ID: 1193847049

View in Genome Browser
Species Human (GRCh38)
Location X:86485412-86485434
Sequence GTACAAACCTACAGTTAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1231
Summary {0: 1, 1: 14, 2: 65, 3: 275, 4: 876}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193847041_1193847049 30 Left 1193847041 X:86485359-86485381 CCAGAGAATGGGGAGGGCAGGCT 0: 1
1: 0
2: 3
3: 31
4: 358
Right 1193847049 X:86485412-86485434 GTACAAACCTACAGTTAGATAGG 0: 1
1: 14
2: 65
3: 275
4: 876

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193847049 Original CRISPR GTACAAACCTACAGTTAGAT AGG Intronic
900904058 1:5538248-5538270 GTACAAAGTTACAGTGAGATAGG + Intergenic
902027737 1:13396275-13396297 GTACAAAAATGCAGTTAGGTAGG - Intergenic
904955237 1:34277718-34277740 ATACATAATTACAGTTAGATAGG + Intergenic
905839756 1:41164992-41165014 GTAGAAACTTATAGTTAGATAGG - Intronic
906220303 1:44073134-44073156 GTAAAAAGGTACAGTAAGATGGG + Intergenic
906549464 1:46650897-46650919 ATACAAAAGTACAGCTAGATGGG + Intronic
906764997 1:48421080-48421102 GTACAAGATTACAGTTAGATAGG + Intronic
906816246 1:48882723-48882745 GTACAAATTTTCAGTTAGACAGG - Intronic
906957233 1:50384746-50384768 GCACAAAGTTACAGTAAGATAGG - Intergenic
907024186 1:51099074-51099096 ATACAAACATACAGTTAGATAGG + Intergenic
907086927 1:51683958-51683980 GTACAAAGTTTCAGTTAGACAGG + Intronic
907572740 1:55498815-55498837 ACACATACCTACAGTTACATGGG - Intergenic
907796009 1:57717991-57718013 GTACAAATTTACAGATAGATAGG + Intronic
907797859 1:57735351-57735373 CTTCAAACCTCCAGTGAGATAGG - Intronic
907811831 1:57878777-57878799 ATACAAAATTACAGCTAGATAGG - Intronic
908012651 1:59796499-59796521 ATACAAACTTACAGCTAGATAGG + Intergenic
908258734 1:62322806-62322828 TTCCAAGCCTACAGTTAGAGAGG - Intergenic
908505828 1:64799035-64799057 TTACAAAACTATAGCTAGATAGG - Intronic
908625428 1:66035430-66035452 GTACAAAGTTATAGTTAGATAGG - Intronic
908684550 1:66700781-66700803 GTACAAAATTACAACTAGATAGG - Intronic
909029258 1:70520177-70520199 TTTCAAAATTACAGTTAGATTGG + Intergenic
909064404 1:70917133-70917155 GTACAAAGTTACAATTAGACAGG - Intronic
909346637 1:74596580-74596602 GTACAAAGTTACAGTTAGACAGG - Intronic
909516441 1:76512670-76512692 GTACAAAGTTACAATTAGACAGG - Intronic
909716025 1:78706951-78706973 ATACAAAGTTATAGTTAGATAGG + Intergenic
909869184 1:80718023-80718045 ATACAAAATTACAGCTAGATAGG - Intergenic
910008436 1:82430136-82430158 CTACAAATATATAGTTAGATGGG + Intergenic
910198368 1:84669953-84669975 ATACAAACTTTCAGTTAGATAGG + Intronic
910576413 1:88769841-88769863 GTACATACTTAGAGTTAGGTAGG + Intronic
910611708 1:89151162-89151184 GTACAAACTTGAAGTTATATAGG - Intronic
910721433 1:90290616-90290638 ATACAAACTTACAGCTAGATAGG + Intergenic
910734193 1:90434155-90434177 GTAAAAAATTTCAGTTAGATAGG - Intergenic
910763106 1:90754626-90754648 GTACAAAATTACAGTTAGGAAGG - Intergenic
910840704 1:91558732-91558754 ATACAAAAATACAGCTAGATAGG - Intergenic
911162651 1:94697026-94697048 ATACAAAGTTACTGTTAGATAGG + Intergenic
911279702 1:95908692-95908714 GTACAAAATTACAGCTAAATAGG - Intergenic
911465601 1:98249219-98249241 GTGCAAAGTTACAGTTAGACAGG + Intergenic
911685241 1:100768251-100768273 ATACAAAATTACAGCTAGATAGG + Intergenic
911717145 1:101146206-101146228 ATACAAAATTACAGCTAGATAGG - Intergenic
912016649 1:105046323-105046345 ATACAAAATTACAGTTAGACAGG - Intergenic
912059366 1:105646501-105646523 CTACACACCTACAGTAATATTGG + Intergenic
912132201 1:106617376-106617398 ATATAAACCTACAGGTAGTTGGG - Intergenic
912205866 1:107508947-107508969 GTACAAACATACAGTTAGATAGG + Intergenic
912592688 1:110842211-110842233 ATACAAAGTTACGGTTAGATAGG - Intergenic
912831977 1:112961031-112961053 GTACAAAGTGACAATTAGATTGG - Intergenic
912909167 1:113739677-113739699 ATACAAAAGTACAGCTAGATAGG - Intronic
913148751 1:116018856-116018878 ATACAAAATTACAGCTAGATAGG - Intronic
914979139 1:152397452-152397474 ATACAAAATTACAGCTAGATAGG + Intergenic
915010188 1:152678203-152678225 GTAAAAACCAATAGTCAGATTGG - Intergenic
915048233 1:153038541-153038563 GTACAAAGTTACAGTTAAACGGG - Intergenic
915774632 1:158469381-158469403 GTACAAAATTTCAGTTAGATAGG - Intergenic
915783782 1:158584380-158584402 GTACAAAGATATAATTAGATGGG + Intergenic
916621690 1:166504754-166504776 GTACAAAGTTACAATTAGAAAGG + Intergenic
916714459 1:167437747-167437769 GTACAAAGCCTCAATTAGATAGG + Intronic
916794724 1:168155107-168155129 ATACAAAGTTACAGTTAGATAGG - Intergenic
916805728 1:168259227-168259249 ATACAAAGTTTCAGTTAGATAGG - Intergenic
916990890 1:170243611-170243633 ATACAAAATTACAGCTAGATGGG - Intergenic
917044828 1:170847907-170847929 ATACATAAATACAGTTAGATAGG - Intergenic
917154372 1:171980555-171980577 ATACAAAAGTACAGCTAGATAGG - Intronic
917174902 1:172223178-172223200 ATACAAAGTTACAGTTAGACAGG - Intronic
917319701 1:173767010-173767032 GTACAAAATTTCAGTTAGAGAGG - Intronic
917341637 1:173985734-173985756 ATACAAAGCTTCAGTTAGACTGG - Intronic
917401753 1:174657347-174657369 GTACAAAATTACAGCTAAATGGG - Intronic
917446500 1:175109386-175109408 GTTTAAAAATACAGTTAGATAGG - Intronic
917559172 1:176127306-176127328 GTACAAAGTTATAGTTAGACAGG - Intronic
918191205 1:182176369-182176391 GTACAAAGTTTCAGTTAGACAGG - Intergenic
918502083 1:185208394-185208416 ATAAAAAGCTACAGTTAGATAGG + Intronic
918503289 1:185222883-185222905 GTACAAAGTTACAATTAGATAGG - Intronic
918578736 1:186099043-186099065 GTACAAAGTTACAATTAGAAAGG + Intronic
918676154 1:187288716-187288738 GTACAAAGTTCCAGTTAGATAGG - Intergenic
918807271 1:189065162-189065184 GTACAAAGTTATAGTTAGACGGG - Intergenic
918812299 1:189138106-189138128 ATACATATTTACAGTTAGATAGG - Intergenic
918835831 1:189464493-189464515 ATAGAAAACTACAGTTAGATAGG - Intergenic
919036649 1:192319356-192319378 GTACACACATACATATAGATTGG - Intronic
919224148 1:194672864-194672886 GTATAAAAATAAAGTTAGATTGG - Intergenic
919284213 1:195532588-195532610 GTACAAAAGTACAGTTAAATAGG + Intergenic
919512148 1:198478451-198478473 GTACAAAAATATAGTTAAATAGG + Intergenic
919512638 1:198485229-198485251 ATACAAAATTATAGTTAGATAGG + Intergenic
920025734 1:202994137-202994159 GTACAAAGCTGTAGTTAGATAGG - Intergenic
920595564 1:207266310-207266332 GTACAAATTTGCAGTTAAATTGG - Intergenic
920755299 1:208724885-208724907 GTACAAAAATACAGTTAGATAGG - Intergenic
920944762 1:210518193-210518215 GTACAAAGTTTCAATTAGATAGG - Intronic
920995954 1:210991489-210991511 GTACAAAGTTTCAGTTAGACAGG + Intronic
921617752 1:217291351-217291373 GTACAAAATTACAGTTAGATAGG - Intergenic
922138230 1:222853781-222853803 ATACAAAATTACAGCTAGATAGG + Intergenic
922938747 1:229442433-229442455 GTATAAATCTAAAATTAGATAGG + Intronic
923173287 1:231437475-231437497 ATACAAAATTACAGCTAGATAGG + Intergenic
923401845 1:233623322-233623344 ATACAAAATTACAGCTAGATAGG + Intronic
923453620 1:234143152-234143174 GTACAGAGTTGCAGTTAGATAGG - Intronic
923932637 1:238720251-238720273 GTACATAATTACAATTAGATAGG + Intergenic
923941362 1:238831206-238831228 GTACAAACTTGTAGTTAAATTGG + Intergenic
924192459 1:241567998-241568020 GTACAAACTTTAAGTTAGACAGG - Intronic
924589076 1:245386363-245386385 GTACAAAGCCTCAGTTAGATAGG - Intronic
1063076985 10:2727153-2727175 GTACAAACATTCAGTTAGATGGG - Intergenic
1063348317 10:5332390-5332412 GTACGGAGTTACAGTTAGATGGG - Intergenic
1063740641 10:8815100-8815122 GTACAAAATTTCACTTAGATAGG - Intergenic
1065031339 10:21589394-21589416 CTACAAAGCTACAGTGAGCTAGG - Intronic
1065078750 10:22107199-22107221 GTACAAAATTTCAGTTAGACAGG - Intergenic
1065083116 10:22146615-22146637 ATACAAAATTACAGCTAGATAGG - Intergenic
1065248121 10:23780379-23780401 GTACAAAGTTTCAGTTATATAGG - Intronic
1065269977 10:24019077-24019099 GTACAAAGTTTCAGTTAGACAGG + Intronic
1065343477 10:24726227-24726249 GTACAAACAAAAAGTTAGCTGGG + Intergenic
1065705323 10:28466905-28466927 GTACAAAGTTACAATTAGATAGG + Intergenic
1065764858 10:29019064-29019086 GTACAAAGTTACTGTTAGATTGG + Intergenic
1065986330 10:30956513-30956535 GTGCAAACCTACAGTCACATAGG - Intronic
1066013071 10:31211938-31211960 GTACAAAGTTGCAGTTATATAGG - Intergenic
1066111668 10:32202782-32202804 ATACAAAATTACAGCTAGATAGG - Intergenic
1066163809 10:32763853-32763875 GCACAAAATTTCAGTTAGATAGG + Intronic
1066621174 10:37352612-37352634 ATACAAACCCACAGTTGGAAAGG - Intronic
1066621791 10:37362910-37362932 GTACAAAGTTATAGTTAGATAGG - Intronic
1067026856 10:42849966-42849988 ATACCAAATTACAGTTAGATAGG + Intergenic
1067304859 10:45053491-45053513 TTACAAAATTTCAGTTAGATAGG - Intergenic
1067827228 10:49585624-49585646 GTACAAAGTTACAGTTAGATTGG + Intergenic
