGAAGG + Intronic
901038886 1:6352345-6352367 GGTGGGGAGGGGAAGAGGGAGGG - Intronic
901115701 1:6842050-6842072 GTTGGGGGGCAGGAGAGGAAAGG - Intronic
901234682 1:7661563-7661585 GTAGGGGAGGAGGAGGGGAAGGG - Intronic
901452240 1:9342806-9342828 TTTGGAGAACAGAAAGGGGAGGG + Intronic
901630762 1:10647089-10647111 TCTGGGGAGGAGGAGGGGGAGGG + Intronic
901648459 1:10729071-10729093 GTTGGGAGGCAGCTGGGGGAAGG + Intronic
901670018 1:10850553-10850575 GTTGAGGACCACATGGGGGAGGG + Intergenic
901803912 1:11725751-11725773 GTTGGGGAGCGGCAGGGGGAGGG + Exonic
902382863 1:16060775-16060797 GTTGGGGAGAACCAGGTGGAGGG + Intronic
902395384 1:16129643-16129665 GTTAGGGAGCAGCAGGTGCAGGG - Intronic
902531793 1:17095372-17095394 GTGGGGGAGCAGAATGGGAGTGG + Intronic
902764536 1:18605713-18605735 GTAAGGGAGCCGAAGGAGGAAGG - Intergenic
902770435 1:18642724-18642746 GCTGGGGTGGAGCAGGGGGAGGG + Intronic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
902905985 1:19557799-19557821 GAAGGGGAACAGAAGGGGAAGGG - Intergenic
903012601 1:20342318-20342340 GTGGGGGAGCAGAAGGAAGGAGG + Intronic
903035613 1:20490846-20490868 GTTGGAGACCAGCTGGGGGATGG - Intergenic
903333446 1:22609251-22609273 GGTGGGGAGCAGGAGGGGCCGGG + Intergenic
903570996 1:24304812-24304834 GTAGGGGAGGACAAGGAGGAGGG + Intergenic
903832644 1:26183999-26184021 GTTGGGGGGCAACAGGGGTAGGG - Intronic
903931105 1:26863074-26863096 GGTGGGGAGGAGCAGGGGGCGGG - Intergenic
903950045 1:26991436-26991458 GCTGGGGCTCAGTAGGGGGAAGG - Intergenic
903953381 1:27009498-27009520 GTTGGGGAACAGGAAGGTGAGGG + Intronic
904375828 1:30081903-30081925 GTGGGGGAGCAGAGGGAGGGAGG - Intergenic
904424835 1:30416554-30416576 GATGGGGAGCAGGAGGGGACAGG + Intergenic
904789592 1:33009082-33009104 GAAGTGGAGCAGAAGAGGGAGGG + Intronic
904839617 1:33363995-33364017 GTGGGGGAGCAGGTGGGGGAGGG - Intronic
905038228 1:34930546-34930568 GTGGGGAAGCCGCAGGGGGAGGG + Intergenic
905174508 1:36127284-36127306 GGCAGGCAGCAGAAGGGGGAAGG - Intergenic
905310688 1:37046903-37046925 GTGGGGGGTCAGAAGGAGGAGGG + Intergenic
905340415 1:37273941-37273963 GTTGGGGTGAAATAGGGGGAGGG + Intergenic
905393199 1:37651154-37651176 ATTGTGGAGCAGCAGGTGGAAGG - Intergenic
905473766 1:38211674-38211696 GTGGGGGAGGTGATGGGGGATGG - Intergenic
905833785 1:41098748-41098770 GTCGGGGGGAGGAAGGGGGAGGG - Intronic
906159479 1:43637155-43637177 GATGGGGTGCAGAATGGGCAGGG + Intergenic
906191961 1:43904724-43904746 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192324 1:43906042-43906064 GAAGAGGAGCAGGAGGGGGAGGG - Intronic
906825239 1:48972232-48972254 GTAGGGAAGCTGAAGGGAGATGG + Intronic
907099179 1:51812418-51812440 CTTGGGGAGCTGAGGTGGGAGGG + Intronic
907117020 1:51977929-51977951 GTTGGTGAAGAGAAGGGGTATGG - Intronic
907222158 1:52914974-52914996 TTTGAGGAAAAGAAGGGGGAAGG - Intronic
907232252 1:53010627-53010649 GTTGGGTGGGGGAAGGGGGAAGG + Intronic
907354909 1:53864143-53864165 GTTGGTGAGGAGAAGGAGGCAGG - Intronic
907377134 1:54053260-54053282 GGTGGGGCGGAGAAGGGGGCTGG - Exonic
907826473 1:58021896-58021918 GTTCAGAAGCAGAAGGGGGTTGG + Intronic
908354497 1:63317311-63317333 GTTGGGGCGCTGACGCGGGAGGG - Intergenic
908356545 1:63329018-63329040 GTTGGAGGGCAGCAAGGGGAGGG - Intergenic
908748702 1:67399584-67399606 GGTGGGGGGCAGAGGGGAGAAGG - Intergenic
909785323 1:79604750-79604772 GTTGCAGAGCACTAGGGGGAGGG + Intergenic
910062134 1:83106535-83106557 GTTAGGGGGCAGAAGAAGGAGGG + Intergenic
910321867 1:85955264-85955286 GATGGGGAGCCAAAAGGGGATGG - Intronic
910428482 1:87138843-87138865 GTGGGTGAGCAGAAGGGGATGGG + Intronic
910442590 1:87267801-87267823 GTTGGGGAGGGGAAGGTGAATGG - Intergenic
910509513 1:87987973-87987995 GTTTGGGAGCTGAATGGCGAGGG - Intergenic
910846143 1:91606401-91606423 GGTGGGGAGGAGAGGGGCGAGGG - Intergenic
910855323 1:91689145-91689167 GAGGGTGAGAAGAAGGGGGAAGG - Intronic
910891826 1:92026851-92026873 GCTGGGCATCAGAGGGGGGACGG + Intergenic
911078005 1:93898580-93898602 TTTGGGAAGCCGAAGCGGGAGGG - Intronic
911153341 1:94616298-94616320 GTTGGGGAGGGGAAGAAGGAAGG + Intergenic
911495919 1:98630977-98630999 GATGGGGATGAGAAGGGAGAGGG + Intergenic
911569610 1:99507582-99507604 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
912246796 1:107968324-107968346 GCTGGGGAGGACAAGGGAGAGGG + Intergenic
912252868 1:108029373-108029395 GGAGGGGAGAAGAAGAGGGAAGG + Intergenic
912673785 1:111656999-111657021 TTGGGGGCGGAGAAGGGGGATGG - Intronic
912800972 1:112719594-112719616 GGTGGGGAGCAGAGGGGTGGGGG - Intergenic
912862724 1:113229028-113229050 GAAGGGGAGCATCAGGGGGATGG + Intergenic
912875565 1:113355199-113355221 CTTGGGAGGCAGAAGTGGGAGGG - Intergenic
913223401 1:116677636-116677658 GACGGGCAGCAGAAGGAGGAAGG - Intergenic
913322918 1:117601949-117601971 GTAGGGATCCAGAAGGGGGATGG - Intergenic
913539440 1:119804872-119804894 GGTGAGGGGCAGAAAGGGGAGGG - Intronic
914542820 1:148632287-148632309 TTTGGGAGGCAGAAGTGGGAGGG + Intronic
914689147 1:150010401-150010423 GGGCGGGAGCAGACGGGGGACGG + Intronic
914745515 1:150498474-150498496 GTTGGGGTGCAGAGGGGTCAGGG - Intronic
915328454 1:155093419-155093441 GGTGGGGAGCAGAGGGGGCTGGG + Intergenic
915530193 1:156498864-156498886 GTTGGGCAGGAGATGGGGGTGGG - Intronic
915608595 1:156971826-156971848 GGTGAGGAGGAGAAGGGGGAGGG + Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915878797 1:159643419-159643441 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
916076095 1:161200722-161200744 GTGGGAGACCAGAAGGGGCAGGG + Intronic
916332064 1:163628319-163628341 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
917156318 1:172003579-172003601 GTTGGAGAGCAAGAAGGGGAGGG - Intronic
917245142 1:172992660-172992682 GTTGTGGGGCAGCTGGGGGATGG - Intergenic
917467888 1:175299406-175299428 GGTGGGGGGCAGAAGGGTGGGGG - Intergenic
917600210 1:176566261-176566283 TTTGGGGTGCAGGTGGGGGAAGG + Intronic
917903144 1:179563798-179563820 CTTGGGGAGGAAAATGGGGAGGG + Intronic
918389632 1:184045202-184045224 GATGGGGAGGAGAAGAAGGAAGG + Intergenic
918855337 1:189747470-189747492 GTTGGGGAGGGGAGGGGGGAGGG + Intergenic
918952762 1:191160717-191160739 GGAGGGGAGGAGGAGGGGGAGGG + Intergenic
919058041 1:192595347-192595369 GGTAGGGAGCAGGAGGGGTAGGG + Intergenic
919058053 1:192595380-192595402 GGTAGGGAGCAGGAGGGGTAGGG + Intergenic
919805128 1:201376917-201376939 CTTGGGGGGCAGATGGGGAAAGG - Intronic
919927360 1:202199249-202199271 GGTGGGGAAGAGAAGGGTGAAGG + Intronic
919935461 1:202247923-202247945 GCTGGGGAGGAGGAGGGGGCAGG - Intronic
919981851 1:202646821-202646843 GTTGGGGGTCAGGAAGGGGAGGG - Intronic
920073548 1:203320960-203320982 GCTGGGGAGGAGCTGGGGGAGGG - Intergenic
920123680 1:203676825-203676847 GGAGGGGAGGACAAGGGGGAAGG + Intronic
920133739 1:203753200-203753222 GTGGGGGACCAGAACAGGGAAGG - Intergenic
920228846 1:204457073-204457095 GTTGGGAAAAAGAAGAGGGAGGG + Intronic
920609561 1:207423683-207423705 CTTGGGGAGCAGAAGGCGGTCGG - Intergenic
920674357 1:208029083-208029105 AGTGGGCAGCAGAAGGGGCACGG - Intronic
921135598 1:212256583-212256605 GGAGGGGAGCAGAAGGGGCAGGG - Intergenic
921900723 1:220447770-220447792 GTTGGAGATGAGAAGGGTGAGGG + Intergenic
922218462 1:223539727-223539749 GGTGGGGAGAAGACTGGGGAGGG + Intronic
922724400 1:227915706-227915728 GCTGGAGAGGAGGAGGGGGAAGG - Intergenic
922814776 1:228440766-228440788 GTTGGGAGGCAGAGGTGGGAGGG - Intergenic
922934261 1:229411438-229411460 GGTGGGGGGGAGAAGGGAGACGG - Intergenic
922943790 1:229492747-229492769 TTTGGGGACCTGAAGGGGAAGGG + Intronic
922987552 1:229877640-229877662 GTTGGGGTGCACAAGGGAGAGGG + Intergenic
923342091 1:233016357-233016379 GGGGAGGAGGAGAAGGGGGAGGG - Intronic
923640287 1:235751243-235751265 GATGGGGAGCAGAAGGTGACTGG + Exonic
923770801 1:236936163-236936185 ATTGCTGAGCAGGAGGGGGAGGG + Intergenic
923853228 1:237819574-237819596 TTTGGGAGGCTGAAGGGGGATGG + Intronic
923875813 1:238045776-238045798 CTTGGGGAGAAGAGGGGAGAGGG + Intergenic
924315643 1:242792606-242792628 ATTAGGGAGCGGAAGGTGGAAGG - Intergenic
924524622 1:244835347-244835369 GTTGGGGCGGAGCAGGGGGCTGG + Exonic
924858199 1:247895816-247895838 GTTGTAGAGCAGCTGGGGGATGG - Exonic
1062833630 10:622364-622386 GGGGGAGAGAAGAAGGGGGAGGG + Intronic
1063080147 10:2760186-2760208 GTTGGGGAGGAGATGGGGAGGGG + Intergenic
1063352028 10:5364884-5364906 GGTGGGAAGCAGAGGTGGGAGGG + Intergenic
1063439365 10:6059953-6059975 GTTGAGGGGCAGATGGGGTATGG + Intronic
1063968776 10:11367159-11367181 AGTTGGGAGGAGAAGGGGGAGGG - Intergenic
1064020520 10:11805203-11805225 GTCGGGCAGGAAAAGGGGGAAGG - Intergenic
1064982045 10:21174460-21174482 GCTGGGGAAGAGAAGAGGGAGGG - Intergenic
1065047007 10:21753970-21753992 GTGGGAGAGGAGAAGGGGCACGG + Intergenic
1065181567 10:23131343-23131365 GTTGGAGGGCAGAGGGTGGAAGG + Intergenic
1065204486 10:23344163-23344185 GGTGGGGAGGGGAAGGGGGAAGG + Intronic
1065285164 10:24180573-24180595 GTTGGGAAGGAGAAGAGGAAAGG - Intronic
1065696845 10:28388149-28388171 GAAGGGGAGGGGAAGGGGGAAGG + Intergenic
1065959376 10:30722014-30722036 GATGGGCAGCAGGTGGGGGATGG + Intergenic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1066368577 10:34799746-34799768 TTTGGGGAGCCAAAGTGGGAGGG + Intronic
1066440219 10:35431370-35431392 GGAGGGGAGGGGAAGGGGGAGGG - Intronic
1066696901 10:38087298-38087320 GTTGGAAAGCAGATGAGGGAGGG + Intergenic
1066995655 10:42560416-42560438 GTTGGAAAGCAGATGGGGGAGGG - Intergenic
1067164782 10:43856561-43856583 GTTGGGGAGCAGCAGGGACCAGG + Intergenic
1067542900 10:47169044-47169066 GTTGAGGAGAAGGAAGGGGAAGG - Intergenic
1067933860 10:50591334-50591356 GTTCGGGAGCAGGAGGGTGGAGG - Intronic
1067972998 10:50992523-50992545 GTTGGGATGAAGAAGGCGGAGGG + Intronic
1068401534 10:56534125-56534147 GTCAGGGGGCAGAAGGGGCAGGG - Intergenic
1069222642 10:65903569-65903591 GATGGGAACCAGAAGGGTGATGG - Intergenic
1069362607 10:67660318-67660340 GTTGGGGAGAAGCAGGAGGGTGG - Intronic
1069404798 10:68087727-68087749 GGTGGGGAGCAGGGAGGGGAAGG + Intergenic
1069642353 10:69964058-69964080 GTAGGGGAGGACAAGTGGGATGG + Intronic
1069785034 10:70982302-70982324 GTTGGGGAGCAGGATAGGAAGGG - Intergenic
1070077077 10:73146993-73147015 TTTGGGAAGCAGAGGTGGGAGGG + Intronic
1070312540 10:75284140-75284162 GTAAGGGAGCAGAGAGGGGAGGG + Intergenic
1070463226 10:76690951-76690973 CATGGGGAGGAGGAGGGGGAGGG - Intergenic
1070680937 10:78448548-78448570 GTGGGGGAGCAGGAGAGGCAGGG + Intergenic
1070718577 10:78740293-78740315 GCTGGTGAGGAGATGGGGGAGGG + Intergenic
1070769433 10:79073698-79073720 TGGGGGGTGCAGAAGGGGGAAGG + Intronic
1070812590 10:79305838-79305860 CGTGGGGAGCAGCAGGTGGAGGG - Intronic
1071204195 10:83255014-83255036 GTGGGGGAGGGGAGGGGGGAGGG - Intergenic
1071293654 10:84204203-84204225 GTTAGGGAGCAGTAGAGGCAAGG + Intronic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072014044 10:91328301-91328323 GGTGCTAAGCAGAAGGGGGAGGG - Intergenic
1072153239 10:92700169-92700191 AGTGGGGAGCAGAAGAAGGATGG - Intergenic