1068019500 10:51563192-51563214 GTACAAAATTACAGCTAGATAGG + Intronic
1068408368 10:56623456-56623478 GTACAAACCTACCTTTGTATTGG - Intergenic
1068640993 10:59407671-59407693 GTGCAAAGTTACAGTTATATAGG - Intergenic
1068669197 10:59707457-59707479 ATACAAAATTTCAGTTAGATAGG + Intronic
1068750165 10:60583394-60583416 GTATAAAGCTATAGTCAGATAGG + Intronic
1068795653 10:61076744-61076766 ATACAAAATTACAGCTAGATAGG - Intergenic
1069229280 10:65988071-65988093 GTACAAAAATACAGTTATATAGG + Intronic
1069328923 10:67266694-67266716 GTACAAAGTTTCAGCTAGATAGG + Intronic
1069824470 10:71246606-71246628 GGACAAACTGACAGTTGGATGGG + Intronic
1070049371 10:72872351-72872373 GTACAAAATTACAGTTAGATAGG - Intronic
1070098818 10:73365673-73365695 ATACAAAGTTACAGTTAGATAGG + Intergenic
1070170670 10:73930390-73930412 GGTCAAAGTTACAGTTAGATAGG + Intergenic
1070566780 10:77609468-77609490 GTACAAACTTTCAGTTAAACAGG + Intronic
1070822961 10:79373528-79373550 GTACCAAATTACAGTTAGATAGG + Intergenic
1070855064 10:79601653-79601675 GTACAAAATTACAGCTAGATAGG + Intergenic
1070935239 10:80289027-80289049 GTACGAAGTTACAGTCAGATAGG + Intronic
1071259361 10:83906051-83906073 GTTCAAGACTACAGTTAGCTAGG + Intergenic
1071261337 10:83921997-83922019 ATACAAAATTTCAGTTAGATGGG + Intergenic
1071541804 10:86491973-86491995 GTACATACTTGCAGTTACATAGG - Intronic
1071805176 10:89111669-89111691 GTACAAAATTTCAGTTAAATAGG - Intergenic
1071919466 10:90333053-90333075 ATACAAAATTTCAGTTAGATAGG - Intergenic
1072363503 10:94684301-94684323 GTACAGAGTTACACTTAGATAGG - Intronic
1072401096 10:95101225-95101247 CCACAAAGTTACAGTTAGATAGG + Intergenic
1072860759 10:99002976-99002998 ATACAAAATTTCAGTTAGATAGG - Intronic
1073557846 10:104470657-104470679 GTAAAAAGTTACAGTTAGACAGG - Intergenic
1073665499 10:105528193-105528215 GTACAAAGTTTCAGTTAGATTGG + Intergenic
1073712655 10:106062300-106062322 ATACACAATTACAGTTAGATAGG - Intergenic
1073813123 10:107173259-107173281 GTACAAAGTTACAGTTATATAGG + Intergenic
1073997348 10:109330925-109330947 GTACAAAGCTACAGTTAGAGAGG - Intergenic
1074173449 10:110970146-110970168 ACACAAAACTACAGCTAGATAGG - Intronic
1074630392 10:115248064-115248086 ATACAAAATTACAGCTAGATAGG + Intronic
1074644133 10:115424846-115424868 ATACAAAGTTACAGTTAGATAGG + Intronic
1074655031 10:115575854-115575876 GTACAAACTTGAAGTTAGGTAGG - Intronic
1074683784 10:115938889-115938911 GTACAAAGTTTCAGTTAGACTGG + Intronic
1074737878 10:116454528-116454550 GTACAAAGCTTCAGTTACACAGG - Intronic
1074911741 10:117916350-117916372 GTGCAAAGTTACAGTTAGATAGG + Intergenic
1075232446 10:120692444-120692466 ATACAAAGTTACAGTTGGATGGG - Intergenic
1075480058 10:122772541-122772563 GTACAAAGTTTCAGTTAGATAGG - Intergenic
1075829643 10:125396660-125396682 TTATAAAACTACAGCTAGATAGG - Intergenic
1075891821 10:125958149-125958171 ATACAAAATTACAGCTAGATAGG - Intronic
1075962101 10:126577034-126577056 ATACAAAATTACAGCTAGATAGG + Intronic
1076646529 10:131958245-131958267 GTACACACCTTCATCTAGATAGG - Intronic
1077928979 11:6710813-6710835 ATACAAAATTACAGCTAGATAGG - Intergenic
1078481894 11:11684323-11684345 ATACAAAATTTCAGTTAGATAGG + Intergenic
1078971327 11:16415427-16415449 ATACAAAATTACAGCTAGATAGG + Intronic
1079202896 11:18390603-18390625 GTGCAAAAATACAGTTAGATAGG - Intergenic
1079254333 11:18813804-18813826 GTACAAAGCTTCAGTTGGACTGG - Intergenic
1079274741 11:19024736-19024758 GTACAAAGTTTCAGTAAGATGGG - Intergenic
1079278719 11:19068225-19068247 ATACAAAATTACAGCTAGATAGG - Intergenic
1079662502 11:23057538-23057560 GTACAAAGTTACAGTTACATAGG + Intergenic
1079677987 11:23256064-23256086 GTACAAAAATATAGTTAGAAAGG + Intergenic
1079793501 11:24769273-24769295 GTACAAAGTTAAAGTTAGGTAGG + Intronic
1079839524 11:25378851-25378873 GTTCAAAGCCACAGTTAAATAGG - Intergenic
1079954091 11:26841302-26841324 GCACAAAGTTTCAGTTAGATAGG + Intergenic
1080174567 11:29346435-29346457 ATACAAAGTTTCAGTTAGATAGG + Intergenic
1080242855 11:30147153-30147175 GTACAAATATACAGTTAGGCTGG - Intergenic
1080645634 11:34185709-34185731 GTACAAAGTTGTAGTTAGATTGG + Intronic
1080985844 11:37464142-37464164 GTACAAAGTTACAGATAGATGGG + Intergenic
1081036490 11:38153247-38153269 GTACAAACATGCAGTTAGATAGG + Intergenic
1081134785 11:39426751-39426773 ATACAAAACTACAATTAGACAGG + Intergenic
1081253596 11:40865335-40865357 GTACAAAATTACAGTTAGATAGG + Intronic
1081902210 11:46638537-46638559 GTACAAGGCCACAGTTAGATAGG - Intronic
1082229976 11:49751844-49751866 GAACAAAATTACAGTTAGATAGG - Intergenic
1082257329 11:50045321-50045343 ATACAAAATTTCAGTTAGATTGG - Intergenic
1082666686 11:55983143-55983165 GTACAAACGTACAGTCAGATAGG + Intergenic
1082740856 11:56909326-56909348 GTACAAAGTTACAGCTAGACCGG - Intergenic
1082830793 11:57615574-57615596 GACCAAACCTAGAGTTAGACTGG + Intergenic
1082901641 11:58260468-58260490 ATACAAAATTACAGCTAGATGGG - Intergenic
1083014142 11:59435071-59435093 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1083046884 11:59744676-59744698 GTGCAAAAATACAGTTAGATAGG + Intronic
1083489176 11:63002478-63002500 GTACAAAGTTTCAGCTAGATGGG - Intronic
1083520475 11:63306193-63306215 GTACAAAGCTACAGTTTGTTAGG - Intronic
1083914921 11:65735713-65735735 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1083982798 11:66187408-66187430 GTACAAAATTACAGCTAGATAGG - Intronic
1084078387 11:66800268-66800290 GTACAAAGTTTCAGTTAGACAGG + Intronic
1085376760 11:76070334-76070356 ATACAAATTTGCAGTTAGATAGG + Intronic
1086330053 11:85744936-85744958 GTACAAATGTACATTTTGATTGG + Intronic
1086620084 11:88877105-88877127 GAACAAAATTACAGTTAGATAGG + Intronic
1086720621 11:90116811-90116833 ATACAAAATTACAGTTAGGTAGG + Intergenic
1086749900 11:90478805-90478827 GTGCAAAGTTACAGTTAGATAGG + Intergenic
1086852866 11:91831493-91831515 GTACAAAGCTGCAGTTTTATAGG + Intergenic
1086986261 11:93252520-93252542 ATACAAAAATACAGTTAGATAGG - Intergenic
1087089817 11:94257395-94257417 GTACAAAATTATAGTCAGATGGG - Intergenic
1087258491 11:95983443-95983465 ATACAAAATTACAGCTAGATAGG + Intronic
1087284511 11:96250501-96250523 ATACAAAATTACAGCTAGATAGG - Intronic
1087339411 11:96883686-96883708 ATACAAAATTACAGCTAGATAGG + Intergenic
1087503316 11:98987956-98987978 GTACAAACATTCAGTTAGTTAGG - Intergenic
1087505168 11:99011789-99011811 GTACAAACTTGCAGTTATGTAGG + Intergenic
1087550599 11:99642701-99642723 GTACAAAGTTATAGTTAGACAGG - Intronic
1087551044 11:99648946-99648968 ATACACAACTACAGCTAGATTGG + Intronic
1087679691 11:101205749-101205771 ATACAAAATTACAGCTAGATAGG - Intergenic
1088067769 11:105741892-105741914 GTACAAACTTGCAGTTATGTAGG + Intronic
1088389161 11:109294730-109294752 GTATAAGCATACAGTTAGATAGG + Intergenic
1088432250 11:109771560-109771582 GTACAAAGTTACAGTTAGACAGG - Intergenic
1088441312 11:109873977-109873999 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1088443611 11:109899987-109900009 TTACAAAGCCACAGTTAGGTAGG + Intergenic
1088547781 11:110978298-110978320 GTACAAAGTTACAGTTAGATAGG + Intergenic
1088571306 11:111226444-111226466 ATACAAAATTACAGCTAGATAGG + Intergenic
1088946652 11:114520216-114520238 GTACAAACTTGCAGTTCTATTGG - Intergenic
1089934376 11:122348607-122348629 GTGCAAAATTACAGATAGATAGG - Intergenic
1090302230 11:125652914-125652936 ATACAAAATTACAGCTAGATAGG - Intronic
1090500935 11:127260211-127260233 ATGCAAAATTACAGTTAGATGGG + Intergenic
1090877048 11:130799695-130799717 ATACAAAGTTACAGCTAGATAGG - Intergenic
1092496921 12:9005617-9005639 ATACAAAATTACAGCTAGATAGG + Intronic
1092632538 12:10397987-10398009 GTACAAAGTTATAGTTAGGTAGG - Intronic
1092759913 12:11800515-11800537 ATACAAAACGTCAGTTAGATGGG - Intronic
1092853862 12:12654765-12654787 GTACAAAACTCCAGTGAGATAGG - Intergenic
1093072443 12:14721026-14721048 GTAAAAAGGTACAGTTAGACAGG - Intergenic
1093389465 12:18601509-18601531 ATACAAAATTACAGCTAGATAGG + Intronic
1093509788 12:19913019-19913041 GTACAAAGTTTCAGTTAGACTGG - Intergenic
1093678226 12:21968866-21968888 ATACAAAGCTACAGGTAGATAGG + Intergenic
1093801923 12:23383812-23383834 GTACAAAATTTCAGTTAGACTGG + Intergenic
1093982924 12:25494951-25494973 GTACAAAGCTTCAGTTAAACAGG - Intronic
1094417057 12:30228354-30228376 GTCCAAAGTTTCAGTTAGATAGG - Intergenic
1095156028 12:38855609-38855631 GTACAAAATTTCAGTTAGACAGG + Intronic
1095281532 12:40357029-40357051 GTACAAACATACAGTTAGATAGG - Intronic
1095499510 12:42821265-42821287 GTACAAAATTACAGTTAGATAGG - Intergenic
1095649598 12:44591649-44591671 ATACAAAATTACAGCTAGATAGG + Intronic
1096011000 12:48214673-48214695 ATACAAACTTTTAGTTAGATGGG - Intergenic