1072195743 10:93116045-93116067 GAGGGGGAGGAGGAGGGGGAGGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072296365 10:94012707-94012729 GTTGGGGTGCAGGGGAGGGAAGG - Intronic
1072453951 10:95560648-95560670 CTCGGGGAGAAGAAGGGGCACGG + Intronic
1072470232 10:95706843-95706865 GTTGCTGGGCAGAAGGGGGTGGG - Intergenic
1072699873 10:97633114-97633136 GTTAGCGAGCAGAGGGTGGAGGG - Intronic
1072897177 10:99376991-99377013 GTGGGGAGGAAGAAGGGGGAGGG - Intronic
1073015443 10:100395460-100395482 GAAGGGGAGGAGAAAGGGGAAGG - Intergenic
1073220977 10:101873635-101873657 GGTGGGGAGCAGGGTGGGGAGGG - Intronic
1073257117 10:102159912-102159934 GTGGGGGAGCAGAAGGCGGGGGG - Exonic
1073470428 10:103718723-103718745 GGAGGGGAGCAGAAAGGGAAAGG - Intronic
1073491139 10:103854473-103854495 GTTTGGGGGAGGAAGGGGGAGGG + Intronic
1073632016 10:105158663-105158685 GTTGGGGGGCAGAGGCAGGAGGG + Intronic
1073711794 10:106051719-106051741 GTTGGGGAGCATTAGGGAAAAGG - Intergenic
1073816190 10:107209973-107209995 GTGGGGGAGAAGAGGGGAGAGGG + Intergenic
1074712079 10:116185698-116185720 GGTGGGGAGCAGGACAGGGAGGG - Intronic
1075091101 10:119444558-119444580 GCTGGGGACCATAAGGAGGAGGG - Intronic
1075101587 10:119510081-119510103 GTTGGGCAAGAGAAGGCGGATGG - Intronic
1075306103 10:121368764-121368786 GTTGAGGTGCAGAAGTGGGAAGG - Intergenic
1075602212 10:123778043-123778065 GTTGGGGTGGAGAAGGGAGGAGG - Intronic
1076019252 10:127056967-127056989 GATGGGGAGCAGGGGTGGGATGG - Intronic
1076189801 10:128475064-128475086 GGCTGGAAGCAGAAGGGGGACGG - Intergenic
1076278785 10:129227414-129227436 TATGGGTAGCAGAAGGGAGAAGG + Intergenic
1076312540 10:129518562-129518584 GCTGGGGAGGGGGAGGGGGAAGG - Intronic
1076350204 10:129810337-129810359 GGTGGGGAGAAGCAGGGGGAGGG + Intergenic
1076778123 10:132709358-132709380 GTAGGAGAGGAGAATGGGGAGGG + Intronic
1076810846 10:132885651-132885673 GTGGGGGAGCAGCAGGTGGTGGG + Intronic
1076917878 10:133433421-133433443 GATGGGGAGCAGATAGGGGGTGG - Intergenic
1076937876 10:133577498-133577520 GATGGGGAGCAGATAGGGGGTGG - Intergenic
1077103787 11:833260-833282 GTTGGGGAGGCGCAGCGGGAAGG + Intronic
1077105181 11:839116-839138 GGTGGGGAGCAGACGTGGGAAGG + Intronic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077226823 11:1442217-1442239 GCTAGGGAGCAGGAGGGGGCAGG + Intronic
1077236984 11:1486573-1486595 GGTGGGGAGGAGAAGCGGGGCGG + Exonic
1077280433 11:1742538-1742560 CTAGGGGAGCAGCAGGAGGAAGG + Intronic
1077287285 11:1773157-1773179 GTGGGGGAGGGGGAGGGGGAGGG + Intergenic
1077303742 11:1858718-1858740 GTTGGGGAGGGGATGGGGGCTGG - Intronic
1077320389 11:1938371-1938393 GTGGGGGACCAGGAGGGGCATGG + Intronic
1077483832 11:2829933-2829955 GGTGGGGAGGGGGAGGGGGAGGG + Intronic
1077806591 11:5596547-5596569 ATGGGGGAGGGGAAGGGGGAAGG - Intronic
1077841219 11:5976857-5976879 GGTGGGTGGCAGAAGGGTGAGGG - Intergenic
1077945210 11:6889880-6889902 GTGGGGGATCAGAAGGTGGGTGG + Intergenic
1078096382 11:8299788-8299810 GTTGAGGAGGTCAAGGGGGAGGG + Intergenic
1078200105 11:9173595-9173617 TTTGGTAAGCTGAAGGGGGAGGG - Intronic
1078807954 11:14725505-14725527 GAAGGGGAGAAGGAGGGGGAAGG - Intronic
1078987116 11:16607247-16607269 GTTGGGGCGCCGGAGGGGGCAGG - Intronic
1080405155 11:31972048-31972070 GAGGGGGAGCGGGAGGGGGAGGG + Intronic
1080478626 11:32622510-32622532 GGTGGGGGGCAGCAAGGGGAGGG + Intronic
1081015296 11:37870770-37870792 TGTGGGGAGCAGGAGGGAGAGGG - Intergenic
1081124730 11:39308888-39308910 GTGGGGTAGGAGAAGGGGGGAGG - Intergenic
1081651778 11:44828705-44828727 GCTGGGCTACAGAAGGGGGAAGG - Intronic
1082939674 11:58691153-58691175 GTTGGGGAGCAGCTTTGGGAGGG - Intronic
1083254155 11:61486175-61486197 TTTGGGGAGAAGACAGGGGAAGG - Intronic
1083262040 11:61528354-61528376 GGAGGGGAGGGGAAGGGGGAGGG + Intronic
1083421552 11:62556166-62556188 GGTGAGGAGCAGAAAGGGAAGGG - Intronic
1083490133 11:63009707-63009729 TTAGGGGATCAGAAGGGGGAGGG + Intronic
1083613601 11:64015809-64015831 GAGGGGGCGCAGAAGGGGGCAGG + Intronic
1083674743 11:64319057-64319079 GTTTGGGAGGAGAAGGGGGAAGG - Intronic
1083715924 11:64576927-64576949 GTTGGGGAGCAGCACGTGCAAGG - Intergenic
1083846676 11:65338615-65338637 GTTGGAGAGCAGAATGGAGAAGG - Intronic
1083892020 11:65600184-65600206 GTGGGTGGGCAGAAGGGGCAGGG - Intronic
1083935142 11:65866074-65866096 GTTGGGGGACAGACGGGGGCTGG - Exonic
1084061346 11:66677559-66677581 GTTGGGGCGAAGAAGCTGGAGGG - Exonic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084223561 11:67700110-67700132 GTTGGGGAGGAGTAGGTGAAGGG - Intergenic
1084278304 11:68068213-68068235 TGTGTGGTGCAGAAGGGGGAAGG + Intronic
1084362639 11:68678748-68678770 GTTCTGGAGCTGAAGGAGGAGGG - Intergenic
1084557897 11:69885727-69885749 GGGGGAGGGCAGAAGGGGGAGGG + Intergenic
1084709420 11:70834891-70834913 GTTGGAGAGCTGAAAGGGGCTGG + Intronic
1084772842 11:71355437-71355459 GCTGGGGAGAAGGAGGAGGAGGG - Intergenic
1084954193 11:72682915-72682937 GCTGGGGGGCAGAGGGGAGAGGG - Intergenic
1085112240 11:73898200-73898222 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1085193906 11:74654658-74654680 GGTGGGGAGCAGAGGAGAGAAGG - Intronic
1085340081 11:75725695-75725717 GTTGGGGAGCAGCAGAGGCCTGG - Intronic
1085348016 11:75780634-75780656 GGTGGGGAGCTGGAAGGGGAAGG - Intronic
1085409619 11:76283406-76283428 GGAGGGGAGGAGAAGGGGGAAGG + Intergenic
1085502707 11:77038083-77038105 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1085508607 11:77074071-77074093 CTTAGGGAGCAGATGGAGGATGG + Intronic
1085829083 11:79880523-79880545 GTGGGGGTGCAGAATGGGCATGG + Intergenic
1085910723 11:80822280-80822302 GTTGGTGATCTGAAGGAGGACGG + Intergenic
1086473871 11:87148595-87148617 TTTGAGGAGCAAAAGGGGAAAGG - Intronic
1087036237 11:93758820-93758842 GTTCCGGGGCAGAAGGGGGCGGG + Intronic
1088182323 11:107126841-107126863 GCAGGAGATCAGAAGGGGGAAGG - Intergenic
1088274304 11:108068424-108068446 GTTGGGGGGCTGAGGTGGGAGGG - Intronic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1089040893 11:115448652-115448674 GTTGGGGGGTAGGAGGGGGTGGG + Intronic
1089197310 11:116701785-116701807 GTTGGGGAGAAGAAGAGGGGAGG - Intergenic
1089380659 11:118028873-118028895 TTGGGGGAGAAGAAGGAGGAGGG + Intergenic
1089395787 11:118135856-118135878 GTTGGGGAGGAGCAGGGAGTGGG - Exonic
1089499171 11:118922675-118922697 GGGAGGGGGCAGAAGGGGGATGG - Intronic
1089728157 11:120501221-120501243 GTTTGGGAGCTGAAGGAAGAGGG - Intergenic
1090439786 11:126715995-126716017 GTTGGGCAGGAGAAGGGCGGAGG + Intronic
1090549708 11:127806480-127806502 GTTGGGTTGAAGGAGGGGGAGGG - Intergenic
1090664132 11:128903776-128903798 GGAGGGGAGCAGGAGGGAGAGGG + Intronic
1090817948 11:130314943-130314965 GAAGGGGAGGAGAAGGGGGCGGG + Intergenic
1090887588 11:130892902-130892924 GGTGGGGTGGGGAAGGGGGAAGG + Intronic
1091024752 11:132132157-132132179 TTGGGGGAGCAGATGGGGGCGGG - Intronic
1091121309 11:133060212-133060234 GATGGGGAGAAGGAGGTGGAGGG - Intronic
1091493559 12:952938-952960 GGAGGGGAGGGGAAGGGGGAAGG + Intronic
1091498449 12:991677-991699 CTTGGGGAGCGGAGGGGGGGAGG + Intronic
1091635624 12:2194372-2194394 GAGGGGGAGCAGGAAGGGGAAGG - Intronic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1092139259 12:6171613-6171635 GTTGAGGAGGAGGAGGAGGAAGG + Intergenic
1092162798 12:6325173-6325195 CTTGGGGAGGGGGAGGGGGAGGG - Intronic
1092235723 12:6807568-6807590 GATGGGGAGGGGAAGGGGTATGG + Intronic
1092468785 12:8760086-8760108 GTGGGGTAGGGGAAGGGGGAGGG - Intronic
1092658224 12:10710089-10710111 GCTGGGGAGGAGGAGGAGGAAGG - Exonic
1092754662 12:11752348-11752370 GGTGGGGAGCAAAAGGGAGGCGG - Intronic
1092857015 12:12683931-12683953 CTTGGGGAGCTGAAGTGGGCAGG - Intronic
1093203178 12:16214514-16214536 TCTGGGGAGCAGAAGGAGGGTGG + Intronic
1093265438 12:16998508-16998530 GTTGGGGAGCACAAGGGGTCAGG + Intergenic
1094198944 12:27778713-27778735 TTTGGGTAGGAGAAGGGAGAAGG - Intergenic
1094342150 12:29424498-29424520 GTTTGGGAGCATAAGGCGGTAGG + Intronic
1096134058 12:49185119-49185141 GTTGGGGAGGGGATGGAGGAAGG - Exonic
1096193080 12:49632662-49632684 GTTGGGGGGCATAGGGGAGAGGG + Intronic
1096353221 12:50917365-50917387 GTTGGGGGGAAGAAGGGCCAGGG - Intergenic
1096463585 12:51836323-51836345 GTTGAGCAGCTGATGGGGGAGGG - Intergenic
1096583369 12:52602648-52602670 CTGGGGGAGCAGAGGAGGGAAGG - Intergenic
1096653737 12:53075521-53075543 GTAGGAGAGCAGAAGGGACAGGG + Intronic
1096713522 12:53476210-53476232 GGTGGGGAGCAGAAAGGATACGG - Intronic
1096912499 12:54998298-54998320 GAAGGGGAGGAGAAGTGGGATGG - Intergenic
1097194422 12:57235809-57235831 GCTGTGGAGCAGGAGGGGGGAGG + Exonic
1097262675 12:57728264-57728286 GCTGGGGTGCAGAAGGGTGGGGG - Intronic
1097713062 12:62935415-62935437 CTTTGGGAGCAGGAGGGGAAAGG + Intergenic
1097787428 12:63776908-63776930 GTGGGGGAGGAGAGTGGGGATGG + Intergenic
1098685683 12:73417053-73417075 GTTGAGGATGAGAAGGTGGAGGG + Intergenic
1099133207 12:78862784-78862806 GAAGGGGAGGAGAAGGAGGATGG - Intergenic
1099267091 12:80462071-80462093 CTTGGGGAGCACAAGGGGTCAGG + Intronic
1099622767 12:85025527-85025549 GTTGGGGGGGAGGTGGGGGATGG + Intronic
1099959182 12:89380414-89380436 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1100214379 12:92432743-92432765 GTTGGTGGGCAGAAGTTGGAAGG - Intergenic
1100549207 12:95631060-95631082 GTAGGGGAGGAGCAGGGGAAGGG + Intergenic
1100550742 12:95644399-95644421 AAGGGGGAGAAGAAGGGGGAAGG - Intergenic
1100550751 12:95644422-95644444 GGAAGGGAGAAGAAGGGGGAAGG - Intergenic
1101001013 12:100357183-100357205 GGTGGGGAGCAGAGAGAGGAGGG + Exonic
1101067222 12:101034483-101034505 GTTGGGGAGTAGGAGGGTGAGGG + Intronic
1101454468 12:104815899-104815921 GTTGGGTGGCAGGTGGGGGAAGG + Intronic
1101472764 12:105013816-105013838 GATGGGGAGCAGAAGAAGGGTGG - Intronic
1102065475 12:109971564-109971586 TTTGGGAGGCAGAAGGGGGTGGG - Intronic
1102175195 12:110868743-110868765 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1102596945 12:114000137-114000159 GTTGGGAAGCAGAAACAGGAGGG - Intergenic
1102649217 12:114425599-114425621 TTTGGGGAGCATAGGGGGTAGGG + Intergenic
1103105296 12:118219212-118219234 TTTAGGGAGCAAAAGGGAGAGGG - Intronic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103425503 12:120830377-120830399 GGAGGGGGGAAGAAGGGGGAGGG + Intronic
1103425549 12:120830462-120830484 GGAGGGGGGAAGAAGGGGGAGGG + Intronic
1103507911 12:121453942-121453964 CTTGGGGAGCAGACGGAGGTGGG - Intronic
1103734732 12:123052986-123053008 CTTGGGAGGCTGAAGGGGGAGGG - Intronic
1103902481 12:124310566-124310588 GTTGAGGAGCAGGATGGGGTGGG + Intronic
1103925855 12:124423046-124423068 GTGGGGCAGCAGGAGGGGGCTGG + Intronic
1103927904 12:124433929-124433951 GGTGGGGGGCGGGAGGGGGACGG - Intronic
1103948643 12:124540460-124540482 GGTGGAGAGCTGGAGGGGGATGG + Intronic
1103948759 12:124540763-124540785 GGTGGAGAGCTGGAGGGGGATGG + Intronic
1104028828 12:125049527-125049549 GTTGGGGAGCAGAGCGGGTGGGG + Intergenic
1104210756 12:126685977-126685999 TTTGGGATGCAGAAGGGAGAGGG - Intergenic
1104298754 12:127543198-127543220 GCTGGGGAGGAGAAGGGAGAGGG + Intergenic
1104305759 12:127609869-127609891 GTTGCAGAGCATAATGGGGAGGG - Intergenic
1104956743 12:132470454-132470476 GGAGGGGAGGAGAGGGGGGAGGG + Intergenic
1105283187 13:18981777-18981799 GCCAGGGAGCAGAAGGAGGATGG + Intergenic
1105345215 13:19565073-19565095 GTTGGGGAGCGGAGCGGGGAGGG - Intergenic
1105766332 13:23563425-23563447 GTTGGAGAGCAGAAGGCAGCTGG + Intergenic
1106323051 13:28659772-28659794 GGTGGGGAGGAGAAGGAGGGAGG - Intronic
1106675803 13:31956738-31956760 GTTGGGAAGGGCAAGGGGGAGGG - Intergenic
1106679956 13:31999445-31999467 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1107071649 13:36276628-36276650 GTAGTGGAGGACAAGGGGGAGGG + Intronic
1107217186 13:37935082-37935104 GTTGGGGTGCAGGCGGTGGATGG + Intergenic
1107410706 13:40155991-40156013 GTTGGGGAGAAAAAGAAGGAAGG + Intergenic
1107999293 13:45891619-45891641 GTTAGGGAGCAGGAGGTGGCAGG + Intergenic
1108310517 13:49184933-49184955 GTTGCAGAGCATAAGGGGGAGGG + Intronic
1108498455 13:51046870-51046892 GATGGAGAGCAGATCGGGGAAGG + Intergenic
1108884708 13:55165561-55165583 GTTGTGGCGCAGCAGGGGCAGGG - Intergenic
1110255928 13:73433957-73433979 GAGGGGGAGGAGAAGAGGGAGGG + Intergenic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1110653654 13:77972077-77972099 GTTGGGAAGCGGAAGCTGGATGG + Intergenic
1110860695 13:80341810-80341832 CGGGGGGAGAAGAAGGGGGAGGG + Intergenic
1110994582 13:82090599-82090621 GGTGGGGAGGGGAAGGTGGAGGG - Intergenic
1111077735 13:83260623-83260645 GCTGGGGAGGAGAAGGGGAAGGG + Intergenic
1111823881 13:93244597-93244619 TTTGGGGAGCAGTGGGGAGAAGG - Intronic
1113566194 13:111320982-111321004 GTGGGGGAGCAGTTGGGGGGGGG + Intronic
1113575141 13:111390051-111390073 GCAGGGGAGCAGAAGGGCTACGG - Intergenic
1113593931 13:111518266-111518288 GTGAGGGAGCTGGAGGGGGAAGG - Intergenic
1113627975 13:111860408-111860430 GTCTGGGAACAGGAGGGGGAGGG + Intergenic
1113654722 13:112061020-112061042 TCTGGGCAGCAGAAGAGGGAGGG + Intergenic
1113745085 13:112738716-112738738 CTGGGGGAGGAGGAGGGGGACGG - Intronic
1113796591 13:113061869-113061891 GAAGGGGAGGAGGAGGGGGAGGG - Intronic
1113909751 13:113836404-113836426 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1113909758 13:113836422-113836444 GAGGGGGAGGAGAATGGGGAAGG + Intronic
1114149142 14:20015390-20015412 GCTGGGAAGGAGAAGGGTGAGGG + Intergenic
1114288494 14:21268890-21268912 GTGGGGGAGGGGAAGGGGGAAGG - Intronic
1114299723 14:21364358-21364380 GTGGGGGAAGGGAAGGGGGATGG + Intronic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1114517744 14:23310772-23310794 CTTGGGGAGATGAAGGGGGTGGG + Exonic
1114654254 14:24306569-24306591 GTTGGGCAGCTAAAGAGGGAAGG - Exonic
1114664732 14:24370638-24370660 GTAGGGGAGCAGGAGGGTCAAGG + Intronic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1115904746 14:38192593-38192615 GTTGCTGGGCAGGAGGGGGAGGG - Intergenic
1116090067 14:40293733-40293755 ATTGGGAATCAGAAGGGGGATGG + Intergenic
1116501940 14:45634477-45634499 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1116687353 14:48056897-48056919 GTTGGGAGGCAGAAAGGGAATGG - Intergenic
1117069335 14:52042529-52042551 GTAGTGGAGTAGAAGGAGGAGGG - Intronic
1117162308 14:53001555-53001577 GTAGGGGAGAAGTAAGGGGAGGG + Intergenic
1117667848 14:58076088-58076110 GAAGGGGAGGGGAAGGGGGAGGG + Intronic
1118066203 14:62193369-62193391 GCCGGGGAGCAGTGGGGGGAAGG + Intergenic
1118171860 14:63395952-63395974 GAAGAGGAGGAGAAGGGGGAGGG + Intronic
1118730006 14:68659459-68659481 GTTGGGGAGGAGAAGAGGGCGGG + Intronic
1118761019 14:68880167-68880189 GTTGGGGAGTAGGATGGGCAGGG - Intronic
1118986354 14:70759076-70759098 GCTAGGGAGTAGAAGGGGGAAGG + Intronic
1118994112 14:70821854-70821876 GTTGGGGGGCAGAAGGGGAGGGG - Intergenic
1119067392 14:71542610-71542632 GAAGGGGAGGAGGAGGGGGAGGG - Intronic
1119442495 14:74637672-74637694 GATGAGGGGCAGAAGGGAGACGG - Intergenic
1119768693 14:77206630-77206652 GATGGGGAGGAGAGGGTGGAGGG - Intronic
1119901481 14:78264255-78264277 GTTGGGAAGCAGAAGCTAGAAGG - Intronic
1119921097 14:78446784-78446806 GTTGGGGCTCAGAAGGGGAGGGG + Intronic
1120059693 14:79967833-79967855 TTTGGGAAGCAGAGGGGTGAGGG - Intergenic
1120993585 14:90398221-90398243 CTGGGGGAGCAGAAGCGGGTGGG + Intronic
1121052748 14:90830153-90830175 GGTGGGGAGGAGACGGAGGACGG + Intergenic
1121069043 14:90999498-90999520 AATGGGGAGGAGGAGGGGGAGGG + Intronic
1121643130 14:95499724-95499746 GCTGGGGAGAAGAAAGGGGCAGG - Intergenic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121912792 14:97807120-97807142 ATTGGGGAGCAGAGGAGGAAAGG + Intergenic
1122091607 14:99344390-99344412 GATGGCGAGGAGAAGGGAGAAGG + Intergenic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1122508590 14:102248200-102248222 GTTGCAGAGCATTAGGGGGAGGG - Intronic
1122782624 14:104150110-104150132 GAGGGGGACCAGGAGGGGGAGGG - Intronic
1122872067 14:104643376-104643398 GGTGGGTAGCAGGTGGGGGAGGG - Intergenic
1122888229 14:104720068-104720090 GCTGGGGAGGAGCACGGGGAAGG - Intronic
1122983938 14:105203636-105203658 GATGGGGAGCAGGAGGCAGAGGG + Intergenic
1123068062 14:105628097-105628119 GGTGGGGGGCAGAAGGAGTAGGG - Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124216142 15:27808392-27808414 GTTGGGGAGCAGAGGCAGCAAGG + Intronic
1124405270 15:29386045-29386067 GATGGGGAGCAAAACGGGGATGG - Intronic
1125320684 15:38484451-38484473 GTTGGGGAGGTGGTGGGGGAGGG + Exonic
1125463159 15:39925275-39925297 GATGGGGAGCAGGAGGGAGGAGG - Intergenic
1125518700 15:40336733-40336755 GTTGGGGAGGAGGAGGGGCCAGG - Intronic
1125697496 15:41651654-41651676 AATGGGGAGGAGAAGGGGGAAGG - Intronic
1125722869 15:41853483-41853505 GCTGGGGAGCAGGGGAGGGAGGG + Intronic
1126234434 15:46366867-46366889 ATTGGGGAGAAGAAGAGGAAGGG - Intergenic
1126467831 15:48976602-48976624 GTTGGGGAGAAGTAGCGGGTGGG + Intergenic
1126679809 15:51191929-51191951 GTTGGGGGGGAGGTGGGGGAGGG + Intergenic
1127169875 15:56290210-56290232 GTTGGGGGGCAGAGGGGTGCAGG + Intronic
1127225030 15:56919058-56919080 GTTGGGGAGCGGAGTGGGGGCGG + Intronic
1127627891 15:60798197-60798219 GTTGGGGAAATGAAGGGGAAGGG - Intronic
1127657702 15:61071461-61071483 GGTGGGGATAAGAAGGGAGAGGG + Intronic
1127784392 15:62343117-62343139 CTGGGGGAGCACAAGGGAGAAGG + Intergenic
1127887020 15:63210557-63210579 GTTGGGAAGCTGGAGGTGGAAGG - Intronic
1127958067 15:63870561-63870583 GAGGGGGAGCAGGAGGGGGTTGG - Intergenic
1128372116 15:67048092-67048114 GCTGGGGATGAGAAGAGGGAGGG - Intergenic
1128781003 15:70358638-70358660 GTTGTGGAGCAGAGTGGGCAAGG - Intergenic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129206050 15:74037571-74037593 GGTGGGGTGAAGAAGGGGCAAGG - Intronic
1129221706 15:74135101-74135123 GTTGGGGAGTAGTAAGGGGGAGG - Exonic
1129313379 15:74726951-74726973 GTTGGGGAGCACGTCGGGGATGG - Intergenic
1129464377 15:75715773-75715795 GTTGGAGGGCAGAAGGAAGAAGG - Intergenic
1129720868 15:77877239-77877261 GTTGGAGGGCAGAAGGAAGAAGG + Intergenic
1130028893 15:80294379-80294401 GTTAGGGAAAAGAAGGAGGAAGG - Intergenic
1130216356 15:81973903-81973925 GTTGGGGAGCTGGGTGGGGAAGG + Intergenic
1130226059 15:82059034-82059056 GAGGGGGAGGAGAAGGGGGAAGG - Intergenic
1130344634 15:83031627-83031649 GTGGGGCAGCGGGAGGGGGAAGG + Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130767760 15:86889538-86889560 GTTGGGGGCCAGGTGGGGGAAGG - Intronic
1131280615 15:91018348-91018370 GTGGGGGAGTGGAAGGGTGATGG - Intronic
1131398497 15:92105754-92105776 GCTGGGATGCAGAAGGGAGATGG + Intronic
1131416691 15:92266076-92266098 GTTGGGCAGCAGGATGGGAATGG + Intergenic
1131502530 15:92982830-92982852 GATGGGGTAGAGAAGGGGGAAGG + Intronic
1131557746 15:93414248-93414270 ATGGGGGGCCAGAAGGGGGACGG + Intergenic
1132255423 15:100372876-100372898 GTTGGGGGGTGGAAGGTGGAGGG + Intergenic
1132547208 16:538821-538843 GATGGGGAGCAGCAGAGGGCAGG - Intronic
1132697098 16:1206918-1206940 GTGGGGGAGCGGGAGGGGGGTGG - Intronic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1133026597 16:2991379-2991401 ATTGGGGAGCAGAAGTGGTTTGG + Intergenic
1133028173 16:2997620-2997642 GTTGGGGTACAGAAGGGGGCTGG - Intergenic
1133060653 16:3172309-3172331 GTTGGGAAGGAGAAGGGCGCGGG - Intergenic
1133270999 16:4610779-4610801 GGTGGCGAGCAGCAGGGGAAGGG - Intronic
1133338248 16:5020586-5020608 GCTGGGGAGCAGAAGCTGGGTGG - Intergenic
1133464746 16:6018983-6019005 GCTGGCGAGGGGAAGGGGGAGGG + Intergenic
1133563520 16:6971395-6971417 TTTGGGGAGCAGAAAGGGAAGGG + Intronic
1133786963 16:8981462-8981484 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1134017574 16:10899834-10899856 GTTTGGGAGGCCAAGGGGGACGG + Intronic
1134449331 16:14354043-14354065 GGTGGGGGGCAGAGAGGGGAGGG + Intergenic
1134542150 16:15076105-15076127 GTCAGGGAGCAGAAGAGGGCAGG - Intronic
1134547614 16:15122815-15122837 GTTGGGGAGGGGGAGGGGAAGGG + Intronic
1134555266 16:15158773-15158795 GTTGGGCAGGAAAATGGGGATGG - Intergenic
1134597730 16:15509315-15509337 GTTGTGGAGTGGAAGGGGGGTGG + Intronic
1134692042 16:16197515-16197537 GTAGAGGAGAAGAAGGGAGAAGG + Intronic
1134867257 16:17619635-17619657 GATGGGGAAGAGAAGGGAGAAGG + Intergenic
1135049528 16:19181313-19181335 TTTGTGGAGCAGAAGGAGGTTGG - Intronic
1135192886 16:20369111-20369133 TTTGAGGAGGAGAAGGGAGATGG - Intronic
1135312778 16:21418984-21419006 GTTGGGGAGGGGGAGGGGGAGGG + Intronic
1135408802 16:22217812-22217834 TTTGGGGGGCAGTAGGGGAAAGG - Intronic
1135446113 16:22519898-22519920 GTTGGGGAGGGGGAGGGGGAGGG - Intronic
1135596303 16:23745987-23746009 ATTAGTGAGCAGAAGGGAGATGG + Intergenic
1136051885 16:27656787-27656809 GGTGGGGAGGGGAGGGGGGAGGG + Intronic
1136403637 16:30031147-30031169 GGTGGGGAGGGGGAGGGGGAGGG + Exonic
1136774258 16:32863210-32863232 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1136896353 16:33998304-33998326 ATCGGGGAGCAGAAGGAAGAGGG - Intergenic
1137551200 16:49438720-49438742 GTGGGGGAGCAGAACTGAGAGGG + Intergenic
1137556998 16:49477140-49477162 GAGGGTGAGCGGAAGGGGGAGGG + Intergenic
1137666347 16:50251852-50251874 GTGGGGGAGCAGGCCGGGGAAGG - Intronic
1138084277 16:54119531-54119553 GGTTGGGAGCAGAGGAGGGAAGG - Exonic
1138323893 16:56144758-56144780 GTTGGGGAGGCGAAGGAGGAAGG + Intergenic
1138563514 16:57816146-57816168 GCTGGGGAGAGGAAAGGGGAGGG + Intronic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1139589252 16:67924324-67924346 CTTGGGGAGCAGCGGGGAGAGGG + Intronic
1139857142 16:69990130-69990152 GTTGGGGAGGGGGAGGGGAAGGG + Intergenic
1139946273 16:70644708-70644730 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1140201264 16:72896736-72896758 GTTGGGGAGGAGGAGGGAGCTGG - Intronic
1140545677 16:75806358-75806380 GTTGGGAAGCACAAGGGACACGG + Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1141642412 16:85348951-85348973 GTTGGGGAGCGGCAGGGCGGTGG - Intergenic
1141737107 16:85861051-85861073 GTTGGGGAGCAGAGGCTGCAGGG + Intergenic
1142153727 16:88523834-88523856 GGTGGGGAGGGGCAGGGGGAAGG - Intronic