1096889474 12:54753629-54753651 GTACAAAAATACAGTTAAAAGGG - Intergenic
1097022567 12:56030824-56030846 GTACAAGATTACAGTTAGATGGG + Intronic
1097210338 12:57363470-57363492 ATACAAAACTATAGCTAGATAGG + Intronic
1097506025 12:60471706-60471728 GTATAAAGTTACAGTTAGCTAGG - Intergenic
1097569203 12:61310540-61310562 ATACAAAACTACAGCTAGATAGG + Intergenic
1097676686 12:62610623-62610645 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1097805812 12:63963642-63963664 GTAAAAAATTACAATTAGATTGG - Intronic
1097836521 12:64278704-64278726 GTACAAAACTTCAGTTAGACAGG - Intronic
1097976059 12:65687680-65687702 GTACAAAGCTACAATTAAATAGG + Intergenic
1098238929 12:68446174-68446196 ATACAAAATTACAGGTAGATAGG + Intergenic
1098518584 12:71408654-71408676 GTACAAAGCTTCAGTTAGGCAGG + Intronic
1098531736 12:71549328-71549350 GTACAAAGCTTCAGTTAGACAGG + Intronic
1098555893 12:71818322-71818344 GTATAAAATTCCAGTTAGATAGG + Intergenic
1098569945 12:71977005-71977027 GTACAAAGTTGCAGTTAGATAGG + Intronic
1098713830 12:73802781-73802803 ATACAAAATTACAGCTAGATAGG - Intergenic
1099007693 12:77253875-77253897 GTGCAAAATTACAGCTAGATAGG + Intergenic
1099196163 12:79618539-79618561 GTGCAAAGTTACAGTTAGATAGG - Intronic
1099539430 12:83887858-83887880 GTACAAACTTGCAGTTATATGGG - Intergenic
1099749824 12:86758991-86759013 GTGCAAAGCTACAGTTAGGTAGG - Intronic
1099950753 12:89300170-89300192 GTACAAAGTTACAGTTAGATAGG + Intergenic
1099993775 12:89754369-89754391 GTACACATTTACAGTTAGATAGG + Intergenic
1100146931 12:91689850-91689872 ATACAAAATTACAGCTAGATAGG + Intergenic
1100193176 12:92214933-92214955 ATACAAAATTACAGCTAGATAGG - Intergenic
1100341698 12:93685319-93685341 ATACAAAATTACAGCTAGATGGG + Intronic
1100666113 12:96755426-96755448 GTACAAAGTTTCAGTTAAATGGG - Intronic
1101042058 12:100765981-100766003 GTACAAAATTTCAATTAGATAGG - Intronic
1101395653 12:104344678-104344700 ATATAAAACTACAGCTAGATAGG - Intronic
1102733283 12:115133936-115133958 GTACAAAATCACAGCTAGATAGG + Intergenic
1103047367 12:117748327-117748349 GTACAAAGTTTCAGTTAGATAGG + Intronic
1104516824 12:129434916-129434938 ATACAAAGTTACAGTAAGATGGG - Intronic
1105252447 13:18711927-18711949 ATACGAACTTACAGCTAGATAGG - Intergenic
1105689201 13:22818954-22818976 GTACAAAGTTACAATTTGATAGG - Intergenic
1105763848 13:23538344-23538366 CTACAAACCTTCAGCTAGAATGG - Intergenic
1105780888 13:23704600-23704622 ATACAAAATTACAGCTAGATAGG - Intergenic
1105816975 13:24044934-24044956 GTACAAAGTTACAGTTAGATAGG + Intronic
1106220060 13:27739089-27739111 ATACAAAATTACAGCTAGATAGG + Intergenic
1106448167 13:29855152-29855174 GTACAAAATTCCAGTTAGACAGG + Intergenic
1106644765 13:31620699-31620721 GTACAAAGGTACAATTAGATAGG - Intergenic
1106961319 13:35001721-35001743 TTACAAAATTACATTTAGATAGG + Intronic
1107106966 13:36654319-36654341 GTACAAAGTTACAATTAGAAAGG - Intergenic
1107112538 13:36713404-36713426 GTACAAAGTTACAGTTAAACAGG - Intergenic
1107177772 13:37419800-37419822 GTACAAAGTTTCAGTTAGACTGG + Intergenic
1107210474 13:37847916-37847938 GTACAAAGTTTCAGATAGATAGG + Intronic
1107543859 13:41418315-41418337 GTACAAAGTTACAGTTAGACAGG + Intergenic
1107664685 13:42676652-42676674 GTACAAAAATATAGTTAGATAGG - Intergenic
1108027426 13:46192707-46192729 GTACAAAATTTCAGTTAGACAGG + Intronic
1108451073 13:50563713-50563735 ATACAAAATTTCAGTTAGATAGG - Intronic
1108974502 13:56421536-56421558 ATACAAAGTTACAGCTAGATAGG - Intergenic
1109015607 13:57008793-57008815 GTACAAATCTTCAGTTAGATAGG + Intergenic
1109031688 13:57198785-57198807 GTCCAAACCTATAGAAAGATAGG - Intergenic
1109179100 13:59191627-59191649 ATACAAAATTTCAGTTAGATGGG - Intergenic
1109425381 13:62160238-62160260 GTACAAACTTGCAGTTATGTAGG + Intergenic
1109479884 13:62937199-62937221 GTACAAAGTTACAATTAGACAGG + Intergenic
1109604286 13:64671918-64671940 ATACAAAATTACAGCTAGATAGG - Intergenic
1109615113 13:64823794-64823816 GTACAATGTTACAATTAGATAGG + Intergenic
1109662493 13:65482293-65482315 GTACAAAGTTTCAGTTAGAGAGG - Intergenic
1109874981 13:68389845-68389867 ATACAAAATTTCAGTTAGATAGG - Intergenic
1110118996 13:71858627-71858649 TTACAAAATTTCAGTTAGATAGG - Intronic
1110192188 13:72743045-72743067 GTACAAAGTTTCAGTTAGACAGG + Intronic
1110264951 13:73527050-73527072 ATACAAAATTACAGCTAGATAGG + Intergenic
1110724316 13:78802046-78802068 ATACAAAATTACAGTTAGATAGG - Intergenic
1110952143 13:81508706-81508728 GTACCAAGATACAATTAGATAGG - Intergenic
1110952206 13:81509722-81509744 GTACAAAGATACAATTAGATAGG + Intergenic
1111037822 13:82702793-82702815 GTACAAAGTTGCAGTTAGGTAGG - Intergenic
1111078500 13:83270513-83270535 GTACAAAGTTACAGTTAGACAGG + Intergenic
1111178533 13:84631384-84631406 GCACAAAGCCTCAGTTAGATTGG - Intergenic
1111309283 13:86460526-86460548 GTACAAAGTTTCAGTTAGACTGG + Intergenic
1111447392 13:88365412-88365434 GTACAAAGTTACAGTTAAATGGG - Intergenic
1111501443 13:89126115-89126137 GTACAAAGTTACAGTTAGAAAGG + Intergenic
1111555700 13:89878881-89878903 GTACAAAGTTGCAGTTATATTGG - Intergenic
1111556774 13:89890982-89891004 ATACAAAATTACAGCTAGATAGG + Intergenic
1111602365 13:90491157-90491179 GTACAAAGTTACAATTAAATAGG - Intergenic
1112202172 13:97287608-97287630 GTAGAAAATTACAGCTAGATCGG - Intronic
1112683342 13:101793128-101793150 ATACAAAGCCTCAGTTAGATAGG - Intronic
1112718683 13:102216757-102216779 GTACTAAGCTATGGTTAGATAGG - Intronic
1113626034 13:111847430-111847452 GTACAAACTTTCAGCTAGACAGG - Intergenic
1114274820 14:21133253-21133275 ATACAAAATTTCAGTTAGATAGG + Intergenic
1114735428 14:25038896-25038918 ATACAAATTTTCAGTTAGATAGG + Intronic
1115058046 14:29154838-29154860 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1115078905 14:29426660-29426682 ATACTAAGTTACAGTTAGATAGG - Intergenic
1115131636 14:30059864-30059886 GAACAAAGTTACAGTTAGACAGG - Intronic
1115364541 14:32543149-32543171 ATACAAAATTACAGCTAGATAGG - Intronic
1115392595 14:32870031-32870053 GTACAAACATACAGTATGATAGG - Intergenic
1115691467 14:35848565-35848587 GTACAAAATTTCAGTTAGACAGG - Intronic
1115695221 14:35890578-35890600 GTATAAACACACAGTTAGATAGG - Intronic
1115947519 14:38678920-38678942 ATACAAAATTACAGCTAGATGGG - Intergenic
1115952996 14:38742517-38742539 GTACAAAGTTACAGTTAGACAGG + Intergenic
1116024640 14:39500255-39500277 GTACAAAGTTACAATTAGATAGG - Intergenic
1116096958 14:40382423-40382445 ATACAAAATTTCAGTTAGATAGG + Intergenic
1116112147 14:40599516-40599538 ATACAAAATTTCAGTTAGATAGG - Intergenic
1116316691 14:43405377-43405399 GTACAAAGTTACAGTTAGATAGG + Intergenic
1116473380 14:45311202-45311224 ATACAAAATTACAGCTAGATAGG - Intergenic
1116611480 14:47078897-47078919 ATACAAAATTTCAGTTAGATAGG - Intronic
1116706056 14:48302810-48302832 ATACAAAACTTCAGTTAGACAGG - Intergenic
1116803786 14:49470916-49470938 GTACAAAATTACAGCTAGATAGG + Intergenic
1117107501 14:52413189-52413211 ATACATAATTACAGTTAGATAGG - Intergenic
1117260115 14:54023751-54023773 ATACAAAAGTACAGTTAGATAGG - Intergenic
1117388011 14:55236145-55236167 GTACGAAGTTACAGCTAGATAGG + Intergenic
1117570916 14:57048466-57048488 GTACAAAGTTTCAGTTAGATAGG - Intergenic
1117848621 14:59941905-59941927 GTACAAAATTACAGCTAGATAGG - Intronic
1118160145 14:63280414-63280436 GTACAAAGCTGCAGTTAGCTAGG + Intronic
1118394729 14:65326289-65326311 ATACAAAATTACAGCTAGATAGG + Intergenic
1118515095 14:66518871-66518893 ATACAAAATTACAGCTAGATTGG + Intronic
1119028171 14:71170141-71170163 GTAAAAACCTACAGATCAATGGG - Intergenic
1119811547 14:77524890-77524912 GTACAAACATATAGTTAGATAGG + Intronic
1120116475 14:80624030-80624052 AGACAAAGCTACAGCTAGATGGG - Intronic
1120146036 14:80979407-80979429 GTATAAAGTTACAGTTAGGTAGG + Intronic
1120217700 14:81697780-81697802 GTACAAACTTGCAGTTACATAGG - Intergenic
1120308931 14:82805734-82805756 GTACAAAGTTACAGTTAGACAGG - Intergenic
1120312632 14:82850280-82850302 GTACAAAGTTACAATTAGAAAGG + Intergenic
1120416356 14:84222774-84222796 GTACAAAGTTACAGTTAGAAAGG + Intergenic
1120423856 14:84322442-84322464 GCACAAACATACAGTTAGGAGGG + Intergenic
1120623061 14:86790186-86790208 GTACAAAGTTTCAGTTTGATAGG - Intergenic
1121601423 14:95207471-95207493 GTATAAAGTTACAGTTACATAGG - Intronic
1121649224 14:95544869-95544891 GCACACTGCTACAGTTAGATAGG + Intergenic
1121920979 14:97881273-97881295 GTACAAAATTACAAATAGATAGG + Intergenic
1122349740 14:101081947-101081969 GTACAAACCTACAGTAAGATAGG + Intergenic
1123884508 15:24711583-24711605 GTACAAAGCTTTGGTTAGATAGG + Intergenic
1123896068 15:24831579-24831601 GTACAAAATTTCAGTTAGATAGG - Intronic