1142251454 16:88993793-88993815 GAGGGAGAGAAGAAGGGGGAGGG - Intergenic
1142265374 16:89061979-89062001 GTGGGGGAGCAGCAGGGGTGAGG - Intergenic
1142341541 16:89526307-89526329 GCTGGGGGGCAGAAAGGAGAGGG - Exonic
1203076682 16_KI270728v1_random:1125329-1125351 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1142572212 17:882412-882434 GTTGGGGCAGAGACGGGGGAGGG - Intronic
1142641480 17:1288352-1288374 GATGGGGAGCCCATGGGGGATGG - Intronic
1142641943 17:1289390-1289412 GTTGAGGAGCCCATGGGGGATGG - Intronic
1142725529 17:1810910-1810932 GTTGGGAGCCAGAAGGGAGATGG - Intronic
1143164202 17:4889837-4889859 GGTGGGGGAGAGAAGGGGGAAGG - Intronic
1143393775 17:6576094-6576116 CTTGGGGAGAAGACTGGGGAAGG + Intergenic
1143401692 17:6649760-6649782 GTTGGGGTGGAGATGGGGGCAGG + Intronic
1143512935 17:7405840-7405862 GAAGGGGAGAAGGAGGGGGAGGG - Intronic
1143855637 17:9846371-9846393 TTTGGGAAGCTGAAGTGGGAGGG + Intronic
1144461851 17:15464660-15464682 GTTTGAAAGCAGAAGGGGAAGGG - Intronic
1144534798 17:16077556-16077578 GGAGGGGAGGAGAGGGGGGAGGG + Intronic
1144675331 17:17158211-17158233 GTGGGGGAGGGGGAGGGGGACGG - Intronic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145014539 17:19387671-19387693 CTGGGGGAGCAGAAGGCTGAGGG + Intergenic
1145015290 17:19392492-19392514 GTTGGAGAGGAGAGGGGGCAGGG + Intergenic
1145103257 17:20094164-20094186 TGTGGGCAGCAGGAGGGGGATGG + Intronic
1145865750 17:28240543-28240565 GTTGGGGAGGTGAACAGGGAGGG - Intergenic
1146229711 17:31096192-31096214 GTTGGGGAGTAAAGGGGAGAAGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146618361 17:34375147-34375169 GTAGGGGAGCAAAACAGGGAAGG + Intergenic
1146663956 17:34684190-34684212 GTTGGGGTGGGGATGGGGGAGGG - Intergenic
1147159620 17:38562562-38562584 GGTGGGAAGTAGAAGGGGAAGGG + Intronic
1147168466 17:38605323-38605345 GGTGAGGAGAAGAAGGGGGATGG - Intronic
1147172435 17:38630215-38630237 GGTGGGGAGAGGGAGGGGGAGGG - Intergenic
1147361565 17:39933947-39933969 GGTGGGAAGAAGGAGGGGGAGGG + Intergenic
1147368812 17:39977222-39977244 GTTGCGGAGCTGGAGGGGTAGGG - Exonic
1147580627 17:41625430-41625452 CTTGGGGTACAGAAGGGTGAGGG - Intergenic
1147746359 17:42697247-42697269 GGTGGGGAGGGGGAGGGGGAGGG - Intronic
1147839589 17:43361801-43361823 GATGGGGAGGGGGAGGGGGAAGG - Intergenic
1147945548 17:44078245-44078267 GTAGAGGAGCAGGAGGGGCAAGG + Exonic
1148682149 17:49480458-49480480 GCTGGGAAGCAGAGGGGAGAAGG + Intergenic
1148759550 17:49992589-49992611 GGTGGGGAGTGGCAGGGGGAGGG - Intronic
1148930303 17:51121848-51121870 GTTGGGGAACAGAGGAGGTAAGG + Intergenic
1149177394 17:53889720-53889742 CTTGGGGAGGAAAAGTGGGAAGG + Intergenic
1149430597 17:56593591-56593613 TTTGGGGGGAAGAAGGGGGAGGG + Intergenic
1149451237 17:56751688-56751710 GTTGGGGAGCATGTGGGGTAGGG - Intergenic
1149553079 17:57554447-57554469 GCTGAGGAGGAGAGGGGGGATGG - Intronic
1149592450 17:57841482-57841504 GCTGGGGTGCAGAAGTGGGAGGG - Intronic
1149607280 17:57933947-57933969 GGTGGTGAGCAGGATGGGGAGGG - Intronic
1150433826 17:65139176-65139198 GCTGGGGAGGAGGAGGAGGATGG - Intronic
1150896986 17:69223049-69223071 GTAGGGGAGGAGAGGGGGTAGGG + Intronic
1152024912 17:77802720-77802742 TCTAGGTAGCAGAAGGGGGAGGG - Intergenic
1152066513 17:78115418-78115440 GATGGGGAGCCCTAGGGGGAGGG + Intronic
1152157561 17:78644820-78644842 CTTGGGGAGAAGACGGGTGATGG - Intergenic
1152238001 17:79148412-79148434 GTTGGGGGGTGGAAGGGGCAGGG + Intronic
1152322021 17:79613018-79613040 CATGGGGAGCTGAAGGGAGACGG - Intergenic
1152353661 17:79796847-79796869 GCTGGGCTGCAGCAGGGGGAGGG + Intronic
1152461942 17:80446161-80446183 CTTGGGGGGCAGCAGGGGCAGGG - Intergenic
1153778680 18:8475955-8475977 GTTGGGGAGCAGGTGGGAGCTGG + Intergenic
1155423797 18:25684864-25684886 GGTGAGGAGCAGAAGGCAGAAGG - Intergenic
1155505186 18:26526248-26526270 TTTGGGGAGCAGCAGGAGGAGGG + Intronic
1155746104 18:29357944-29357966 GTTGGGAGACAGAAGGAGGATGG + Intergenic
1156162345 18:34374433-34374455 GATGGGGAGCAGAGAGGTGAAGG + Intergenic
1156361420 18:36387726-36387748 GTGGAGGAGCAGCAGGGAGATGG - Intronic
1156398196 18:36717945-36717967 GATGATGAGGAGAAGGGGGATGG + Exonic
1156465657 18:37346704-37346726 TTTGGGGAGGAGTAGGTGGAAGG + Intronic
1156912504 18:42426930-42426952 GTAGGGGAACAGAAGAGGGGTGG + Intergenic
1157279744 18:46338528-46338550 GTTGAGGTGGGGAAGGGGGAAGG + Intronic
1157299271 18:46467909-46467931 GTTGGGGAGGGGGAGAGGGAGGG - Intergenic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157370755 18:47109262-47109284 GTTGGGGAGGAAAAGAGTGATGG + Intronic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1157833356 18:50877836-50877858 GTTGGGGGGTAGATGGGGAATGG - Intergenic
1158272390 18:55730571-55730593 GTTGGAGAGGAGAAGGAGGCAGG + Intergenic
1158325271 18:56307037-56307059 GTGGGGGAGCAGCAAGGAGATGG + Intergenic
1158472688 18:57751728-57751750 GTGAGGGAGCAGAAGGTGGCTGG - Intronic
1158685473 18:59610401-59610423 TTTGGGGGGCAGGAGGGGTAAGG - Intronic
1158699559 18:59734024-59734046 GTTGGGGAGTCCAAGGGTGAGGG + Intergenic
1159129987 18:64270495-64270517 GTTTGGGAACAGAAGGTGGGAGG - Intergenic
1159234693 18:65656619-65656641 GTTGGGGCTTAGAAGGGGAAGGG - Intergenic
1159918260 18:74204691-74204713 GGGTGGGAGAAGAAGGGGGATGG + Intergenic
1159918303 18:74204799-74204821 GGGTGGGAGAAGAAGGGGGATGG + Intergenic
1159918312 18:74204826-74204848 GTGTGGGAGAAGGAGGGGGATGG + Intergenic
1159918321 18:74204853-74204875 GTGTGGGAGAAGGAGGGGGATGG + Intergenic
1160017829 18:75157901-75157923 ATTGGGTATGAGAAGGGGGAGGG - Intergenic
1160063421 18:75552064-75552086 GTGGTGGAGGAGAAGGGGGTGGG + Intergenic
1160527102 18:79544483-79544505 GGTGAGGAGCAGAGAGGGGAAGG - Intergenic
1160819711 19:1052344-1052366 CTTGAGGAGGAGGAGGGGGAGGG + Intronic
1160819773 19:1052508-1052530 GAGGGGGAGGAGAAGGGGGGAGG + Intronic
1160819810 19:1052602-1052624 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1160900240 19:1424332-1424354 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
1160965698 19:1746102-1746124 AAGGGGGAGTAGAAGGGGGAAGG + Intergenic
1160975343 19:1790095-1790117 AGTGGGGAGGAGAAGGGGCAGGG - Intronic
1161157835 19:2742624-2742646 GTTCGTGAGCAGTAGGGAGATGG + Intergenic
1161202963 19:3025961-3025983 GCTGGGAAGGAGAAGGGGGTGGG - Intronic
1161262549 19:3345756-3345778 GTTTGGGAGGCCAAGGGGGACGG + Intergenic
1161366955 19:3885602-3885624 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1161403783 19:4080890-4080912 GGTGGGGAGGGGAAGGGGGAGGG + Intergenic
1161403794 19:4080919-4080941 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1161724060 19:5918390-5918412 GGTGGGGAGGGGAGGGGGGAGGG - Intronic
1161821494 19:6533434-6533456 GATGGAGAGGGGAAGGGGGAAGG - Intronic
1162038107 19:7953384-7953406 GAGGGGGAGGAGGAGGGGGAAGG - Intergenic
1162038143 19:7953479-7953501 GAGGGGGAGGAGGAGGGGGAAGG - Intergenic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162053108 19:8046845-8046867 GATGGGGAGGAGAAGGAGGAGGG - Intronic
1162142114 19:8591329-8591351 GTTGGGGACGAGAAGGTGGTGGG + Intronic
1162351090 19:10150196-10150218 GTGGCAGAGCAGAAGTGGGAGGG - Intronic
1162535583 19:11261700-11261722 GCTGGTGGGCAGACGGGGGAGGG - Intronic
1163004561 19:14389259-14389281 GAGGGGGAGGGGAAGGGGGAAGG + Intronic
1163004577 19:14389288-14389310 GAAGGGGAGGGGAAGGGGGAAGG + Intronic
1163171187 19:15532344-15532366 GTGGAGGAGGAGGAGGGGGATGG - Intronic
1163213937 19:15862503-15862525 GAAGGGGAGGGGAAGGGGGAAGG + Intergenic
1163370959 19:16901049-16901071 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1163378498 19:16948933-16948955 GGAGAGGAGCAGAGGGGGGAGGG + Intronic
1163461056 19:17437824-17437846 GTTGGGGACCAGATGAGGGTGGG + Intronic
1163685141 19:18708332-18708354 GTTGGAGAGGAGAACAGGGAAGG + Intronic
1163846934 19:19643302-19643324 GTGAGGGATCAAAAGGGGGAGGG + Intronic
1164143108 19:22492159-22492181 GATGGGGAGCTGTAGTGGGAAGG - Intronic
1164144792 19:22505350-22505372 GGTGGGGAGGAGAAGGGGGCTGG - Intronic
1164407923 19:27971142-27971164 GATGGGGAGCAGTAAGGAGACGG + Intergenic
1164719977 19:30424898-30424920 GGTGGGAAGCAGAAGGTGGCAGG - Intronic
1164754700 19:30681064-30681086 GTTGGGGAATAGAAAGGGGCGGG - Intronic
1165149685 19:33753512-33753534 GATGGTGAGGAGATGGGGGATGG - Intronic
1165149768 19:33753724-33753746 GATGGTGAGGAGACGGGGGATGG - Intronic
1165149875 19:33753998-33754020 GATGGTGAGGAGATGGGGGATGG - Intronic
1165313223 19:35040736-35040758 GCTGGGGAGAAGGAGAGGGAAGG + Intronic
1165378525 19:35461077-35461099 GCTGGGGAGAAGAAGGGGCCTGG + Intergenic
1165793706 19:38506838-38506860 GTAGGGGACCAGCAGGGGGTGGG - Exonic
1165827616 19:38714200-38714222 GTTTGCGAGCAGCAGTGGGAGGG + Intronic
1166043971 19:40218583-40218605 GTTGGGGAGGGTAAGGGGAATGG - Intergenic
1166250360 19:41565270-41565292 AGTGGGGAGGAGAAGGGGGTGGG + Intronic
1166253423 19:41586310-41586332 GGTGGTGAGCAGAGGAGGGAGGG + Intronic
1166257173 19:41614944-41614966 GAAGGGGAGGGGAAGGGGGAGGG + Intronic
1166257951 19:41619531-41619553 GGTGGTGAGCAGAGGAGGGAGGG - Intronic
1166283735 19:41811014-41811036 GGTGGCGAGCAGAGGAGGGAGGG + Intronic
1166543745 19:43622413-43622435 GGTGGGGAGGGGAATGGGGAGGG - Exonic
1166671179 19:44710405-44710427 GCAGGGGAGCAGAAGGGGTGGGG + Intronic
1166733372 19:45070860-45070882 GGTGGGGAGGACAAGGGGGTGGG + Exonic
1166736386 19:45087765-45087787 GTTGGGGTGCAGACGGCGGGGGG + Intronic
1166824062 19:45598506-45598528 GTTGGGGAGGAGGGGTGGGAGGG - Intronic
1166978787 19:46620815-46620837 TTTGTGGAGCAGAAAGGGGCTGG + Exonic
1166992998 19:46704476-46704498 GCTGGTGAGGAGATGGGGGATGG - Exonic
1166993981 19:46710619-46710641 CTAGGGGAGCAGAAGGGTGGCGG - Intronic
1167014637 19:46832822-46832844 CTTTGGGAGCAGGAGGGGGGTGG + Intergenic
1167080533 19:47274130-47274152 GTTGGGGAGGAGCTGGGAGAAGG + Intergenic
1167130532 19:47582305-47582327 GGAGGGGAGGAGGAGGGGGAAGG - Intergenic
1167266551 19:48485628-48485650 GTAGGGGAGTGGGAGGGGGAGGG + Exonic
1167286748 19:48602589-48602611 GCTGGAGAGGAGACGGGGGATGG - Intronic
1167382865 19:49148816-49148838 GATGGGGAGGAGAGGGGGTAGGG + Intronic
1167477508 19:49709435-49709457 GTTTGGGAATAGAACGGGGAAGG - Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167661676 19:50799185-50799207 GTTGGGGGGCGGAGGTGGGATGG - Intronic
1167663482 19:50810272-50810294 GTTGGGGATGAGGATGGGGATGG + Intergenic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1168060988 19:53892141-53892163 GGAGGGGAGAAGATGGGGGATGG + Intronic
1168543436 19:57231396-57231418 GTTGGGGAGGAGGAGAGGGAGGG - Intronic
1168565032 19:57415563-57415585 GTTAGGGAGAAGGAAGGGGAAGG + Intronic
1168691765 19:58381702-58381724 GAGGGGGAGAAGGAGGGGGAGGG - Intergenic
925130039 2:1488337-1488359 GGTGGGGAGGAGAAGGGGAGGGG - Intronic
925187092 2:1855515-1855537 GCTGGGGAGCAGAGTGGGGTTGG + Intronic
925347931 2:3183508-3183530 GTGGGGGATCAGAGGAGGGAAGG - Intergenic
925376527 2:3389651-3389673 GTGGGGCAGCCGAAGGGGGTGGG + Intronic