1123978036 15:25571056-25571078 GTACAAAGTTTCAGTTACATAGG + Intergenic
1124049093 15:26178539-26178561 GTACAAAGCTCCAGTTAGACTGG + Intergenic
1124193466 15:27600041-27600063 GTACACAAGTACAGTTAGATGGG + Intergenic
1124385324 15:29203699-29203721 GTACAAAATTTCAGTTAGATTGG - Intronic
1124477426 15:30046795-30046817 GCACAAAGTTACAGTTAGACAGG + Intergenic
1124710007 15:32000566-32000588 GTATAAAATTTCAGTTAGATGGG + Intergenic
1124876190 15:33596813-33596835 ATACAAAATTACAGCTAGATGGG - Intronic
1125091718 15:35800523-35800545 ATACAAAATTTCAGTTAGATAGG + Intergenic
1125343020 15:38693189-38693211 GTACAAAACTGCAGTTACATAGG + Intergenic
1125568755 15:40698060-40698082 GCACAAAGTTTCAGTTAGATAGG - Intronic
1125896117 15:43303003-43303025 ATACAAAATTACAGCTAGATAGG + Intergenic
1126305606 15:47252501-47252523 GTACAAAGTAACAGTTAGATAGG - Intronic
1126346595 15:47701395-47701417 ATACAAAATTTCAGTTAGATAGG + Intronic
1126442570 15:48706491-48706513 GTACAAAGTTACAATAAGATAGG - Intergenic
1126463906 15:48943211-48943233 GTCCAAACTTGCAGTTACATGGG - Intronic
1126533990 15:49741035-49741057 GTAGAAAATTACAGTTAGTTAGG + Intergenic
1126836209 15:52668441-52668463 ATACAAAATTACAGTTAGATAGG + Intronic
1126864145 15:52919404-52919426 ATACAAAATTACAGCTAGATAGG + Intergenic
1126974049 15:54154142-54154164 GTACAAAAATATAGTTAGATAGG - Intronic
1126990554 15:54371119-54371141 ATACAAAATTTCAGTTAGATAGG - Intronic
1127729497 15:61786163-61786185 GTAGAAGGCTACAGTTAGATGGG - Intergenic
1127765515 15:62182468-62182490 ATGCAAAAATACAGTTAGATAGG + Intergenic
1128138112 15:65278989-65279011 GCACAAACCTACAGTATGAAAGG + Intronic
1129549049 15:76428679-76428701 GTACAAGGCTACAATTAAATAGG + Intronic
1129623611 15:77173563-77173585 GTACAAAGTTCCAGTTAGACAGG - Intronic
1129962622 15:79701347-79701369 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1130174328 15:81552267-81552289 ATACAAAATTACAGATAGATGGG + Intergenic
1130798646 15:87237503-87237525 GTACAAAGCTACAGTTAGACAGG - Intergenic
1130855973 15:87840581-87840603 TTACAAAGCTGCAGTTATATAGG + Intergenic
1130962515 15:88672089-88672111 GTATAAAAATATAGTTAGATAGG + Intergenic
1131349412 15:91683876-91683898 GTACAAAATTTCAGTTAGACAGG - Intergenic
1132003722 15:98206821-98206843 ATACAAAATTTCAGTTAGATGGG + Intergenic
1132088364 15:98926347-98926369 ATACAAAATTTCAGTTAGATAGG + Intronic
1132155751 15:99494520-99494542 TTACAAACCTTGAGCTAGATTGG + Intergenic
1132310207 15:100851938-100851960 GTACAAAAGTTCAGTTAGACAGG + Intergenic
1132402012 15:101516663-101516685 GTACAAAGCCTCAGTTAGACAGG - Intronic
1133472705 16:6091156-6091178 GTGCAAACCTACAGTTAGATAGG - Intronic
1133541360 16:6757685-6757707 GTACAAACATATGGTTAGATAGG + Intronic
1133591706 16:7251115-7251137 ATACAAAATTTCAGTTAGATAGG - Intronic
1133608242 16:7409273-7409295 GAACAAAGCTACAGGCAGATCGG - Intronic
1133712330 16:8413270-8413292 ATACAAAGTTACAGCTAGATGGG + Intergenic
1134120650 16:11581975-11581997 GTACAAAGTTACAGTTCAATGGG + Intronic
1134208338 16:12255492-12255514 GTACAAAGCTTCAGTTGGACAGG - Intronic
1134283733 16:12841632-12841654 GTACGAAGTTGCAGTTAGATAGG + Intergenic
1134899254 16:17920723-17920745 ATACAAAACTTCAGTTAGACAGG + Intergenic
1135610608 16:23863567-23863589 GCACAAATCCACAGCTAGATAGG - Intronic
1135774920 16:25249174-25249196 GTACAAAATTTCAGTTAGATGGG + Intronic
1135886525 16:26314536-26314558 GTACAAAGTCACAGTCAGATAGG - Intergenic
1136743632 16:32562806-32562828 GTGCAAACATACAGTTTGAATGG - Intergenic
1137013737 16:35351228-35351250 TTACAAAGTTACAGTTAGATAGG + Intergenic
1137020694 16:35424155-35424177 TTACAAAGTTACAGTTAGACAGG + Intergenic
1137329240 16:47473972-47473994 GTACAAAGTTTCAGTTAGATAGG - Intronic
1137385470 16:48038405-48038427 ATACAAAATTACAGCTAGATAGG + Intergenic
1137470676 16:48754265-48754287 ATACAAAATTACAGCTAGATAGG + Intergenic
1137681647 16:50352030-50352052 GTACAGAATTACAGTTAGATGGG - Intronic
1137894964 16:52201714-52201736 GTACAAAAATACAGTTAAACAGG + Intergenic
1138581535 16:57944417-57944439 GTACAAAGATTCAGCTAGATAGG + Intronic
1138637292 16:58351093-58351115 GTACAAAATCACAGTTAGACAGG + Intronic
1138684764 16:58715465-58715487 GTACAAAGTTACAGTGAGTTAGG + Intronic
1139085745 16:63583548-63583570 GTACAAAACTGTAGTCAGATAGG + Intergenic
1139519337 16:67471600-67471622 GTATAAAATTACAGCTAGATAGG - Intronic
1140420998 16:74818704-74818726 ATACAAAATTACAGCTAGATAGG - Intergenic
1141351043 16:83297115-83297137 GTACAAAGCTACAGTCACATAGG + Intronic
1141710613 16:85696851-85696873 GTGCAGAGCTACAGGTAGATGGG - Intronic
1203025967 16_KI270728v1_random:512423-512445 GTGCAAACATACAGTTTGAATGG + Intergenic
1203045754 16_KI270728v1_random:822008-822030 GTGCAAACATACAGTTTGAATGG - Intergenic
1203144064 16_KI270728v1_random:1788053-1788075 GTACAAAGTTACAATTAAATAGG + Intergenic
1143699128 17:8644841-8644863 GTACAAAATTGCAGTTAGATAGG - Intergenic
1144228590 17:13176002-13176024 GTACAAAGTTACAACTAGATAGG + Intergenic
1144597011 17:16578648-16578670 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1144716292 17:17438004-17438026 GTACAAGCATACAGTTAGATAGG + Intergenic
1144867064 17:18343062-18343084 GTACAAAGTTGCAGTTAGACAGG + Intronic
1145358675 17:22190123-22190145 GTACAAAGTTACAGTTAGACAGG - Intergenic
1146888554 17:36488919-36488941 ATACAAAATTACAGCTAGATGGG - Intronic
1147412389 17:40263098-40263120 GTACAAAGTTTCAGTTAGACAGG + Intronic
1147508620 17:41046227-41046249 GTACAAAGTTACAGGTAGATAGG + Intergenic
1148290954 17:46448794-46448816 GTACAAACGTACAGTAAGATAGG - Intergenic
1148313143 17:46666499-46666521 GTACAAACGTACAGTAAGATAGG - Intronic
1149155732 17:53628302-53628324 ATACAAAATTTCAGTTAGATAGG - Intergenic
1149283149 17:55130629-55130651 GTACAAAGTTTCAGTTACATAGG - Intronic
1150198620 17:63328693-63328715 GTACAAATTTTCAGATAGATAGG + Intronic
1150450848 17:65266724-65266746 GTACAAAATTTCAGTTGGATAGG - Intergenic
1150985251 17:70188920-70188942 GTACAAAGTTACAATTAGATAGG - Intergenic
1151081315 17:71332893-71332915 CTACAAACATACAGTTAGATAGG + Intergenic
1151120477 17:71787350-71787372 TTAAAAACCAACAGTGAGATGGG + Intergenic
1151394705 17:73814952-73814974 ATACAAAATTACAGGTAGATAGG + Intergenic
1151592229 17:75052982-75053004 GGACAAAACTGCAGTCAGATAGG - Intronic
1152194705 17:78910544-78910566 ATACAAAATTACAGCTAGATAGG - Intronic
1153369738 18:4301246-4301268 GCACAAAGCCTCAGTTAGATAGG - Intronic
1153989366 18:10382476-10382498 ATACAAACCTGCAGTTATATAGG - Intergenic
1154098144 18:11440075-11440097 ATACAAATGTACAGTTAGATAGG + Intergenic
1155440655 18:25858454-25858476 GTACAAAATTACAGCTAGATAGG + Intergenic
1155486706 18:26351406-26351428 ATACAAAATTACAGCTAGATAGG + Intronic
1155598996 18:27522263-27522285 GTACAAAGTTTCAGTTAGATGGG - Intergenic
1155715996 18:28944615-28944637 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1155741132 18:29289195-29289217 ATACACAACTTCAGTTAGATAGG + Intergenic
1156135303 18:34030601-34030623 ATACAAAATTACAGCTAGATAGG + Intronic
1156224802 18:35093805-35093827 GTACAAAGTTACAGTTAGGTAGG + Intronic
1156343312 18:36232592-36232614 GTACAAAATTACAGGTATATAGG - Intronic
1156440188 18:37178157-37178179 GTACAAAGTTACAGTTAGATAGG - Intronic
1156727479 18:40146967-40146989 GAATAAACCTGCAGATAGATAGG - Intergenic
1156751706 18:40465632-40465654 ATAGAAAACTACAGCTAGATAGG - Intergenic
1156812711 18:41272315-41272337 GTACAAAGCTACAGTTAAATAGG + Intergenic
1156910119 18:42402122-42402144 GTACAAAATTACAGCTAAATGGG - Intergenic
1157152816 18:45235521-45235543 ATACAAAATTACAGCTAGATAGG - Intronic
1157300204 18:46473602-46473624 GTATAAACATGCAGTTAGATAGG + Intergenic
1157393594 18:47323631-47323653 GTACAAAATTTCAGTTAGACAGG + Intergenic
1158009083 18:52707891-52707913 ATACAAAATTTCAGTTAGATAGG + Intronic
1159331893 18:67005595-67005617 ATACAAAGATACAATTAGATCGG - Intergenic
1159334700 18:67047282-67047304 GTACAAAGTCACAGTTAGATAGG - Intergenic
1159343990 18:67174815-67174837 ATACAAAGTTTCAGTTAGATAGG + Intergenic
1159749388 18:72281531-72281553 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1159772745 18:72566687-72566709 GTACAATGTTACAGTTAGATAGG + Intronic
1159802085 18:72913768-72913790 GTACAAAAATATAGTTAGAATGG - Intergenic
1159837266 18:73353269-73353291 ATACAAAACTAGAGTCAGATTGG - Intergenic
1160343988 18:78114745-78114767 GTACAAAGTCACAGTTGGATAGG - Intergenic
1160497158 18:79382455-79382477 GAACAAACCTTCATTTAGAATGG - Intergenic
1162206893 19:9062991-9063013 ATACATAATTACAGTTAGATGGG - Intergenic
1162862606 19:13518141-13518163 GTACAAAAATAGAGTTAGATAGG - Intronic
1163083432 19:14960801-14960823 GTACAAAATTTCAGTTAAATAGG + Intronic
1163096415 19:15060807-15060829 GTACAAAAGTACAGTTAGGTAGG + Intergenic
1164469291 19:28515774-28515796 GTACGAAGTTACAGTTAGATAGG - Intergenic
1165085807 19:33346193-33346215 ATACGAAGTTACAGTTAGATAGG + Intergenic
1165605356 19:37098797-37098819 GTACAAAGTTATAGTTAGATAGG - Intronic
924989247 2:297507-297529 GAACAAACCTACAATTACAAAGG - Intergenic
925410925 2:3639723-3639745 GACCCAACCTCCAGTTAGATGGG - Intronic
926708177 2:15851599-15851621 GTACAAACACACCGTCAGATAGG - Intergenic
926891267 2:17640930-17640952 ATACAAAATTACAGCTAGATAGG - Intronic
926929844 2:18026376-18026398 GTACTAACTTTCAGTTAAATCGG - Intronic
927734435 2:25506180-25506202 GTACAAACACAGAGTTAGATGGG + Intronic
928481115 2:31684525-31684547 ATACAAAATTACAGTTAGATAGG + Intergenic
928561512 2:32492423-32492445 AAACTAACTTACAGTTAGATTGG + Intronic
928783395 2:34852460-34852482 ATACAAAATTACAGCTAGATAGG - Intergenic
929041054 2:37745067-37745089 ATACAAAAATATAGTTAGATAGG + Intergenic
929230245 2:39552309-39552331 ATACAAAATTTCAGTTAGATAGG - Intergenic
929272959 2:39993793-39993815 ATATAAAATTACAGTTAGATAGG + Intergenic
929338303 2:40780247-40780269 GTACAAAGTTACAGTTAAGTAGG + Intergenic
929356044 2:41025730-41025752 ATACAAAACTACAGCTAGATAGG + Intergenic
929389520 2:41453509-41453531 GTACAAAATTTCAGTTAAATAGG + Intergenic
929883362 2:45856654-45856676 GTACAAAGTTACAGTTAGACAGG - Intronic
930061030 2:47288873-47288895 GTTCAAAAATACAGTTAGATAGG - Intergenic
930284076 2:49406069-49406091 GTACAAAGATACAGTTAGGAGGG - Intergenic
930288241 2:49461587-49461609 GCACAAAGTTAGAGTTAGATAGG - Intergenic
930350219 2:50243055-50243077 ATACAAAGTTACGGTTAGATAGG + Intronic
930419917 2:51137607-51137629 GTACAAAGTTAAAATTAGATAGG + Intergenic
930570681 2:53082272-53082294 GTACAAAGTTATAGTTAGATAGG + Intergenic
931017755 2:58005671-58005693 GTAAAAACATTCAGTGAGATAGG + Intronic
931363544 2:61598972-61598994 GTACAAAGCTACAGTTATGTGGG + Intergenic
931452185 2:62377627-62377649 GCACAAAAATACGGTTAGATAGG + Intergenic
931465113 2:62479166-62479188 ATACAAAATTACAGCTAGATAGG - Intergenic
931506026 2:62927244-62927266 ATACAAAATTACAGCTAGATAGG + Intronic
931910466 2:66894206-66894228 GTACAAAGTTACAGTTATATAGG - Intergenic
932206293 2:69886152-69886174 GTACAAACTTGCAGTTATGTAGG - Intergenic
932552981 2:72790981-72791003 ATACAAAATTACAGCTAGATAGG + Intronic
933009468 2:77041027-77041049 GTACAAAGGTACAGTTAGATAGG - Intronic
933127662 2:78630892-78630914 ATACAAAATTACAGCTAGATAGG - Intergenic
933174655 2:79161439-79161461 GTACAAACATACAGCTAGATAGG + Intergenic
933419976 2:82032279-82032301 GTACAAAAATTCAGTTAGATAGG + Intergenic
933479397 2:82836250-82836272 ATACAAAATTACAGTTAGATGGG - Intergenic
933594464 2:84268737-84268759 ATACAAAATTACAGCTAGATAGG + Intergenic
934029929 2:88034751-88034773 GTACAAAGTTACAGGTAGATAGG - Intronic
934487172 2:94725923-94725945 ATACAAACTTACAGCTAGATAGG - Intergenic
935208718 2:100920183-100920205 GTAGAAAGCTTCAGTTAGACAGG + Intronic
935236896 2:101146819-101146841 GTACAGAGTTACAGTTAGATAGG - Intronic
935376477 2:102404031-102404053 GTACAAAAGTACAGTTAGGAGGG - Intergenic
935378695 2:102426858-102426880 GTACAAAGTTTCAGATAGATGGG - Intronic
935393004 2:102573386-102573408 GTACAAGATTACAGTTAGATAGG - Intergenic
935554569 2:104494411-104494433 GTACAAAGTTATAGTTAGAGAGG + Intergenic
935617373 2:105100682-105100704 GTACGAAGCTGCAGTTACATAGG - Intergenic
935925722 2:108066103-108066125 ATACAAAACTTCAGTTAGACAGG + Intergenic
935998178 2:108796860-108796882 GTACAAAAATACAGTTAGATAGG + Intronic
936623000 2:114119539-114119561 GTCCAAAGTGACAGTTAGATAGG + Intergenic
936719125 2:115228456-115228478 GTACAAAAATATAGTTAGATAGG - Intronic
936829710 2:116628487-116628509 GTACAAAGTTACAGTTACATAGG + Intergenic
937233167 2:120413466-120413488 ATACAAAATTACAGCTAGATTGG + Intergenic
937403220 2:121603957-121603979 ATACAAAATTACAGCTAGATAGG + Intronic
937504424 2:122520461-122520483 GTATAAAATTACAGTTAGATAGG + Intergenic
937567716 2:123315125-123315147 GTACAAAATTACAGTTAGACAGG + Intergenic
937572252 2:123378722-123378744 ATACAAAATTTCAGTTAGATAGG + Intergenic
937580910 2:123486807-123486829 CTTCAAAGCTACAGTTAGAATGG + Intergenic
937752401 2:125492411-125492433 GTACAAGTTTACAGTTAGATTGG - Intergenic
937790130 2:125951448-125951470 GTACACAATTACAGATAGATAGG + Intergenic
937878548 2:126847281-126847303 GTACAAAGTTGCAGTTAGAAAGG + Intergenic
938253906 2:129838365-129838387 GTACAAAGTTACAGTCAGATAGG + Intergenic
938564411 2:132505497-132505519 GTACAAACATAGAGTTAGATAGG - Intronic
938581194 2:132647963-132647985 CTACAAACATGCAGTTAGAGGGG - Intronic
938771025 2:134500855-134500877 ATACAAAATTACAGCTAGATAGG + Intronic
938948304 2:136234522-136234544 GCACAAACCAACAGTTATGTGGG + Intergenic
939058246 2:137388614-137388636 GTACAAACATATAATTAGGTAGG - Intronic
939182544 2:138820859-138820881 GTACAAAGCGTCAGTTAGAAAGG + Intergenic
939184936 2:138849273-138849295 GTACAAAAATACAGTTAGAGAGG + Intergenic
939276603 2:140005647-140005669 GTACAAACATATAGTTAGATAGG + Intergenic
939620891 2:144417724-144417746 GTACAAAACTACAGTTAGATAGG + Intronic
939976630 2:148724438-148724460 ATACAAAGTTACAGCTAGATAGG - Intronic
940072557 2:149705276-149705298 GTACAAAGTTACAGTTAATTAGG - Intergenic
940620319 2:156104385-156104407 GTACAAAATTACAGTTAGACAGG + Intergenic
941129891 2:161634809-161634831 GCACCAAGCTACAGTTAGATAGG - Intronic
941327902 2:164140790-164140812 ATATAAAATTACAGTTAGATAGG - Intergenic
941338674 2:164277934-164277956 GTACAAAGTAACAATTAGATTGG - Intergenic
941404393 2:165070519-165070541 GGACAAATCTACACTTATATAGG + Intergenic
941707903 2:168679207-168679229 GTGTAAAGTTACAGTTAGATGGG + Intronic
941971574 2:171356519-171356541 GTACAAATATACAGTTAGAAGGG - Intronic
942000012 2:171636797-171636819 GTACAAAGTTGCAGTTATATAGG - Intergenic
942082536 2:172414387-172414409 ATACAAAATTACAGCTAGATAGG - Intergenic
942309184 2:174638506-174638528 GTACAAAGTTACAATTAGACAGG - Intronic
942863625 2:180646252-180646274 GTACAAAGTTTCAGTTAGATAGG - Intergenic
942909161 2:181220858-181220880 GTATAAAGTTTCAGTTAGATAGG - Intergenic
942986002 2:182143115-182143137 GTACAAAATTCCAGTTAGATAGG + Intronic
943045020 2:182850322-182850344 GGACAAATATACAGTTAGTTAGG - Intronic
943138296 2:183943940-183943962 GTACAAACATACAGTTAGATGGG + Intergenic
943177346 2:184493561-184493583 ATACAAAATTACAGTTAAATAGG - Intergenic
943256916 2:185606104-185606126 TTACAAAACTTCAGTTAGACAGG + Intergenic
943400250 2:187399984-187400006 ATACAAAATTACAGCTAGATAGG + Intronic
943444342 2:187965425-187965447 CTACAAAATTACAGCTAGATAGG + Intergenic
943512937 2:188848642-188848664 GCACAAAGTTACAGTTAGATAGG + Intergenic
943550215 2:189329356-189329378 GCACAAAGTTTCAGTTAGATAGG + Intergenic
943874793 2:193051543-193051565 GTATAAACATACAGTTAAATAGG + Intergenic
944055288 2:195516396-195516418 TTACAAACCTTGAGTTAGACAGG - Intergenic
944590362 2:201211340-201211362 GTACAAAGTTACAATTAGATAGG - Intronic
944868512 2:203885587-203885609 AAAGAAACCTAAAGTTAGATTGG + Intergenic
944923921 2:204443395-204443417 ATACAAAATTCCAGTTAGATAGG + Intergenic
945128166 2:206536477-206536499 GTACAAAGTTGCAGTTATATAGG + Intronic
945768708 2:214013441-214013463 GTACAAAGTTACAATTAGATAGG - Intronic
945783581 2:214206226-214206248 GTACAAAAATACAGCTAGAGGGG - Intronic
945810032 2:214537591-214537613 GTACAAAGTTAAAGTTAGACAGG + Intronic
945853819 2:215042803-215042825 GTAGAAAGTTACAATTAGATAGG - Intronic
946137535 2:217659949-217659971 GTACAAAGTTTCAGTTAGACAGG + Intronic
946456950 2:219834437-219834459 GTACAAACATTCAGTTAGACAGG - Intergenic
947090420 2:226504055-226504077 ATACAAAATTACAGCTAGATAGG + Intergenic
947975921 2:234366147-234366169 GAAACAACCCACAGTTAGATCGG - Intergenic
948045687 2:234942039-234942061 GTACAAAGCCTCAGTTAGACAGG - Intergenic
948209812 2:236184609-236184631 TTAACAACCTACAGTTAGACAGG + Intergenic
948435549 2:237951268-237951290 CTACAAAAATACAGTTAGCTGGG + Intergenic
948912816 2:241013195-241013217 GTGCAAACCTTCAGTCAGACAGG - Intronic
1168940277 20:1705359-1705381 ATACAAAATTTCAGTTAGATAGG + Intergenic
1169250078 20:4053585-4053607 GTACAAAGTGACAATTAGATTGG + Intergenic
1169293597 20:4373664-4373686 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1169295671 20:4395749-4395771 TTACAAACTTTCAGTTAGACTGG - Intergenic
1169665866 20:8034776-8034798 ATACAAAATTACAGCTAGATAGG + Intergenic
1169706456 20:8511092-8511114 GTACAAAGTTTCAGTTAGACAGG - Intronic