925418466 2:3690415-3690437 GGGGGGGAGGGGAAGGGGGAGGG - Intronic
925421211 2:3713431-3713453 GTGGAGCAGCAGAGGGGGGAAGG - Intronic
925807926 2:7671015-7671037 GGTTGAGAGCACAAGGGGGAGGG - Intergenic
925927599 2:8681696-8681718 ATGGGGGAGGGGAAGGGGGAGGG - Intronic
926506446 2:13721873-13721895 GATGGGGAGCTGGAGGGGGATGG - Intergenic
927054913 2:19358714-19358736 GTTGGGGGGCAGGGGAGGGAGGG - Intergenic
927142367 2:20139265-20139287 ATTAGGGAGAAGAAGGGGAAGGG - Intergenic
927146921 2:20172361-20172383 GTTGGAGGGGAGAAGAGGGAGGG - Intergenic
927853114 2:26512145-26512167 TTTGGGCAGCAGAAGGAGGTGGG + Intronic
928017827 2:27674945-27674967 TTTGGGAGGCTGAAGGGGGATGG - Intronic
928076441 2:28269275-28269297 GATGGAGAGGAGAAGGGGGAAGG - Intronic
928200712 2:29246138-29246160 GGTGGGGAGGAGATGGGGGCAGG + Intronic
928465198 2:31516961-31516983 GGGGTGGGGCAGAAGGGGGAGGG - Intergenic
928489194 2:31763946-31763968 GTTGGGGAGCAGGGTGGAGAGGG - Intergenic
929526360 2:42706960-42706982 GCTGGGGAGGGGAAGAGGGAGGG - Intronic
929895868 2:45960461-45960483 TGTGGGGGGCAGAAGGGGAAGGG + Intronic
930771561 2:55135020-55135042 TTTGGGGAGGCCAAGGGGGAAGG + Intergenic
931216909 2:60253774-60253796 GTTGGAGGGCAGAAGAGGGAAGG - Intergenic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931533536 2:63245455-63245477 CTTGGAGAGCAGAAGGGTGTTGG + Intronic
931576219 2:63721710-63721732 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
932231903 2:70089704-70089726 GTTGGGCAGCAGGGGTGGGAAGG + Intergenic
932360228 2:71099016-71099038 TTTGGGGAGCAGATGGGCCAAGG - Intergenic
932691486 2:73917429-73917451 GTTGGGAGGCAGTATGGGGAAGG - Intronic
932768841 2:74489329-74489351 ATTGGAGAGCAGCTGGGGGAAGG + Intronic
932911496 2:75810650-75810672 GGTGGGGAGGAGAGGAGGGAGGG - Intergenic
933466464 2:82658187-82658209 GATGGGCAGCCGAAGGGGGATGG - Intergenic
933737334 2:85505681-85505703 GCTGGAGAGCAGGAGGTGGAAGG - Intergenic
934652329 2:96099761-96099783 GAGGGGGAGATGAAGGGGGAGGG + Intergenic
934663335 2:96154569-96154591 GTTGGGGAGGAGGAGAGAGATGG - Intergenic
934765528 2:96878162-96878184 GTTGAGGAGGAAAAGGAGGATGG + Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935679323 2:105622221-105622243 GTCAGGGAGCAGAAGGGGTAAGG + Intergenic
935725964 2:106024293-106024315 GTTGGGGAGTAGAAGCGGGGAGG + Intergenic
936272219 2:111057584-111057606 GTAGGGGATTAGGAGGGGGAAGG + Intronic
936294457 2:111256260-111256282 GTTGGACAGCAGCAGGGGAAGGG - Intergenic
936556421 2:113501802-113501824 GGTGGGGAGTAGATGGGGGCTGG - Intergenic
937415366 2:121710359-121710381 GTGGGGGAGCAGGTGGGGGTGGG + Intergenic
937449674 2:121991978-121992000 GTGGGGGAGCAGCAGATGGAGGG - Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
938049777 2:128158180-128158202 GTAGGGTAGGAGAATGGGGAAGG + Intronic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
938814033 2:134881517-134881539 GTAGAGGTACAGAAGGGGGATGG - Intronic
938954162 2:136282986-136283008 ATTGGGGAGCAGAAGGGCTTTGG - Intergenic
939638648 2:144612669-144612691 GTTGGGGATGAGAGAGGGGAAGG + Intergenic
940279464 2:151974709-151974731 GGTGTGGAGCAGCAGGTGGAGGG - Intronic
940291406 2:152080879-152080901 GATTGGGAGCAAGAGGGGGAAGG - Intronic
940806641 2:158194879-158194901 GTGGATGAGCAGATGGGGGATGG - Intronic
940977226 2:159959768-159959790 GTTGGGGAGATGGAGTGGGAAGG - Intronic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941886286 2:170530984-170531006 GTTGGGGTGGAGGAGAGGGAGGG - Intronic
942411682 2:175716133-175716155 GTTGGTGAGCAGAGTGCGGACGG - Intergenic
942960981 2:181829644-181829666 GTTGGGAGGAAGGAGGGGGACGG - Intergenic
942970821 2:181956021-181956043 GGTGGGGAGGAGATAGGGGAGGG - Intronic
943173320 2:184433089-184433111 GGTGGGGAGGAGATAGGGGAGGG - Intergenic
943247081 2:185469070-185469092 GTGGGGGATCAGAGGGGGTAAGG - Intergenic
943748046 2:191482842-191482864 GATGGGGAGCTGAGGGGAGAGGG + Intergenic
944412098 2:199456107-199456129 GGTGGGGGGAGGAAGGGGGAGGG + Intronic
945259788 2:207832785-207832807 GTGGGGGAGGTGCAGGGGGAGGG - Intronic
945749735 2:213766675-213766697 GATGGGGAGCAGAAGAGGCTAGG + Intronic
945821005 2:214665224-214665246 GTTGAGGAGATCAAGGGGGAGGG - Intergenic
945895096 2:215472461-215472483 GTTGGGGACCATTGGGGGGAAGG + Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946297736 2:218799172-218799194 GTTGCAGAGCATTAGGGGGAGGG - Intronic
946301808 2:218828486-218828508 GCTGGGGAGGTGAAGGGAGATGG - Intronic
946368724 2:219267076-219267098 AGTGGGGAGAAGAAGGAGGAGGG + Intronic
946405256 2:219488924-219488946 TTGGGGGAGCGGCAGGGGGAGGG + Intronic
946609484 2:221441948-221441970 GTGGGGGAGCAGTCGGAGGAGGG - Intronic
947987153 2:234458483-234458505 GTTGGGGACCGGCGGGGGGAAGG - Intergenic
948091780 2:235301718-235301740 GATGAGGGGGAGAAGGGGGAAGG - Intergenic
948152696 2:235756859-235756881 GTTGGGGGGCAGGTGGGGGATGG - Intronic
948314968 2:237021086-237021108 GTTGGGGAGGACAATGGAGAAGG - Intergenic
948453661 2:238093960-238093982 GGTGGGCACCAGGAGGGGGAGGG + Intronic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1168905898 20:1403533-1403555 GATGGGCAGCAGGAGGGGGAGGG + Intergenic
1169974280 20:11305964-11305986 GTTGGGAAGTAGAAGGAGAAAGG + Intergenic
1170010127 20:11713838-11713860 ATTGGGAAGCAGATGTGGGAGGG + Intergenic
1170020244 20:11829595-11829617 CTTGGGGAGAAGAACGGGCATGG + Intergenic
1170103495 20:12728281-12728303 GTTGGGGAGCAGAGAAGGGGAGG - Intergenic
1170243095 20:14191979-14192001 GTGGGGGAGGGGGAGGGGGAGGG + Intronic
1170295138 20:14816180-14816202 GTTGCGGGGCAGAGGGAGGATGG + Intronic
1170743991 20:19081909-19081931 GGTGGTGAGGAGAAGGGGGGTGG - Intergenic
1170821455 20:19758503-19758525 CGTGGGGAACGGAAGGGGGAAGG + Intergenic
1171096877 20:22340768-22340790 GTTGGGGATGAGTAGAGGGAGGG + Intergenic
1171123643 20:22584625-22584647 GGTGGGGAGGAGGAGGAGGAAGG + Intronic
1171210288 20:23311195-23311217 GTTGGAGAGCTGGAGTGGGAGGG - Intergenic
1172025321 20:31944445-31944467 GTTGGGGCGCACAGGTGGGAGGG - Exonic
1172248217 20:33460679-33460701 GTTGGGGGGCTGAAGGGGTGGGG - Intergenic
1172292108 20:33784050-33784072 GATGGGGAGGAGGAGGGAGACGG - Intronic
1172292115 20:33784068-33784090 GATGGGGAGGAGGAGGGAGATGG - Intronic
1172726615 20:37048463-37048485 GTTGTGGATCAGAAGAAGGAAGG - Intronic
1172745571 20:37205288-37205310 GTTGCTGAGCATAAGGGGGAAGG - Intronic
1172866800 20:38106341-38106363 TTTGGGGGGCAGAGGTGGGAGGG - Intronic
1172895235 20:38295553-38295575 GATGTGAAGCAGAGGGGGGATGG + Intronic
1173162844 20:40664907-40664929 GTTGGGGGGAAGGCGGGGGAGGG + Intergenic
1173852491 20:46227770-46227792 GTTGGGGCTCAGAGTGGGGATGG - Intronic
1174034011 20:47655152-47655174 GGTAGGGGGCAGAAGAGGGAGGG - Intronic
1174279255 20:49426978-49427000 CCTGGGGATCAGAAGAGGGATGG - Intronic
1174298969 20:49568355-49568377 GGAGGGGAGAAGGAGGGGGAGGG + Intergenic
1174302498 20:49592682-49592704 GATGGGGAGCAAAAGGCGGTGGG + Intergenic
1174442854 20:50569877-50569899 GTTGGGGAGCAGCGAGGGCAGGG - Intronic
1174569690 20:51492686-51492708 CTTGGGGAGCAGGAGGCGGCCGG + Intronic
1174968725 20:55249623-55249645 GGTGGAGAGTAGAAGGGGGATGG - Intergenic
1175120208 20:56710964-56710986 GATGGGGAGGGGAAGGAGGAGGG - Intergenic
1175460068 20:59145871-59145893 GTTGAGGAGGAGGAGGGTGAGGG - Intergenic
1175555958 20:59856915-59856937 GTAGGGTAGGGGAAGGGGGAGGG + Intergenic
1175644421 20:60658825-60658847 TCGGGGGAGCAGCAGGGGGAGGG + Intergenic
1176199389 20:63853738-63853760 GACGGGGAGCAGGAGGGTGAGGG - Intergenic
1176531097 21:7959005-7959027 GTTGGGTGGGAGGAGGGGGAGGG - Intergenic
1177729282 21:25007306-25007328 GGAGGGGAGGAGAAGGGGAAGGG + Intergenic
1177758307 21:25373687-25373709 GATGGGGAGGAGGAGGAGGAAGG - Intergenic
1177758390 21:25373923-25373945 GGTGAGGAGCAGAAGTGGGTGGG - Intergenic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179215902 21:39366914-39366936 GATGGGGAGGGGGAGGGGGAGGG - Intergenic
1179286703 21:39983816-39983838 GATGTGGTGCAGAAGGGGGAAGG - Intergenic
1179295069 21:40054441-40054463 GTGGGGCAGCAGAAGGGTGATGG + Intronic
1179295696 21:40060447-40060469 GTTTGGGAGTAGATAGGGGAGGG + Intronic
1179487799 21:41722119-41722141 GTTGAGGAGGAAAAGGAGGAGGG - Intergenic
1179491919 21:41746374-41746396 GGTGGGGAGCAGGGGGCGGATGG + Intronic
1179549037 21:42131570-42131592 GCTGGGGAGCAGGAGGAGGGAGG + Intronic
1179583245 21:42358353-42358375 GCTGGGGACCAGGAGGTGGAGGG + Intergenic
1179783220 21:43715839-43715861 GATGGGGAGCTGAGAGGGGATGG - Intergenic
1179788032 21:43740836-43740858 GTTGGGGAGGAGTTGGGGGTGGG + Intronic
1180003562 21:45007607-45007629 CTCGGAGAGCAGAAGGGGGATGG - Intergenic
1180068833 21:45426016-45426038 GTGGGGAAGCAGGAGGGGGCGGG - Intronic
1180872501 22:19154584-19154606 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1181053000 22:20246491-20246513 GGAGGGGTGGAGAAGGGGGATGG + Intronic
1181331395 22:22094862-22094884 GTTGGGGGGAAGAAGGGGAAGGG + Intergenic
1181387708 22:22557884-22557906 GGTGGGGAGGAGATGGGGGTGGG + Intronic
1181471526 22:23143181-23143203 TTTGGGAGGCTGAAGGGGGAGGG + Intronic
1181533533 22:23530440-23530462 GTGGGGGAGCAAAGGGGGGATGG - Intergenic
1181571953 22:23772714-23772736 GTGGGGGAGGTGAACGGGGAGGG - Intronic
1181602109 22:23958823-23958845 GTTGGGGAGCTGGAGATGGAGGG - Intronic
1181606401 22:23982484-23982506 GTTGGGGAGCTGGAGATGGAGGG + Intronic
1181613512 22:24035877-24035899 GGTGGGGGGCCGAGGGGGGAGGG - Intronic
1181688387 22:24544392-24544414 GCTGGGGTGCAGTAGGAGGATGG - Intronic
1181960736 22:26619860-26619882 GTGGGGGCAGAGAAGGGGGATGG + Intergenic
1181967853 22:26669092-26669114 CTTGGGGAACAGAAGGTGGCAGG + Intergenic
1182523989 22:30904105-30904127 TTTGGGGAGCAGTTGGGGGGTGG + Intronic
1183252443 22:36739677-36739699 ATTGTGGAGTAGGAGGGGGAGGG - Intergenic
1183335409 22:37243476-37243498 GGTGAGGAGCAGAAGAGGCAAGG - Intronic
1184119018 22:42438406-42438428 GGTGGGGGGCAGAAGGGGCGGGG - Intergenic
1184170860 22:42759022-42759044 GTTGGGGAGCAGTTTGAGGAGGG - Intergenic
1184547530 22:45181686-45181708 GTTGGGGAGGAGGAAGGGGAGGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1184912417 22:47545000-47545022 GCTGGGGAGGAGAAGAGGAAGGG + Intergenic
1185092790 22:48785336-48785358 GTTGGGGAGCAGAGTGAGAAGGG - Intronic
1185338812 22:50282672-50282694 TGTGGGGAGCAGAGGGGGGCGGG + Intronic
1185345177 22:50307756-50307778 GAGGGGGAGAAGGAGGGGGAGGG + Intergenic
949545653 3:5069977-5069999 GTAGGGGAACAGGAGGGAGATGG + Intergenic
949617521 3:5770319-5770341 GATGGGAGCCAGAAGGGGGATGG + Intergenic
949850938 3:8419606-8419628 GTTAGGAAGGAAAAGGGGGAAGG + Intergenic
950958640 3:17081248-17081270 GTGAGGGAGGAGAAGGAGGAGGG - Intronic
951106521 3:18750222-18750244 GTTGGGAGGCAGAATTGGGAGGG + Intergenic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
954411843 3:50374311-50374333 GAGGGGGAGGAGAAAGGGGAGGG + Intronic
954443627 3:50535079-50535101 CTTGAGGAGCAGAATGGGGGAGG - Intergenic
954993988 3:54865420-54865442 CTTGGGGATCAGTAGCGGGAAGG - Intronic
955034132 3:55249842-55249864 GTTGGAGAGCAGAGGGTGGGAGG - Intergenic
955034879 3:55257926-55257948 GTGGGAGAGAGGAAGGGGGAGGG - Intergenic
955087809 3:55720075-55720097 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
955242716 3:57193564-57193586 GTTGGGTGGGAGTAGGGGGATGG - Intergenic
955324565 3:58000281-58000303 GGTGGAGATCAGAAGGGGCAGGG - Intergenic
955422990 3:58758679-58758701 GTGGGTGAGGGGAAGGGGGAGGG - Intronic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
956109416 3:65855610-65855632 GATGGGGAGGAGAGAGGGGAGGG + Intronic
956116993 3:65929043-65929065 TTTGGGAAGCCGAAGCGGGAGGG + Intronic
956190289 3:66601723-66601745 GAGGGGGAGGAGCAGGGGGAGGG - Intergenic
956318514 3:67967778-67967800 GTTGGGGAGCAGATGAAGTAGGG + Intergenic
956642612 3:71429093-71429115 GCTGGGGACGAGAAGGTGGATGG + Intronic
956778617 3:72587160-72587182 ATGGGGGAGCTGAAGGGAGATGG - Intergenic
957638318 3:82815576-82815598 GTTCCTGAGCAGAAGGGGGTGGG - Intergenic
959839707 3:110960140-110960162 CTTGGGGAGGGGAAGGGGGCTGG + Intergenic
960094010 3:113670623-113670645 GAAGGGGAGCGGAAGGGGAAGGG + Intronic
960128933 3:114032405-114032427 ATTGGTGAGCAAAAGAGGGATGG - Intronic
960527335 3:118724666-118724688 CTTGTGGAGGAGAAGGGAGATGG + Intergenic
960680639 3:120243924-120243946 GTTGGGGAGGAGGAGGTGGAGGG - Intronic
960902144 3:122564167-122564189 GTGGGCGGGGAGAAGGGGGACGG - Intronic
961346034 3:126263943-126263965 ATTGGGGAGCAGAAGGGAGGAGG + Intergenic
961384229 3:126515553-126515575 GCTGGGGAGTGGAAGGGGGTAGG - Intronic
961452899 3:127010461-127010483 GTTGGGGAGGAGATGGGGTGGGG + Intronic
961609699 3:128126823-128126845 GGTGGTGCGCAGAAGTGGGATGG - Intronic
961636687 3:128337433-128337455 GATGGGGAGGAGGAGGGGGAAGG + Intronic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961745598 3:129061897-129061919 GTTGGCCAGCAGAAGGTGGCGGG - Exonic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962237841 3:133723798-133723820 GGTGGGGTGGGGAAGGGGGAGGG - Intergenic
962259877 3:133895558-133895580 GTGCGGGAGCCGGAGGGGGAAGG + Exonic
962316555 3:134363127-134363149 GTTCTGGAACAGAAGGGTGAAGG + Intronic
962460714 3:135609993-135610015 GTTGGGTGGGAGAAGGGGGACGG + Intergenic
962488156 3:135864684-135864706 TGTAGGGTGCAGAAGGGGGAAGG + Intergenic
962615812 3:137125375-137125397 GTTGGCGAGAAGGAGGAGGAAGG + Intergenic
962687094 3:137858209-137858231 GACCGGGAGCAGAAGAGGGATGG + Intergenic
963087826 3:141454890-141454912 GTTGGGGGGCAGGAGTGGGTGGG + Intergenic
963207560 3:142652046-142652068 GTTGGGGAGTCAAATGGGGAGGG + Intronic
963742957 3:149097925-149097947 GGTGGGGAGGGGGAGGGGGAGGG + Intergenic
963828074 3:149977057-149977079 ATTGTGGAGCAGGAGGGGAAAGG + Intronic
964338788 3:155686223-155686245 GTTGAGGGGAAGAAGAGGGAAGG + Intronic
964719070 3:159753896-159753918 GTTGAGCAGCTGAAGAGGGAGGG - Intronic
964780539 3:160332339-160332361 GGTGGGGAGCAAAAGAGAGAGGG + Intronic
965723678 3:171689742-171689764 TTTGGGAAGCTGAAGTGGGAGGG - Intronic
965867631 3:173224984-173225006 TTTGGGGAGCATAAGGCAGAAGG + Intergenic
966111578 3:176408809-176408831 TTTGGGGAGCATAGTGGGGATGG + Intergenic
966350803 3:179031953-179031975 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
966350813 3:179031971-179031993 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
966350829 3:179032001-179032023 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
966916726 3:184588376-184588398 GGTGGGGAGAAGAAGGGGTTTGG - Intronic
966954750 3:184864142-184864164 GAGGGGGAGGGGAAGGGGGAAGG + Intronic
966982888 3:185153699-185153721 GGGTGGGAGGAGAAGGGGGAGGG - Intergenic
967012764 3:185452329-185452351 CTTGGGGGGCTGAAGTGGGAGGG - Intronic
967266177 3:187694292-187694314 TTTGGGCAGCAGTAGAGGGAAGG + Intergenic
968606640 4:1538469-1538491 GTCGGGGGGCAGAGGTGGGAGGG + Intergenic
968607302 4:1541624-1541646 GTTGGGGAGGAGAGTGGGGCGGG - Intergenic
968648413 4:1751000-1751022 GGTGGGGAGCAGCAGCGTGAAGG + Intergenic
968735275 4:2291892-2291914 GGTGGGGAGCAGAGGGGGCCGGG + Intronic
968781255 4:2583421-2583443 ATTTGGGGGCAGCAGGGGGAAGG - Intronic
968863970 4:3195841-3195863 GTTGGGGACAAGGAGAGGGAAGG + Intronic
968920274 4:3518814-3518836 GGTGGGGGGCAGGAGGGGGTGGG + Intronic
969094499 4:4721840-4721862 GTTGGGGATGAGGAGAGGGAGGG - Intergenic
969370312 4:6727626-6727648 GAGGGGGAGGAGGAGGGGGAAGG - Intergenic
969518377 4:7661430-7661452 TGTGGGGAGCAGCTGGGGGACGG + Intronic
969659319 4:8517392-8517414 GCCAGGGAGCAGAAGAGGGAGGG + Intergenic
970209620 4:13695786-13695808 GTTCAGGAGCAGAAGTGGAATGG + Intergenic
970233389 4:13933744-13933766 GATGGGGAGCATGAGAGGGATGG + Intergenic
970443885 4:16108352-16108374 GTTGGGGAGGAGAAAGGTGTGGG + Intergenic
970507206 4:16743575-16743597 GTTGGAGAGTTGAAGGGAGAGGG + Intronic
970754654 4:19410808-19410830 TTTGGGGAAAAGAAGGAGGAAGG + Intergenic
970930745 4:21508944-21508966 GTTAGGGAGCAGAAGCAAGAAGG - Intronic
971007858 4:22395609-22395631 GTAGGGGAGAAGAAAGGGCAAGG - Intronic
971677625 4:29654028-29654050 GTGGGCTAGCAGAAGGGAGAGGG + Intergenic
971952655 4:33374066-33374088 GTTGGGGGAGAGAAGGGAGAAGG + Intergenic
971967893 4:33585745-33585767 GTTGGGGAAGAGAAGGAGGCAGG + Intergenic
972279511 4:37588548-37588570 GATGAGGAGAAGAAGGTGGAAGG - Intronic
972662614 4:41130758-41130780 GATGGGGAGCAGAAGTGGGGAGG - Intronic
973067245 4:45811044-45811066 GCTGGGAAGAAGAAGGGGAAGGG - Intergenic
973687800 4:53391179-53391201 TTTGGGGAGTAAAAGTGGGACGG - Intronic
973790103 4:54370505-54370527 GAAGGGGAGAGGAAGGGGGAAGG - Intergenic
974094722 4:57350910-57350932 GGTGATGAGCAGAAGGGTGAGGG + Intergenic
974109570 4:57511035-57511057 GTTGGGGAGCAGGGGGTTGAGGG + Intergenic
974508573 4:62807849-62807871 GTGGGAGAGCAGAGGGGGTAGGG + Intergenic
974542492 4:63256028-63256050 TTTGGGGAGGAGAAGGCAGAGGG - Intergenic
974597699 4:64036640-64036662 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
976753860 4:88477545-88477567 GTGGGGGAGGGGAAGGGGAAGGG + Intronic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977895852 4:102364036-102364058 GGTGGGGAGGAGAAGGGGAGGGG + Intronic
978529330 4:109698409-109698431 TTTGGGAGTCAGAAGGGGGATGG - Intronic
978775879 4:112506487-112506509 TTTGGGAAGCTGAAGTGGGAGGG + Intergenic
978837090 4:113163978-113164000 CATGGGGAGGACAAGGGGGAGGG - Intronic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
980275277 4:130642881-130642903 GTTGGGTGGGAGGAGGGGGAAGG - Intergenic
980603134 4:135052251-135052273 TTTGGGAGGCAGAAGGGGGACGG - Intergenic
980890733 4:138812249-138812271 TGTGGGGAGCAGGAGAGGGATGG + Intergenic
981696762 4:147566724-147566746 TTTGGGAAGCAGAGGTGGGAGGG - Intergenic
981910981 4:149981799-149981821 TTTAGGGAGGAGAAGGGGCAGGG - Intergenic
982353657 4:154443789-154443811 TTTGGATAGCAGAATGGGGAGGG - Intronic
982898895 4:160972408-160972430 TGTTGGGGGCAGAAGGGGGAGGG + Intergenic
983763229 4:171440437-171440459 GTGTAGGGGCAGAAGGGGGATGG - Intergenic
983905169 4:173174145-173174167 GTGTGGGGGGAGAAGGGGGATGG - Intronic
983913872 4:173269722-173269744 GTTGAGGAGGAGGAGGAGGAGGG - Intronic
984104552 4:175528770-175528792 TTTGGGGAGCTTAAGAGGGAAGG - Intergenic
984373707 4:178899873-178899895 GATGGGGAGCTGGAAGGGGATGG + Intergenic
985644975 5:1080530-1080552 GTCCGGGAGCAGACGTGGGAGGG + Intronic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985674074 5:1221338-1221360 GGTGGGGAGAGGAATGGGGAAGG + Intronic
985749677 5:1667179-1667201 GTTGGGGCGCAGGAGGAGGGCGG - Intergenic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
986167845 5:5291380-5291402 GTTGAGGAGGAGAAGAGGCAGGG + Intronic
986344984 5:6826646-6826668 GTTGGGGATGAGAGAGGGGAAGG + Intergenic
986670571 5:10139530-10139552 GGTGGAGAGCAGAGGGAGGAAGG + Intergenic
986765138 5:10918799-10918821 GTTGGGGAGCAGGGGGAGTAGGG - Intergenic
986769364 5:10957783-10957805 GTGGGGGAGTAGAAGAGAGAAGG + Intergenic
988297913 5:29390448-29390470 GTGAGGGAGCAAAAGGGAGAGGG - Intergenic
988485661 5:31666234-31666256 GTCTTGGAGCAGAAGGTGGAGGG + Intronic
988492587 5:31717542-31717564 GCTGGGGAGGTTAAGGGGGAGGG - Intronic
988703066 5:33695692-33695714 GTTGGGGAGGAAAAGGGAAATGG + Intronic
988717352 5:33841220-33841242 GTTGTGGGGCAGGAGGTGGAGGG - Intronic
989504946 5:42216230-42216252 GTCGGGGAGCAAGAAGGGGAGGG + Intergenic
989545307 5:42665595-42665617 GTGGGGGTGGAGGAGGGGGAAGG + Intronic
990008633 5:50969607-50969629 GCCGGGGAGCGGAAGGGGGAGGG + Intergenic
990269166 5:54116151-54116173 CCTGGGGAGCAGGAGGGGGTTGG + Intronic
990373516 5:55145682-55145704 GTAGGGAAGAAGAAGAGGGAAGG - Intronic
990456520 5:55994616-55994638 GTCCGGGAGCAGGAAGGGGAAGG + Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990893932 5:60676744-60676766 GATGGGGAGGAGAAGGAGAAGGG - Intronic
991038857 5:62155594-62155616 GTTGGGGAAGAGAAGGGAGGAGG - Intergenic
991122080 5:63028557-63028579 GTTGTGGAGGAGAAGAGAGAGGG + Intergenic
991491000 5:67182510-67182532 GTCGGTGAGTAGAAGGGGAATGG + Exonic
992578980 5:78151847-78151869 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
992849712 5:80794643-80794665 GGTGGGTAGCAGAAGGGAGAAGG + Intronic
993225518 5:85164558-85164580 GTTGGGGATCAGGAAGTGGAGGG + Intergenic
993305639 5:86271877-86271899 GAGCGGGAGCAGAAAGGGGAAGG - Intergenic
993492474 5:88568931-88568953 GTGGGTCGGCAGAAGGGGGAGGG + Intergenic
993592177 5:89807782-89807804 GTGGGGGGGAAGAAGGGAGAGGG + Intergenic
993716128 5:91277355-91277377 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
994332281 5:98520991-98521013 GCTGGGGAGCAAAACAGGGAGGG + Intergenic
994531435 5:100977764-100977786 GTGGGGGAGGGGGAGGGGGAAGG - Intergenic
994576861 5:101589309-101589331 GTTGGGGTGGGGAGGGGGGAGGG + Intergenic
994734179 5:103532104-103532126 ATTGGGGAGAAGAAGGGGTTAGG + Intergenic
994989484 5:106980180-106980202 GTTGCTGGGCAGGAGGGGGAGGG - Intergenic
995329013 5:110925868-110925890 GTTGAGGATCAGAAGTAGGATGG - Intergenic
995387763 5:111607144-111607166 GCTGGGGAAGAGAAGGAGGAGGG - Intergenic
995909194 5:117165115-117165137 GGTGGGGAGAAAAAGGGGAAAGG + Intergenic
996009177 5:118461840-118461862 GTTGGGAACAAGAAGGGGCACGG - Intergenic
996024086 5:118624291-118624313 GTTGGGGTTCGGAATGGGGAGGG + Intergenic
996039535 5:118794605-118794627 CTTAGGGAGCAGAAAGTGGAGGG + Intergenic
996325181 5:122265038-122265060 GTGGGGGAGGAGAAGGTGTATGG - Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996778706 5:127160312-127160334 GTTTGGGAGGGGAATGGGGATGG - Intergenic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997178393 5:131802397-131802419 GATGGGGAGCAGAGAGGAGATGG + Intergenic
997300066 5:132797044-132797066 GTTGGGTCACAGAAGGTGGATGG + Intronic
997358437 5:133279386-133279408 GTGGGGGAGCAGAACAGAGATGG - Intronic
997643043 5:135462253-135462275 GTTGGCGAGCAGGAGTGGGTAGG - Intergenic
997784978 5:136701984-136702006 GGTGGGCAGCAGCAGGTGGACGG - Intergenic
997966610 5:138361960-138361982 CTTGGGGAGCAGCAGATGGAGGG + Intronic