1169836085 20:9880795-9880817 GTACAAAATTACAGCTAGATAGG - Intergenic
1170046671 20:12092688-12092710 ATACAAAATTACAGCTAGATAGG + Intergenic
1170146306 20:13178815-13178837 ATACAAAATTACAGCTAGATAGG + Intergenic
1170266622 20:14473252-14473274 GTATAAAGTTACAGTTAGATAGG - Intronic
1170386817 20:15828014-15828036 GTACAATGCTTCAGTTAGACAGG + Intronic
1170410672 20:16087697-16087719 ATACAAAATTACAGCTAGATAGG + Intergenic
1170523454 20:17212629-17212651 GTACAAAATTTTAGTTAGATAGG - Intergenic
1170886620 20:20345144-20345166 GTACAAAAATACAGTTAGATAGG + Intronic
1170944156 20:20875411-20875433 GTACAAAATTCCAGTTAGATGGG - Intergenic
1171000525 20:21410661-21410683 ATACAAAATTACAGCTAGATAGG - Intergenic
1171047084 20:21819490-21819512 ATACAAAGTTACAGCTAGATAGG + Intergenic
1171131991 20:22662630-22662652 GTACGAACATACAGGAAGATAGG - Intergenic
1171939284 20:31309115-31309137 GTACAAACTTTCGGTTAGATAGG - Intergenic
1171943970 20:31359327-31359349 GTATAAAACTACAGTTAGATAGG + Intergenic
1172989164 20:39019827-39019849 GTACAAAGTTTCAGTTAGACTGG - Intronic
1173303528 20:41826398-41826420 ATACAAAATTACAGCTAGATAGG + Intergenic
1173483521 20:43422647-43422669 ATACAAAATTACAGCTAGATAGG + Intergenic
1173642189 20:44611412-44611434 GTACATAGTTACAATTAGATAGG - Intronic
1173708372 20:45132228-45132250 ATACAAAATTTCAGTTAGATAGG - Intergenic
1173913776 20:46690844-46690866 ATACAAAATTTCAGTTAGATAGG - Intergenic
1174696331 20:52563165-52563187 TTACAAAATTACAGCTAGATAGG - Intergenic
1174750394 20:53106192-53106214 GTACAAAATTACAGTTAGATAGG - Intronic
1175573880 20:60045783-60045805 GTACAAAGTTACAGTTAAATAGG + Intergenic
1176837973 21:13811811-13811833 ATACGAACTTACAGCTAGATAGG - Intergenic
1177104300 21:16935465-16935487 GCACAAACCTATAGGTAGAAGGG - Intergenic
1177221218 21:18195415-18195437 GTACAAAGTTTCAGTTAGAAAGG - Intronic
1177246254 21:18527991-18528013 TTACAAAGTTACAGCTAGATAGG - Intergenic
1177459312 21:21389534-21389556 GTACAAAATTGCAGTTAGATAGG - Intronic
1177484160 21:21734253-21734275 GTACAAAGGTACTGTTGGATAGG + Intergenic
1177761731 21:25409223-25409245 GTACAATCTTTCAGTTATATAGG + Intergenic
1177919971 21:27140730-27140752 ATACAAAATTACAGGTAGATAGG - Intergenic
1177951520 21:27543871-27543893 GTACAAAGTTATAGTTAGATAGG + Intergenic
1178010459 21:28279668-28279690 GTACAAAATTACAGTTAGATAGG + Intergenic
1178091282 21:29166107-29166129 GTACATAGTTACAGTTAGACAGG - Intronic
1178198524 21:30376253-30376275 GTGCAAAAATATAGTTAGATAGG - Intronic
1178433720 21:32538631-32538653 GAACAAAGCTACAATTAGAAAGG + Intergenic
1179062068 21:37988481-37988503 GTACAAAATTACAGTCAGAGGGG - Intronic
1180134322 21:45851991-45852013 GTACAAAGTTAAAGTTAGACAGG + Intronic
1181912375 22:26249271-26249293 ATACAAACTTACAGCTAGATCGG - Intronic
1182166238 22:28176455-28176477 GTACAAAGTTACAATTAGATGGG + Intronic
1182679718 22:32069304-32069326 ATACAAAATTTCAGTTAGATAGG + Intronic
1182909976 22:33974923-33974945 ATACAAAGTTACAGTTAAATAGG + Intergenic
1183451755 22:37899911-37899933 GTGCAAAATTTCAGTTAGATAGG - Intergenic
1183537060 22:38408955-38408977 ATACAAAATTTCAGTTAGATGGG + Intergenic
1184518249 22:44976421-44976443 GTACAAAGTTACAGTTAGGTGGG - Intronic
1203293322 22_KI270736v1_random:16643-16665 ATACAAAAATATAGTTAGATAGG + Intergenic
949149723 3:751969-751991 GTATAAACATGCAGTTAGATGGG - Intergenic
949329514 3:2906219-2906241 ATACAACACTTCAGTTAGATGGG + Intronic
951097986 3:18653973-18653995 GTAAAAAATTACAGTTAGAGAGG - Intergenic
951314579 3:21173297-21173319 GTACAAAATTACAGTTAGATAGG - Intergenic
951727459 3:25775735-25775757 GCACAAAATTACAGTTAAATAGG + Intronic
951770741 3:26254505-26254527 GTACAAACTCACAGTTATGTAGG - Intergenic
952675171 3:36021092-36021114 GTACAAAGATACAGTTAGGTAGG + Intergenic
953041600 3:39260023-39260045 GTACAAAATTTCAGCTAGATAGG - Intergenic
953297324 3:41732990-41733012 GTACAAAATTACAGTTCGATAGG + Intronic
953306790 3:41838955-41838977 GTACAAACCTTCAGTTAGACAGG + Intronic
954569891 3:51631932-51631954 GTACAAAAATACAGTTAGACAGG - Intronic
954910178 3:54099013-54099035 GTACAAAGCTATAGCTACATAGG - Intergenic
955108843 3:55927697-55927719 GTACAAAAATATAGTTAGATAGG - Intronic
955127819 3:56131727-56131749 ATACAAAATTACAGCTAGATAGG + Intronic
955271972 3:57509524-57509546 CTACAAAATTTCAGTTAGATAGG + Intronic
955446487 3:59016418-59016440 ATACAAAACTACAGCTAGATAGG + Intronic
955800907 3:62685574-62685596 ATACAAAATTACAGCTAGATAGG + Intronic
955844830 3:63151504-63151526 GTACAAAATTTCAGTTAGACAGG - Intergenic
956055969 3:65299397-65299419 GTACAAAAGTACAGGTAGACAGG - Intergenic
956397128 3:68838227-68838249 GTACAAAATTTCAGTTAGACAGG - Intronic
956496673 3:69834265-69834287 ATACAAAGTTACAATTAGATAGG - Intronic
956960849 3:74399105-74399127 AAAAAAACTTACAGTTAGATAGG - Intronic
957019053 3:75103174-75103196 ATACAAAGTTACAGTTAGACAGG + Intergenic
957152029 3:76498337-76498359 ATACAAAACTTTAGTTAGATAGG + Intronic
957369912 3:79280136-79280158 ATACAAAACTAAAGTTAGACAGG + Intronic
957755664 3:84483122-84483144 GCACAAAATTACAGCTAGATAGG + Intergenic
957875917 3:86146663-86146685 ATACATAATTACAGTTAGATAGG - Intergenic
958186434 3:90126204-90126226 GTACAAAGTTACAATTAGATAGG - Intergenic
958189172 3:90162537-90162559 ATACAAAATTACAGCTAGATAGG + Intergenic
958411483 3:93822169-93822191 ATACAAAATTACAGCTAGATAGG + Intergenic
958493439 3:94809301-94809323 GTACAAAGTTACAGTTATACAGG + Intergenic
958651620 3:96942960-96942982 ATACAAAGTTAGAGTTAGATAGG - Intronic
958705758 3:97653030-97653052 CTATAAACATACAGTTAGTTTGG + Intronic
958812880 3:98882080-98882102 ATACAAAGTTACAGCTAGATAGG - Intronic
958843623 3:99239026-99239048 GTATAAAGTTACAGTTAGATAGG - Intergenic
959160476 3:102718006-102718028 GTACAAACATACAGTTTGATAGG - Intergenic
959218788 3:103487679-103487701 ATACAAAATTACAGCTAGATAGG - Intergenic
959254982 3:103998224-103998246 ATACAAAGTTACAGTTAGACAGG + Intergenic
959335607 3:105060872-105060894 GTACAAAGTTACAGTTAAATAGG + Intergenic
959363516 3:105426610-105426632 GTACAAATCTACAGTAAGATAGG - Intronic
959365028 3:105446895-105446917 GTACAAAGTCACAGTTAGATAGG + Intronic
959457828 3:106585757-106585779 GTACAAAATTATAGTTAGACAGG - Intergenic
959463980 3:106662946-106662968 ATACAAAGCTACAGTTAGGTAGG - Intergenic
959487080 3:106939191-106939213 GTACAAAAATACAATTAGATAGG - Intergenic
959594975 3:108119890-108119912 GTACAAAGTTACAGTTAGGCAGG + Intergenic
959740645 3:109715165-109715187 ATACAAAGTTTCAGTTAGATAGG + Intergenic
959955175 3:112229215-112229237 ATACAAAGTTGCAGTTAGATAGG + Intronic
960016207 3:112891146-112891168 GTACAAAGTTTCAGTTAGACAGG - Intergenic
960646848 3:119895044-119895066 GTACAAAATTATAGTTAGACAGG - Intronic
961963284 3:130875229-130875251 ATACAAAATTACAGCTAGATAGG - Intronic
962277675 3:134028677-134028699 CCACAAACATACAGTCAGATGGG - Intronic
962495400 3:135934815-135934837 ATACAAAAGTACAGCTAGATAGG - Intergenic
962610231 3:137069581-137069603 ATACAAAATTTCAGTTAGATAGG + Intergenic
962628099 3:137247617-137247639 GTACAAAGTTACAATTACATAGG - Intergenic
963279570 3:143369382-143369404 GTACAAAATTACAGCTAGATAGG + Intronic
963464055 3:145655262-145655284 GTACAAAGTTACAGTTAGACAGG - Intergenic
963535861 3:146527221-146527243 ATACAAAATTACAGCTAGATAGG + Intronic
963608181 3:147431746-147431768 GTACAAAATTACAGCTAGATAGG - Intronic
963898171 3:150707862-150707884 GTACAAAGTTACAGTTAGATAGG - Intergenic
964491218 3:157238473-157238495 ATACAAAATTACAGTTAGATAGG - Intergenic
964709124 3:159653049-159653071 GTACAAATATACAGTTTGAGAGG + Intronic
965151142 3:164976851-164976873 GTACAAACTTACAGTTAGATAGG - Intergenic
965152665 3:165000344-165000366 GCACAAAGTTACAGTTAGATAGG + Intronic
965632079 3:170743401-170743423 GTACAAAGTTATAATTAGATAGG - Intronic
965832865 3:172814906-172814928 GCACAAAGTTACAGTTAGAAAGG - Intronic
965839445 3:172887053-172887075 GGACAAAATTACAGTTAGAAAGG - Intergenic
966100371 3:176261941-176261963 GTACAAAATTACAGTTACATAGG - Intergenic
966199622 3:177348351-177348373 GTACAAAGTTGCAGTTACATAGG + Intergenic
966339330 3:178907597-178907619 GTACAAAGTTTCAGTTAGATAGG + Intergenic
966518757 3:180849861-180849883 GTACAAAGTTTCAGTTAGACAGG - Intronic
966664497 3:182455704-182455726 GTACAAAATTACAGTTAGATGGG - Intergenic
966803657 3:183788248-183788270 GTACAAAAATATAGTTAGAAGGG - Intronic
967150458 3:186644217-186644239 ATACAAAATTACAGCTAGATAGG - Intronic
967834854 3:193952641-193952663 ATACAAAATTACAGCTAGATAGG - Intergenic
968259900 3:197312463-197312485 ATACAAACTCACAGTTAGACAGG - Intergenic
968300782 3:197612570-197612592 GTACAAAGTTTCAGTTAGACAGG + Intergenic