998400294 5:141845322-141845344 GTGGAGGAGGAGCAGGGGGAGGG - Intergenic
998816289 5:146017524-146017546 GATGGGGAGGAGGAGGGGAAGGG - Intronic
999243061 5:150138654-150138676 GGTGGGGAGCAGAGGCTGGAGGG - Intronic
999262166 5:150244949-150244971 GTTGGGGGGCAGATGGGAGAGGG - Intronic
999517186 5:152313455-152313477 GTCAGGGAGGAGAAGGGGGAAGG - Intergenic
999922356 5:156335652-156335674 CTTGGAGGGCAGGAGGGGGATGG - Intronic
1000294505 5:159901404-159901426 GAAGGGGAGGAGAAGGGGGAGGG + Intergenic
1000329871 5:160198037-160198059 GAAGGAGAGAAGAAGGGGGAAGG + Intronic
1000470202 5:161631079-161631101 ATGGGGGGCCAGAAGGGGGATGG + Intronic
1001087887 5:168714756-168714778 GAAGGGGAGGAGAAAGGGGAAGG - Intronic
1001619564 5:173071945-173071967 CTTGGGAGGCAGAAGTGGGAGGG + Intronic
1001709047 5:173763088-173763110 GTTGGGGAGGAGGAGAGGGTTGG + Intergenic
1001858671 5:175034204-175034226 GTGGGGGAGCAGATGGGTGTGGG + Intergenic
1002300659 5:178255762-178255784 GGTGGGGAGCGGGAGGGGGTTGG - Intronic
1002336920 5:178485909-178485931 GTTGGGCAGCAGTGGTGGGAGGG + Intronic
1002901135 6:1410500-1410522 GATGGGGAGCGGATGGGGGTAGG + Intergenic
1003459859 6:6319866-6319888 ATTGGTGAGCTGACGGGGGAAGG + Intronic
1003485796 6:6578049-6578071 TTTGGGAGGCAGAAGTGGGAGGG + Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004114029 6:12749541-12749563 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
1004305883 6:14501671-14501693 GCTGGGGGGGAGAAGGGGGGGGG + Intergenic
1004322189 6:14640644-14640666 TTTGGGCAGGAGAAGTGGGAGGG - Intergenic
1005399322 6:25415447-25415469 GGTGGGGAGAGGAAGAGGGAGGG - Intronic
1005502245 6:26439092-26439114 GTTGGGAAGGAAAAGGGGGAGGG + Intergenic
1005768946 6:29045271-29045293 GTAGAGGAGGAGAAGGAGGAGGG + Intergenic
1005773319 6:29099934-29099956 GGAGGGGAGCAGAAGGGGGATGG + Intergenic
1005779369 6:29172408-29172430 GGAGGGGAGCAGAAGGGGGATGG + Intergenic
1005874351 6:29999784-29999806 ATTGAGGAGCAGGAGGGTGAAGG + Intergenic
1006150471 6:31984197-31984219 GCTGGGGAGGGGAAGGGGCAAGG + Intronic
1006156772 6:32016935-32016957 GCTGGGGAGGGGAAGGGGCAAGG + Intronic
1006451975 6:34110638-34110660 GGTGGGGATGAGAAGGGGTATGG - Intronic
1006511731 6:34525306-34525328 GATGGGGAGCCCTAGGGGGAGGG + Intronic
1006603178 6:35239178-35239200 GCTGGGTAGCTGATGGGGGAGGG - Intronic
1006852034 6:37105461-37105483 GATGGGGAGTAGGAGGAGGATGG + Intergenic
1006888485 6:37402445-37402467 GGTAAGGAGCAGAAAGGGGAAGG - Intergenic
1007178608 6:39912869-39912891 GTTAGGGAGCAGGAGGGTGTGGG - Intronic
1007228548 6:40331835-40331857 CTTGGGGAGCAGGAGGGGGAGGG - Intergenic
1007267719 6:40609927-40609949 GAAGGGGAGAAGAAGGGGGAAGG - Intergenic
1007380261 6:41485720-41485742 GTTGGGGTGGGGAAGGGGGCAGG - Intergenic
1007662634 6:43496076-43496098 ACTGGGGAGCACATGGGGGAAGG + Intronic
1007703981 6:43780251-43780273 GATGGGGAGCAGGAGTGGGAGGG - Intronic
1007825702 6:44599086-44599108 GAGGGGGAGCTGAAGGGAGAGGG - Intergenic
1008294169 6:49756394-49756416 GTTGGGGAGCAGGGGGTTGATGG + Intergenic
1008338493 6:50335886-50335908 GGTGGGTAGGAGAAGGGTGAGGG + Intergenic
1009826691 6:68875214-68875236 GAGGGGGAGAGGAAGGGGGAAGG - Intronic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1011389677 6:86838195-86838217 TTTGGGGTGCAGAAGAGGCAGGG + Intergenic
1011603674 6:89081599-89081621 CTTTGGGGGAAGAAGGGGGAAGG + Intronic
1011632351 6:89339573-89339595 GGTGGGGAGGGGAAGGGGGAAGG + Intronic
1011677791 6:89752239-89752261 GTTGAGAAGCAATAGGGGGAGGG + Intronic
1011687251 6:89833339-89833361 GCTGGGGAACAGAACAGGGATGG + Intronic
1012132992 6:95519725-95519747 GTGGGGGAGCTGAAGGGCGGGGG - Intergenic
1012611150 6:101222624-101222646 GAAGGGAAGCAGGAGGGGGAGGG - Intergenic
1012724950 6:102799021-102799043 GATGGGGAGCTGGAGTGGGAAGG - Intergenic
1013246589 6:108293567-108293589 GAAGGGGAGGGGAAGGGGGAAGG - Intergenic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1013837115 6:114345707-114345729 ATTTGGGAGGAGAAGGTGGAAGG + Intergenic
1014237826 6:118979797-118979819 GTTTGGGAGGACAAGGTGGAAGG + Intronic
1014517601 6:122399417-122399439 GGGTGGGAGCAGAAGGGGGTGGG - Intergenic
1014999785 6:128200847-128200869 GGGGGGGAGGAGGAGGGGGAGGG + Intronic
1015554980 6:134451786-134451808 GTTGGGGAGCAGAGAGTGGAGGG + Intergenic
1015616955 6:135087509-135087531 GTTGGGAAGGGGAAGGGGAAGGG - Intronic
1016090717 6:139975859-139975881 GAAGGGGAGGCGAAGGGGGAAGG - Intergenic
1016304136 6:142665835-142665857 GTGGGGGAGCAGGAGAGTGAGGG + Intergenic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1017013341 6:150080008-150080030 CTTGGAGGGCAGATGGGGGAAGG - Intergenic
1017046664 6:150352934-150352956 GTTGGTGAGTAGTAGGGGAATGG - Intergenic
1017328228 6:153165073-153165095 GTTGGGGAGTAGAAGGGCAAGGG + Intergenic
1017457030 6:154610345-154610367 GAATGGGAGTAGAAGGGGGAAGG - Intergenic
1018393223 6:163356627-163356649 GGCGGGGAGCAGGAGGGGGCGGG - Intergenic
1018844711 6:167547517-167547539 GATGGGGTGAAGAAGGAGGAGGG - Intergenic
1018907607 6:168084599-168084621 GTTTGGGAGCAGCACAGGGAGGG - Intergenic
1018914036 6:168121832-168121854 GTTGGAGAGAGGAAGGGGCAGGG + Intergenic
1019101604 6:169635230-169635252 GTTGGGGGGCAGGTGGGGGAAGG + Intronic
1019445445 7:1068634-1068656 GTTGGGGGGAAGACTGGGGATGG - Intronic
1019488784 7:1301449-1301471 GTAGGGGAGCACATGGGGGCAGG + Intergenic
1019531670 7:1506530-1506552 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1019538822 7:1542384-1542406 CGTGGGGAGATGAAGGGGGACGG - Exonic
1019932746 7:4234559-4234581 GTGGGGGAGCTGGAGAGGGAGGG + Intronic
1020143535 7:5625264-5625286 GCTGGGGAGAAGGATGGGGAGGG + Intronic
1020659972 7:10970566-10970588 TTGGGGGAGCTGTAGGGGGATGG - Intergenic
1020660461 7:10974671-10974693 GTTGGGGTGCAGAAGCAGGGTGG - Intronic
1020673545 7:11151311-11151333 TTTGGGAAGCTGAAGTGGGAGGG + Intronic
1021163495 7:17304920-17304942 TTTGCGTAGAAGAAGGGGGAGGG + Intronic
1021196463 7:17679712-17679734 GTTGGGGCGCAGGAGGGAGGAGG + Intergenic
1021554387 7:21904671-21904693 TTTGGGGGGCAGGAAGGGGATGG - Intronic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022209184 7:28191961-28191983 GCTGGGGAGGAAAAAGGGGAGGG + Intergenic
1022469001 7:30670494-30670516 GGTGGGATGCAGAAGCGGGAGGG + Intronic
1022522419 7:31016760-31016782 GTTGGGCAGCAGGAGCGGGGAGG - Intergenic
1023320267 7:38989055-38989077 GTTGGGGAGTGGAAGGGTGGAGG + Intronic
1024196465 7:47064036-47064058 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1024544522 7:50505998-50506020 GTTGGGCAGCAGAGGGGTGGGGG + Intronic
1024725479 7:52189404-52189426 GAGGGGGAGGAGAAGGGAGAGGG + Intergenic
1026308739 7:69166085-69166107 GTGGGGGAGGGGAGGGGGGAGGG + Intergenic
1026716656 7:72795144-72795166 GTTTGGGAGCAGCTGGGGGGAGG - Intronic
1026762540 7:73137707-73137729 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
1026913271 7:74105195-74105217 GTTGGGGAGGCCAAGGTGGATGG - Intronic
1027039003 7:74947483-74947505 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
1027084684 7:75254993-75255015 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1027203192 7:76075590-76075612 CTTGGGAAGCTGAAGTGGGAGGG + Intergenic
1027464918 7:78503560-78503582 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
1027603286 7:80266829-80266851 GTTGGGGAGCACAAGGGAAGAGG + Intergenic
1027622650 7:80510120-80510142 GTTGGGGGGAACAAGGGGAAAGG - Intronic
1027753805 7:82185477-82185499 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1027935005 7:84590590-84590612 GTGGGGTAGGGGAAGGGGGAGGG - Intergenic
1028501243 7:91520980-91521002 GAAGGGGAGCTGAAAGGGGATGG - Intergenic
1028767577 7:94577287-94577309 TTTGGGGAGCAGAAGTGGGGAGG - Intergenic
1028888350 7:95959415-95959437 GTTAAGGAGGAGAACGGGGAAGG + Intronic
1028984236 7:96997380-96997402 GATGGGGAGCAGGAGGGAGGGGG + Intergenic
1029046472 7:97634603-97634625 TATGGGGAGGAGAAAGGGGAGGG + Intergenic
1029122946 7:98280950-98280972 GATCGGGCTCAGAAGGGGGAGGG - Intronic
1029358745 7:100072610-100072632 GTTGGTGAGAAAAGGGGGGAAGG + Intronic
1029374868 7:100171501-100171523 GTCGGGGGGCAGCAGGGGGCGGG - Intronic
1029461010 7:100693951-100693973 CTCGGGGAGGAGACGGGGGAGGG + Intergenic
1029525124 7:101089314-101089336 GTTGGGGAGTACAAGGGGCCAGG + Exonic
1029539474 7:101174192-101174214 GGTGGGGAGCAGGAGAGAGAGGG - Intronic
1029642908 7:101832334-101832356 GTTGGGGAACAGCAGGGGCAGGG + Intronic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1029795852 7:102893818-102893840 GAGGGGGAGAAGAAGGGGAAGGG + Intronic
1030205441 7:106948265-106948287 TTTTGGGAGCAGAATAGGGAAGG - Intergenic
1030606883 7:111646999-111647021 GTTGGTGAGAAGATGGGGAAAGG + Intergenic
1031050886 7:116944289-116944311 GTTGGAGGGAAGAAGGGGTATGG - Intergenic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1031595080 7:123640672-123640694 GAGGGGGAGGAGGAGGGGGAGGG + Intergenic
1031595105 7:123640717-123640739 GAGGGGGAGGAGAAGGGGAAGGG + Intergenic
1032499612 7:132390700-132390722 GTTGGTGGGCAGAAGGGGGCTGG - Intronic
1032807749 7:135374154-135374176 GATGGGCAGCAGAAGGGGAAAGG - Intronic
1034085871 7:148322026-148322048 GTTGGGGTGGGGGAGGGGGACGG - Intronic
1034263759 7:149772140-149772162 GTGGGGGAGGAGAGGAGGGAGGG - Intronic
1034348532 7:150401939-150401961 GGTGGTGAGCAGAGGGGAGAAGG - Intronic
1034711147 7:153192498-153192520 GGTGGGAAGCAGGAGGGGAAGGG - Intergenic
1034721594 7:153299140-153299162 GGTGTGGAGTAGAATGGGGATGG + Intergenic
1035313680 7:157984936-157984958 GGTGGGGAGCAGCACGGGGTGGG - Intronic
1036016705 8:4793456-4793478 GGTGGGGAGGAGAGAGGGGATGG - Intronic
1036665402 8:10734083-10734105 GAGGGGGAGAAGGAGGGGGAGGG + Intronic
1037260410 8:17001704-17001726 GCTGGGGCGCAGATGGGGGTGGG + Intronic
1037813014 8:22097851-22097873 GATCGGGAACAGGAGGGGGAGGG + Intronic
1038007394 8:23444366-23444388 GATGGAGAGGAGAAGGAGGAAGG + Intronic
1039013937 8:33125333-33125355 ATTGGGGTGAAGATGGGGGAGGG - Intergenic
1039564662 8:38542490-38542512 GGAGGGGAGGGGAAGGGGGAGGG - Intergenic
1040070287 8:43181664-43181686 GTTGGGTAGCAGATAGGGCAGGG + Intronic
1040416001 8:47196685-47196707 GCTGGAGAGCAGTAGGGGGATGG - Intergenic
1040500285 8:47999182-47999204 GTTGCAGAGCATTAGGGGGAGGG + Intergenic
1040581994 8:48705744-48705766 GTTTGGGGGCAGCACGGGGAGGG - Intergenic
1040739478 8:50555872-50555894 GTTGGAGAACAGACAGGGGAAGG + Intronic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041012754 8:53559991-53560013 GTTGGGGAGCAGGAGGGTTGAGG - Intergenic
1041086246 8:54259187-54259209 GTTGGGGAGGAGGAGGGAGAGGG + Intergenic
1041219989 8:55640612-55640634 GTGGGGTAGGAGGAGGGGGAAGG + Intergenic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1042226879 8:66521141-66521163 GGTGGGCAGCAGCAGGGTGAGGG + Intergenic
1042311045 8:67379788-67379810 GATGGGGAGGGGAAGGAGGAAGG - Intergenic
1042643099 8:70956542-70956564 GTTCCTGGGCAGAAGGGGGAAGG - Intergenic
1043389186 8:79775404-79775426 GTAGGGGAACAGAACGGGGATGG - Intergenic
1043431810 8:80202102-80202124 GGAGGGGAGGGGAAGGGGGAGGG + Intronic
1043523643 8:81073408-81073430 TTTGGGGATCAGGAGGGGAAAGG - Intronic
1044293177 8:90496785-90496807 GATGGGGAGGGGACGGGGGAAGG - Intergenic
1045009916 8:97950006-97950028 AGTGGGGAGCAGCAGGGAGAGGG + Intronic
1045035895 8:98176257-98176279 GTTGGGGGGCTGGAGTGGGATGG + Intergenic
1045063344 8:98426567-98426589 GTTGGGGAACAGGAGCTGGAGGG - Intronic
1045474635 8:102542557-102542579 GAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1046178999 8:110618310-110618332 GTGGGGGAGGAGGAGGGGCAAGG - Intergenic
1046299938 8:112275025-112275047 GATGTGGAGTAGAAGGGGAATGG - Intronic
1046538100 8:115542557-115542579 GATGGGGAGAAAAAGGGAGAAGG + Intronic
1046625464 8:116572311-116572333 GATGAAGAGAAGAAGGGGGAGGG - Intergenic
1046784081 8:118247248-118247270 GCTGGGGAGAAGGAGGGGCACGG + Intronic
1046848726 8:118948932-118948954 GTTGGGGTGGAGAAGTGGGCAGG - Intronic
1047079099 8:121440326-121440348 TCTGGGGAGAAGAAGGGCGAGGG - Intergenic
1047254828 8:123207112-123207134 GTGATGGAGGAGAAGGGGGAAGG - Intronic
1047336243 8:123939464-123939486 TTCGGGGAGCATAAAGGGGAAGG + Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047521815 8:125600757-125600779 CTTGGGGAGCAGAAGGGAGGAGG + Intergenic
1047529916 8:125665241-125665263 TTTGGGGAGCAGAGGGGTGGGGG - Intergenic
1047632424 8:126722782-126722804 GTAGGAGGGAAGAAGGGGGATGG - Intergenic
1047851083 8:128858472-128858494 GTTGCAGAGCATTAGGGGGAGGG + Intergenic
1047909310 8:129510033-129510055 GTTGGGTAGAAGAAGAGGGAAGG - Intergenic
1048054745 8:130852743-130852765 CATGGGGTGCAGAAGGGTGAGGG - Intronic
1048250985 8:132866745-132866767 GTGGGGGAACAGAACGGGGTGGG - Intergenic
1048280615 8:133102900-133102922 TGTGGGTAGCAGTAGGGGGAGGG + Intronic
1048370745 8:133774015-133774037 GTTTGGGAGAAGGAAGGGGAGGG + Intergenic
1048487282 8:134859923-134859945 GGTGGAGAGCAGAATGGGGGTGG + Intergenic
1048981363 8:139704575-139704597 AGTGGGGAGCAGAAGGGGAGGGG + Intergenic
1049451542 8:142664706-142664728 GAAGGGAGGCAGAAGGGGGACGG - Exonic
1049519340 8:143080278-143080300 ATTTGGAAGCAGACGGGGGAGGG - Intergenic
1049547960 8:143243360-143243382 GGGGGGGAGGAGGAGGGGGAGGG + Intergenic
1049896600 9:115535-115557 GGTGGGGAGTAGATGGGGGCTGG + Intergenic
1050404306 9:5291925-5291947 GGTAGGGAGCATAAGGAGGAAGG + Intergenic
1050599221 9:7233866-7233888 GTTGCAGAGCATTAGGGGGAGGG + Intergenic
1051365226 9:16317025-16317047 TTTGGGGAGGAGGAGGGGTAGGG + Intergenic
1051425514 9:16927897-16927919 GTTGGGAAGGCGAAAGGGGAGGG + Intergenic
1051642692 9:19238478-19238500 GGAGGGGAGGAGAAGGGGGAGGG - Intronic
1051642716 9:19238530-19238552 GGAGGGGAGGAGAGGGGGGAGGG - Intronic
1051642764 9:19238621-19238643 GGAGGGGAGGAGAGGGGGGAGGG - Intronic
1051940710 9:22502295-22502317 GTTAGTGAGCAGAAGCTGGAGGG - Intergenic
1052091210 9:24329858-24329880 GTAGGGGATCAGAAGAGGGGTGG + Intergenic
1052835731 9:33248667-33248689 GTTGAGGAGCACCAGAGGGACGG - Intronic
1052951816 9:34219732-34219754 GGAGGGGAGGGGAAGGGGGAGGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053025570 9:34725794-34725816 TTTAGGGAGCAGTTGGGGGAAGG + Exonic
1053037099 9:34834856-34834878 TTTAGGGAGCAGTTGGGGGAAGG + Intergenic
1053233805 9:36434297-36434319 GGAGAGGAGCAGGAGGGGGAGGG + Intronic
1053318942 9:37078575-37078597 TTTTGGGAGCCTAAGGGGGAAGG - Intergenic
1053329196 9:37188564-37188586 GTAGGGGAGGTGAGGGGGGAGGG - Intronic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1053670807 9:40359337-40359359 GTGGGGGAGCAGGATGGAGATGG - Intergenic
1053739706 9:41125773-41125795 GGTGGGGAGTAGATGGGGGCTGG + Intergenic
1053840086 9:42183548-42183570 GTTGGGGAGGGGCAGTGGGAGGG - Intergenic
1054097137 9:60914296-60914318 GTTGGGGAGGGGCAGTGGGAGGG - Intergenic
1054118543 9:61189925-61189947 GTTGGGGAGGGGCAGTGGGAGGG - Intergenic
1054285400 9:63163649-63163671 GCTGGGGAGCCCACGGGGGAAGG + Intergenic
1054381930 9:64499399-64499421 GTCGGGGAGCAGGATGGAGATGG - Intergenic
1054389420 9:64601374-64601396 GCTGGGGAGCCCACGGGGGAAGG - Intergenic
1054513806 9:66016964-66016986 GTGGGGGAGCAGGATGGAGATGG + Intergenic
1054589214 9:66992639-66992661 GTTGGGGAGGGGCAGTGGGAGGG + Intergenic
1054688645 9:68305547-68305569 GGTGGGGAGTAGATGGGGGCTGG - Intergenic
1054717202 9:68568187-68568209 GATGTGGGGCAGAAGTGGGAGGG - Intergenic
1054901150 9:70370761-70370783 GAGGGGGAGAGGAAGGGGGAGGG + Intergenic
1055161632 9:73136144-73136166 CTTTGGGAGGACAAGGGGGAAGG + Intergenic
1055187497 9:73474272-73474294 GCTGGGGAGGGGGAGGGGGAGGG - Intergenic
1055393811 9:75851960-75851982 GTTGGGGGGAAGAAAGGGGAGGG - Intergenic
1055581441 9:77711054-77711076 GATGGGGAGGGGAAGGAGGAGGG - Intergenic
1055811937 9:80159050-80159072 TTTGGGGAGCTTTAGGGGGAAGG + Intergenic
1056530472 9:87482512-87482534 GGAGGGGAGGGGAAGGGGGAAGG + Intergenic
1056754673 9:89374234-89374256 GTAGGGGAGCTGAGGGAGGAGGG - Intronic
1058139458 9:101342420-101342442 GATGGGGAGGGGAAGAGGGAAGG + Intergenic
1058139538 9:101342585-101342607 GATGGGGAGGGGCAGGGGGAGGG + Intergenic
1058173013 9:101705402-101705424 GATGGGGAGCTGGAGTGGGAAGG - Intronic
1058375292 9:104316052-104316074 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1059476427 9:114551500-114551522 CTTGGGAGGCTGAAGGGGGAGGG - Intergenic
1060077379 9:120604541-120604563 ATTGGGGAGCAGGAGGCTGATGG - Exonic
1060525886 9:124321094-124321116 GGTGGTGAGGAGGAGGGGGAGGG + Intronic
1060800879 9:126545340-126545362 GTTGGGGGGCAAAGTGGGGAGGG - Intergenic
1060846229 9:126839590-126839612 GTTTGGGAACAGAACGGGGTGGG + Intergenic
1060973562 9:127752617-127752639 GTATGGGAGCAGAGGGGTGAGGG - Intronic
1060992296 9:127856097-127856119 ATTGGGGAGAAGAAGGGGTGAGG + Intergenic
1061306602 9:129736204-129736226 GTTGGGGAGGAAAAGTGTGAGGG - Intergenic
1061327540 9:129873525-129873547 GTTAGGGAGAAGGCGGGGGAAGG - Intronic
1061373238 9:130209627-130209649 GTTGGGGAAGAGAAGGTGGGAGG + Intronic
1061481303 9:130898866-130898888 TTTGGGGGGCAGAGGAGGGAAGG - Intergenic
1061481382 9:130899085-130899107 GTAGGGGGGCAGAGGAGGGAGGG - Intergenic
1061848259 9:133400286-133400308 GTGGGTGAATAGAAGGGGGAAGG - Intronic
1062028639 9:134352114-134352136 GCTGGGGTGCAGCAAGGGGAGGG + Intronic
1062143719 9:134976696-134976718 GATGGGGAGGGGAAGGGGGAGGG - Intergenic
1062204686 9:135329474-135329496 GGTGGGGAGCAGAAGAAGGGAGG + Intergenic
1062271889 9:135713651-135713673 GCAGGAGAGCAGAGGGGGGATGG - Intronic
1062284614 9:135767559-135767581 GTTGGGGTGCAGGAGGGAGGGGG - Intronic
1062407293 9:136403080-136403102 GGTGGGGGGCAGAAAGGGGAGGG + Intronic
1062449137 9:136608255-136608277 GAAGGAGAGGAGAAGGGGGAAGG + Intergenic
1062469733 9:136697064-136697086 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1062489864 9:136799857-136799879 GTTGCGGAGCCGACGAGGGACGG + Intronic
1062547143 9:137068989-137069011 GTGGGGGAGCAGTACAGGGAGGG + Intronic
1185581203 X:1212899-1212921 GAGGGGGAGGAGATGGGGGAGGG - Intergenic
1185603620 X:1355037-1355059 GAAGGGGAGCAGATGGAGGAAGG + Intronic
1185640510 X:1587844-1587866 GGAGGGGAGGGGAAGGGGGAGGG - Intergenic
1185756639 X:2659146-2659168 GGAGGGGAGGGGAAGGGGGAAGG - Intergenic
1185793481 X:2945271-2945293 GGTGGGGAGGACAAGGGGGTTGG + Intronic
1186409036 X:9329622-9329644 GTTGGGGAGTGGAAGAGGAATGG - Intergenic
1186410597 X:9342275-9342297 GGTGGGAAGGAGCAGGGGGAGGG - Intergenic
1186410644 X:9342394-9342416 GGAGGGGAGAAGGAGGGGGAGGG - Intergenic
1186733338 X:12433910-12433932 GGTGGAGAGAAGAAGGGGTAGGG + Intronic
1187547414 X:20267150-20267172 GTTGGGGCGCAGAAGGAGGGGGG - Intergenic
1187668397 X:21641902-21641924 GTGGGAGAACAGAAGGGGAAAGG + Intronic
1188000313 X:24974248-24974270 GTTGGGGAGAAGCAGGAGGGAGG + Intronic
1188050251 X:25475856-25475878 GCTGGAGAACAGAATGGGGAAGG - Intergenic
1188518394 X:31011872-31011894 GTTGGGCAGGAGAAGGAGGCAGG + Intergenic
1188724276 X:33562286-33562308 GAAGAGGAGCAGGAGGGGGAGGG - Intergenic
1189244736 X:39554728-39554750 TTTGAGGAGCAGCAGGGGAAAGG - Intergenic
1189325058 X:40106853-40106875 GTTGGGGAGGGGGAGTGGGAGGG - Intronic
1189446389 X:41085254-41085276 GCTGGGCAGGAGCAGGGGGAGGG + Intergenic
1189866059 X:45328492-45328514 GTTGGGGTGGAGATGGGGCATGG - Intergenic
1190793438 X:53721102-53721124 GATGGGGAGGGGGAGGGGGAGGG - Intergenic
1190882290 X:54500409-54500431 GCTTGGGAGAAGGAGGGGGAGGG + Intergenic
1191129853 X:56995794-56995816 GGTGGAAAGCAGAAGGGGCAGGG - Intergenic
1191803321 X:65105257-65105279 GTGGGGGACAAGAAGAGGGAGGG + Intergenic
1192368562 X:70495351-70495373 GACGGGGAGAAGAGGGGGGAAGG - Intronic
1192434271 X:71133225-71133247 GCTGGGGAGAAGAAGGAAGAGGG + Intronic
1192715196 X:73633222-73633244 GTGGGGGGGCAGTGGGGGGAGGG - Intronic
1192868704 X:75164257-75164279 GTTGGAAAGCAGAAGGTGAAAGG - Intergenic
1192956460 X:76075932-76075954 GTTGGGGAGCAGAAAGTTGAGGG - Intergenic
1193698582 X:84738546-84738568 GTTGCAGAGCATTAGGGGGAGGG - Intergenic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1193895145 X:87104794-87104816 GTTGGAGAGCAGAATAGGGCTGG + Intergenic
1193975273 X:88110749-88110771 GTTGGGGAGGGAAAGGGGGAGGG - Intergenic
1194411884 X:93567754-93567776 TTTGGGGGGAAGAAGTGGGAGGG - Intergenic
1194765415 X:97842661-97842683 GTGGCAGAGCAGAAGCGGGAGGG - Intergenic
1194834449 X:98664139-98664161 TGTGGGGAGCAGGTGGGGGAGGG - Intergenic
1194854002 X:98906141-98906163 GTTGGGGGGCGGTGGGGGGAGGG - Intergenic
1194992944 X:100564164-100564186 GAAGGGGAGGGGAAGGGGGAAGG + Intergenic
1195007833 X:100703924-100703946 CTTGGGGAGTAGAATTGGGAAGG + Intronic
1195778992 X:108439912-108439934 TTTGGGGAGGGGAGGGGGGAAGG + Exonic
1196251550 X:113465958-113465980 GTTTGGGAAGAGAAAGGGGAGGG + Intergenic
1196398701 X:115291556-115291578 GTAGGGGAGCAGAGCAGGGAGGG + Intronic
1197039127 X:121913908-121913930 GCTGGGGAGCATATGGGGAAAGG + Intergenic
1197160179 X:123314035-123314057 GTTGGGTGGCAGTGGGGGGAAGG - Intronic
1197219973 X:123902938-123902960 TGTGGGGAGGAGAAGGGGAAAGG + Intronic
1197742152 X:129903464-129903486 GCTGTGGAGCATAAGGGGGAGGG + Intergenic
1197854638 X:130902394-130902416 GATGGGAAGCAAAAGAGGGAAGG - Intronic
1199524976 X:148781980-148782002 GATGGCGAGCAGAAGCAGGATGG - Intronic
1200010001 X:153113745-153113767 TTTGAGAACCAGAAGGGGGAAGG - Intergenic
1200029599 X:153286177-153286199 TTTGAGAACCAGAAGGGGGAAGG + Intergenic
1200062258 X:153488845-153488867 GGTGGGGAGGAGAAGGGGAGGGG + Intronic
1200105699 X:153710865-153710887 ATCGGGGAGCAGAAGGAAGAGGG - Intronic
1200123575 X:153802715-153802737 GTTGGGGAGGAAGAGTGGGAGGG - Exonic
1200360847 X:155604536-155604558 GCTTGGGAGCAGCAGGGGCAGGG - Intronic
1201260027 Y:12149848-12149870 GTTGGGAAACAGAAGCTGGATGG + Intergenic
1201300269 Y:12498827-12498849 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1201948143 Y:19535185-19535207 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1202379261 Y:24261494-24261516 GAGGGGCAGCAGAAGGGTGAAGG - Intergenic
1202491521 Y:25408627-25408649 GAGGGGCAGCAGAAGGGTGAAGG + Intergenic