968311801 3:197689906-197689928 GTTCAACCATACAGTTAGAAGGG - Intronic
970069426 4:12140175-12140197 GTACAAAGTTTCACTTAGATGGG + Intergenic
970413609 4:15835130-15835152 ATACAAAATTATAGTTAGATAGG - Intronic
970578552 4:17451741-17451763 TTATAAAATTACAGTTAGATAGG - Intergenic
970905338 4:21209353-21209375 ATACAAAATTACAGCTAGATAGG - Intronic
971551354 4:27960718-27960740 GTACAAAGTTTCAGTTAGACAGG + Intergenic
971813239 4:31455132-31455154 TTACAAAATTACAGCTAGATAGG + Intergenic
972005525 4:34098891-34098913 GTACAAAGTTTCAGTTAGACAGG + Intergenic
972769970 4:42188599-42188621 GTACAAAAATATAGTTAGATAGG + Intergenic
973042796 4:45494073-45494095 GTACAAAGCTACAGTTATGCAGG - Intergenic
973078354 4:45959514-45959536 GTACAAAGTTACAATTAGATAGG - Intergenic
973114156 4:46434404-46434426 ATACAAAGCTACAGATATATAGG - Intronic
973217203 4:47682493-47682515 ATACAAAATTACAGCTAGATAGG + Intronic
973966445 4:56167474-56167496 GTACAAAGTTTCAGTTAGACAGG - Intergenic
974139957 4:57873276-57873298 GTACAAAATTTCAGTTAGACAGG + Intergenic
974403112 4:61428768-61428790 TTACAGAGATACAGTTAGATAGG - Intronic
974421880 4:61686750-61686772 GTAAAAAGTTACAATTAGATGGG - Intronic
974457783 4:62149799-62149821 GTACAAAATTACAGTTACGTGGG + Intergenic
974497081 4:62645804-62645826 GTACAAAGTTTCAGTTAGACAGG - Intergenic
974545266 4:63297675-63297697 ATACAAAATTTCAGTTAGATAGG - Intergenic
975068912 4:70107224-70107246 TTACAAAGGTACAGTTAGATAGG - Intergenic
975126312 4:70786278-70786300 GTACAAAGCTATAGTTAGATAGG + Intronic
975222808 4:71832954-71832976 GTACAAGAATACAGTTAGGTAGG - Intergenic
975288886 4:72652751-72652773 GTACAAAATTTCAGTTAGATAGG + Intergenic
975294287 4:72714517-72714539 ATACAAACTTTCAGTTAGATAGG - Intergenic
975470750 4:74763737-74763759 ATACAAAATTATAGTTAGATAGG + Intronic
975504263 4:75120867-75120889 ATATAAAATTACAGTTAGATAGG + Intergenic
975778047 4:77810743-77810765 GTACAAAATTATAGCTAGATGGG - Intronic
975806609 4:78119286-78119308 ATACAAAATTACAGCTAGATGGG - Intronic
976120574 4:81776285-81776307 ATACAAAACTACAGCCAGATAGG + Intronic
976298643 4:83496979-83497001 ATACAAAATTACAGCTAGATAGG - Intronic
976548169 4:86361925-86361947 GTACAAAGTTTCAGTTAGAAAGG + Intronic
976702238 4:87983673-87983695 GTACAAAGTTACAGTTAGCTAGG - Intergenic
976856992 4:89616100-89616122 GTACAAAATTATAGCTAGATGGG - Intergenic
977068535 4:92351608-92351630 CTACAAACTTACAGCTAAATAGG - Intronic
977503762 4:97877169-97877191 GTACAAAGTTTCAGTTAGACTGG - Intronic
977547446 4:98400612-98400634 ATACAAAATTACAGCTAGATAGG + Intronic
977643190 4:99380503-99380525 ATACAAAATTACAGCTAGATAGG + Intergenic
978005404 4:103609708-103609730 GTACAAATTTACAGTTCGATAGG - Intronic
978281040 4:107014530-107014552 GTACAAAGTTACAGTTAGATAGG + Intronic
978366282 4:107986355-107986377 GTGCAAAGTTACAGTTAGACAGG + Intergenic
978694579 4:111561607-111561629 ATATAAAGTTACAGTTAGATAGG + Intergenic
978702261 4:111662046-111662068 GTACAAAGATATAGTTAGAAAGG + Intergenic
978703163 4:111673745-111673767 GTACAAAGTTACAGTTCGATAGG + Intergenic
978741244 4:112140656-112140678 GTACAAAGTTTCAGTTAGACAGG - Intergenic
978915156 4:114116487-114116509 ATACAAAATTACAGCTAGATAGG + Intergenic
978980152 4:114934658-114934680 GAACAAAGTTCCAGTTAGATGGG + Intronic
979061775 4:116071065-116071087 GTACAAAGTTATAGTTAGATTGG + Intergenic
979138498 4:117142019-117142041 GTACAAAGCTATGGTTAGATGGG + Intergenic
979648284 4:123098475-123098497 ATACAAACCTTCAGTTAAACAGG - Intronic
979774938 4:124578426-124578448 GTACAAAGTTATAGCTAGATGGG + Intergenic
979791198 4:124783580-124783602 GTACTAACCTACACTAAGACAGG - Intergenic
979820948 4:125170753-125170775 ATACAAAATTTCAGTTAGATAGG - Intergenic
980015029 4:127639871-127639893 GTACAAAGTTACAGTTAGATAGG - Intronic
980235808 4:130104916-130104938 ATACAAAACTATAGCTAGATAGG - Intergenic
980882872 4:138731254-138731276 ATACAAAATTACAGCTAGATGGG + Intergenic
981395472 4:144243328-144243350 TGACAAACCTCCAGTCAGATTGG - Intergenic
981465330 4:145063045-145063067 GTACAAAATTTCAGTTAGATAGG + Intronic
981520731 4:145659915-145659937 GTACAAAGTTACAACTAGATAGG - Exonic
981643456 4:146972030-146972052 ATACAAAATTACAGCTAGATAGG - Intergenic
981710279 4:147702038-147702060 GTACAAAGCTACAATTAGATTGG + Intergenic
981855986 4:149293351-149293373 TTACAAATCTACAGTCAGCTGGG + Intergenic
981884482 4:149657114-149657136 GTACAAAGTTACAATGAGATAGG - Intergenic
981896418 4:149806429-149806451 GTACAAAAATACAGTTACATAGG - Intergenic
982688156 4:158517296-158517318 GTACAAAGTTACATTTAGACAGG + Intronic
982785056 4:159527326-159527348 GTACAAAGCTTTAGTTAGACTGG - Intergenic
982893230 4:160882544-160882566 GTACAATGTTACAGTTAGATAGG + Intergenic
982951218 4:161698399-161698421 ATGCAAAATTACAGTTAGATAGG + Intronic
983283713 4:165712931-165712953 ATACACAACTACAGTTAGATGGG - Intergenic
983377419 4:166947969-166947991 GTACAAAGTTACAGTTAGTTGGG - Intronic
983418912 4:167493517-167493539 GCACAAAATTACAGCTAGATAGG + Intergenic
983679661 4:170338560-170338582 GTACAAAGTTTCAGTTAGACAGG + Intergenic
984357701 4:178685276-178685298 ATACAAAATTTCAGTTAGATAGG - Intergenic
984443948 4:179809639-179809661 GTACAAAGTTACAATTAAATAGG + Intergenic
984524869 4:180846696-180846718 GTAAAAAGTTACAATTAGATGGG + Intergenic
984541829 4:181048162-181048184 ATACAAAATTACAGCTAGATAGG - Intergenic
985052376 4:186004705-186004727 ATACAAAGTTACAGCTAGATAGG - Intergenic
986367728 5:7050712-7050734 GTACAAAATTTCAGTTAGACCGG + Intergenic
986471154 5:8077011-8077033 GTATAAAGTTACAGTTACATAGG - Intergenic
986477535 5:8150959-8150981 GGACAAAGCTACCATTAGATAGG + Intergenic
987005399 5:13704910-13704932 GTATAAAATTTCAGTTAGATAGG + Intronic
987009270 5:13744376-13744398 ATACAAAATTACAGCTAGATAGG + Intronic
987501275 5:18712613-18712635 GTTAAAAGTTACAGTTAGATAGG - Intergenic
987565356 5:19577128-19577150 GTACAATGTTACAGTTAGGTAGG + Intronic
987764127 5:22203202-22203224 GGTCAAAGTTACAGTTAGATAGG - Intronic
987898966 5:23985576-23985598 GTACAAAGTTTCAGTTAGATAGG + Intronic
987932037 5:24414480-24414502 GTACAAAGTTACAATTAGACAGG - Intergenic
988137682 5:27195986-27196008 GTACAAAGTTACAATTAGAAAGG - Intergenic
988371593 5:30376543-30376565 ATACAAACCTACAGTTTTAGTGG + Intergenic
988378430 5:30470197-30470219 GTACAAATCTCTAATTAGATAGG - Intergenic
988626081 5:32876341-32876363 TTACAAAATTACAGCTAGATAGG - Intergenic
988860917 5:35277774-35277796 GTACAAAGTGACAGTGAGATAGG - Intergenic
989000870 5:36758817-36758839 ATTCAAAGCTACAGTTAGACAGG + Intergenic
989210921 5:38858219-38858241 GCACAAACATGCAGTTAGATTGG - Intronic
989325418 5:40187594-40187616 GTACAAAGTTTCAGTTAGACGGG + Intergenic
989753947 5:44928836-44928858 GTACAAAGTTACAGTTAGATGGG - Intergenic
990004374 5:50928246-50928268 GTACAAAGTTTCAGTTAGACAGG + Intergenic
990133658 5:52619222-52619244 GTACAAAGTTACTGTTAGACGGG - Intergenic
990752479 5:59031975-59031997 GTACAAAATTTCAGTTAGATTGG + Intronic
991243711 5:64487416-64487438 GTACAAAATTACAGTTAGATAGG - Intergenic
991515043 5:67425845-67425867 GTATAAACTTTCAGTTACATGGG + Intergenic
991644222 5:68785365-68785387 GTACAAAATTACAATTAGATTGG + Intergenic
991659681 5:68937617-68937639 GTACAAAGCTTCAGTTAGACAGG + Intergenic
991898857 5:71436286-71436308 GGTCAAAGTTACAGTTAGATAGG - Intergenic
992169924 5:74091560-74091582 GTACAAAATTACGGTTAGATAGG - Intergenic
993253304 5:85556026-85556048 GTACAAAAATGCAGTTAAATAGG + Intergenic
993471944 5:88316998-88317020 ATACAAAATTACAGTTAGATAGG - Intergenic
993807436 5:92429153-92429175 GTACTAAATTACAGTTGGATAGG - Intergenic
993856278 5:93079838-93079860 GTACAAAGTTTCAGTTAGATTGG - Intergenic
993878185 5:93333070-93333092 TTACAAAGTTATAGTTAGATAGG + Intergenic
994077059 5:95665311-95665333 GTACAAAATTACAATTAGATAGG - Intronic
994479689 5:100318064-100318086 ATACAAAATTACAGCTAGATAGG + Intergenic
994508986 5:100679401-100679423 GTGCAAAGTTACAATTAGATAGG - Intergenic
994647562 5:102490124-102490146 GTACTAAGTTACAGTTAGATAGG + Intronic
995165397 5:109034092-109034114 GTACAAAGTCTCAGTTAGATGGG - Intronic
995285145 5:110379675-110379697 GTATAAACTTATAGTTAGATAGG - Intronic
995383030 5:111556346-111556368 GTACAAAGTTTCAGTTAGACTGG - Intergenic
995430614 5:112071272-112071294 ATACCAATTTACAGTTAGATGGG + Intergenic
995671302 5:114606599-114606621 ATACAAAATTACAGCTAGATGGG - Intergenic
995849398 5:116529281-116529303 ATACAAAAGTACAGCTAGATAGG + Intronic
996232707 5:121086449-121086471 GTACAAAAACACAGTTAGATAGG - Intergenic
996270597 5:121599988-121600010 GTACAAAATTTCAGTTAGACAGG - Intergenic
996489311 5:124074150-124074172 GTATAAAATTACAGTTAGGTAGG - Intergenic
996607276 5:125338298-125338320 GTACAAAGTTACAGTTAGGTAGG - Intergenic
996632586 5:125652256-125652278 GTACAAAGTTTCAGTTAGGTAGG + Intergenic
997576060 5:134978194-134978216 GTACAAAGTTACAGTTAGATAGG + Intronic
997605295 5:135171048-135171070 GTACAAAGTTACAATTAGAAAGG - Intronic
998025900 5:138816020-138816042 ATACAAATATACAGTTAAATAGG - Intronic
998055527 5:139073578-139073600 ATACAAAGTTTCAGTTAGATAGG + Intronic
998181159 5:139944356-139944378 ATACAAAATTACAGCTAGATAGG - Intronic
998198735 5:140100105-140100127 ATACAAAATTACAGCTAGATAGG - Intergenic
998242412 5:140459527-140459549 GTACAAAGTTTCACTTAGATAGG + Intronic
998293944 5:140946875-140946897 GTACGAAGTTACAATTAGATAGG + Intronic
998550496 5:143072809-143072831 ATACAAAATTACAGCTAGATAGG + Intronic
998766293 5:145491656-145491678 ATACAAAATTTCAGTTAGATAGG - Intronic
999420945 5:151442589-151442611 ATACAAAATTACAGCTAGATAGG - Intronic
999659597 5:153846445-153846467 GTACAAAGTTACAATTAGTTAGG - Intergenic
999764364 5:154727531-154727553 CTACAAAATTTCAGTTAGATGGG + Intronic
1000448334 5:161352584-161352606 TTACAAAATTTCAGTTAGATAGG + Intronic
1000540536 5:162533701-162533723 ATACAAAATTACAGCTAGATAGG - Intergenic
1000695630 5:164378273-164378295 ATACACAATTACAGTTAGATGGG - Intergenic
1000954887 5:167531594-167531616 GTACAAAGTTTCAGTTAGAGAGG - Intronic
1001064405 5:168524530-168524552 GTACAAACATACAGTAAGATAGG + Intergenic
1001739764 5:174042879-174042901 GTACAAAGTTACTGTTAGACAGG - Intergenic
1001850588 5:174961294-174961316 ACACAAAGTTACAGTTAGATAGG - Intergenic
1002588636 5:180270936-180270958 GTCCAAAATTTCAGTTAGATAGG + Intronic
1002678887 5:180944211-180944233 ATACAAAGTTACAATTAGATAGG + Intronic
1002688116 5:181031219-181031241 ATACAAAATTTCAGTTAGATAGG + Intergenic
1003272280 6:4617921-4617943 GTACAAATTTTCAGTTAGACAGG + Intergenic
1003922311 6:10844779-10844801 ATACAAAATTTCAGTTAGATAGG - Intronic
1004438288 6:15619109-15619131 ATACAAAATTACAGCTAGATAGG + Intronic
1004626921 6:17385580-17385602 GTACAAAGTTTCAGTTAGAGAGG - Intergenic
1004757492 6:18628583-18628605 GCACAAAGTTTCAGTTAGATGGG + Intergenic
1005144763 6:22675829-22675851 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1005178569 6:23076544-23076566 GTACAAAGTTACAGTTAAATAGG + Intergenic
1005383552 6:25262731-25262753 GGACAAAATTACAGGTAGATAGG + Intergenic
1005698491 6:28375146-28375168 GTACAAAGTTACGATTAGATAGG - Intergenic
1006068980 6:31483661-31483683 GTACAAAGATACAGTTAAATAGG - Intergenic
1006206390 6:32346878-32346900 ATACAAAATTGCAGTTAGATGGG + Intronic
1006238208 6:32654308-32654330 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1006494543 6:34412681-34412703 GTACAAAGTTTCAGTTAGATAGG - Intronic
1006614142 6:35313560-35313582 GTATAAACATACAGTTTGACAGG - Intronic
1007000024 6:38302229-38302251 GTACAGAGTTACAGTTAGAGAGG - Intronic
1007120321 6:39375238-39375260 GTACAAAGTTTCAATTAGATAGG + Intronic
1007357182 6:41329588-41329610 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1007415427 6:41688742-41688764 GTCCAAACCTACAGCTAGCAGGG - Intronic
1008022441 6:46595630-46595652 ATACAAAACTTCAGTTAGACAGG + Intronic
1008187890 6:48416921-48416943 ATACAAAATTTCAGTTAGATAGG + Intergenic
1008245496 6:49166693-49166715 GTACATAGTTACAATTAGATAGG - Intergenic
1008254876 6:49285361-49285383 GTGCAAAGTTACATTTAGATAGG - Intergenic
1008801995 6:55379769-55379791 ATGCATAACTACAGTTAGATAGG - Intronic
1008937652 6:57009172-57009194 ATACAAAATTACAGCTAGATGGG + Intronic
1009294733 6:61932380-61932402 ATACATAATTACAGTTAGATAGG - Intronic
1009405699 6:63309808-63309830 ATACAAAATTACAGTTAAATAGG - Intronic
1009471990 6:64038201-64038223 ATACAAATTTACACTTAGATAGG + Intronic
1009617495 6:66029096-66029118 GTACAAAATTTCAGTTAGACAGG + Intergenic
1009650732 6:66474970-66474992 GTAAAAAGCTACAGTTAGGTAGG - Intergenic
1009687438 6:66981449-66981471 GTACAAAACTTCAGATAGACAGG - Intergenic
1010321382 6:74514174-74514196 GTACAAAGTTACAGTTAGATAGG + Intergenic
1010321433 6:74514854-74514876 GTACAAAGTTACAGTTAGATAGG + Intergenic
1010346933 6:74822228-74822250 ATACAAAATTACAGCTAGATAGG + Intergenic
1010443384 6:75925011-75925033 GTACAAAGTTACAATTAGGTAGG + Intronic
1010564159 6:77388678-77388700 GTACAAAGTTTCAGTTAGACTGG - Intergenic
1010891374 6:81315047-81315069 GTACAAAGTTTCAATTAGATGGG + Intergenic
1011026891 6:82879242-82879264 GGACAAAGCCTCAGTTAGATGGG - Intergenic
1011446639 6:87448608-87448630 GGACAAAATTACAGTTAGATAGG - Intronic
1011990580 6:93510620-93510642 GTACAAAGTTTTAGTTAGATAGG - Intergenic
1012025975 6:93991755-93991777 ATACAAAATTACAGTTAGATAGG + Intergenic
1012148487 6:95716742-95716764 GTACAAAGCCCCAGTTAGACAGG - Intergenic
1012578824 6:100837771-100837793 GTACGAAGTTACAGTTAGAGAGG + Intronic
1012601298 6:101100751-101100773 ATACAAAATTTCAGTTAGATGGG - Intergenic
1012645553 6:101675123-101675145 GTACAAAGTTACAATTAGAAAGG - Intronic
1012688962 6:102290397-102290419 GTACAAAGCTACAATTAGATAGG - Intergenic
1012755688 6:103227497-103227519 TTACAAAGATACAGTTAAATTGG + Intergenic
1013058469 6:106608373-106608395 ATACAAAATTACAGCTAGATAGG + Intronic
1013420618 6:109963248-109963270 GTACAAAATTACAGCTAGGTGGG + Intergenic
1013645013 6:112128467-112128489 GTACCAAATTACAGCTAGATAGG + Intronic
1013651162 6:112196274-112196296 ACACAAACTTACAGCTAGATGGG - Intronic
1013746780 6:113355194-113355216 GTACAAAGTTGCAGTTACATGGG + Intergenic
1013821421 6:114157461-114157483 GTACAAAGTTTCAGTTAGATAGG + Intronic
1013943911 6:115699325-115699347 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1014207859 6:118676281-118676303 GTACATAGTTTCAGTTAGATAGG - Intronic
1014361458 6:120481003-120481025 TTACAATCCTACAAATAGATAGG - Intergenic
1014375219 6:120663988-120664010 GTACAAAGTTTCAGTTAGGTAGG - Intergenic
1014794568 6:125709841-125709863 GTACAAAGTTTCAGTTAGAGTGG + Intergenic
1014888387 6:126810863-126810885 GGACAAAGTTACAGTTAGATAGG + Intergenic
1015211997 6:130708964-130708986 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1015294179 6:131571727-131571749 CTACATACCTACAATTTGATGGG + Intergenic
1015369180 6:132431393-132431415 GTGCAATGTTACAGTTAGATAGG - Intergenic
1015430835 6:133128976-133128998 TAACAAACTTACAGTTAGAATGG - Intergenic
1015549584 6:134398203-134398225 ATACAAAGTTACAGCTAGATAGG + Intergenic
1015866992 6:137737103-137737125 ATACAAAATTTCAGTTAGATAGG + Intergenic
1016294262 6:142557522-142557544 ATACAAAATTACAGCTAGATAGG + Intergenic
1016368822 6:143349482-143349504 ATACAAAATTACAGCTAGATAGG - Intergenic
1016657796 6:146542179-146542201 GTACAAAGTTGCAGTTATATAGG - Intergenic
1017105130 6:150880204-150880226 GTATAAAGTTACACTTAGATAGG - Intronic
1017284231 6:152656033-152656055 GTAAAAATCTTCAGTTACATAGG + Intergenic
1017427378 6:154336567-154336589 ATACAAACATACAGTTAGATAGG + Intronic
1017685844 6:156913591-156913613 ATACAAAATTTCAGTTAGATGGG - Intronic
1017996631 6:159537330-159537352 GTACAAAGCTGCAGTTATGTGGG + Intergenic
1018032237 6:159850465-159850487 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1020516737 7:9131087-9131109 GTACAAAATTTCAGTTAGATGGG - Intergenic
1020579912 7:9984070-9984092 ATACAAAGTTACAGTTAGGTAGG - Intergenic
1020612254 7:10413707-10413729 GTACAAAGTTATAGTTAGGTAGG - Intergenic
1021296128 7:18908492-18908514 ATACAAAATTACAGGTAGATAGG - Intronic
1021381218 7:19969010-19969032 GTACAAAATTCCAGTTAGATAGG - Intergenic
1021387848 7:20053764-20053786 ATACAAAATTTCAGTTAGATAGG - Intergenic
1021528839 7:21620338-21620360 GTACAAATTTTCAGTTAGACAGG - Intronic
1021589381 7:22243882-22243904 GTACAAAATTTCAGTTAGATAGG - Intronic
1021684529 7:23170462-23170484 GTACAGAAATACAGTTAGATAGG + Intronic
1021980546 7:26050558-26050580 ATACAAAATTACAGCTAGATAGG - Intergenic
1022062375 7:26810450-26810472 ATACAAAATTTCAGTTAGATAGG + Intronic
1022085236 7:27061198-27061220 CTACAAAATTACAGCTAGATAGG + Intergenic
1022209191 7:28192010-28192032 GTACAAAATTATAGTTAGATAGG + Intergenic
1022223913 7:28343310-28343332 GTACAAAGTTACGGTTAGACAGG - Intronic
1022651387 7:32279353-32279375 GTACAAAGTTGCACTTAGATAGG + Intronic
1023043958 7:36195634-36195656 ATACAAAATTTCAGTTAGATAGG + Intronic
1023347059 7:39281403-39281425 GTACAAAGTTACAGTTAGATAGG - Intronic
1023352102 7:39330885-39330907 GTACAGACTTAAAATTAGATAGG - Intronic
1023635251 7:42203341-42203363 ATACAAAATTACAGTTAGGTAGG - Intronic
1023662624 7:42486097-42486119 TTACAAACCTATATTGAGATTGG - Intergenic
1023729892 7:43180947-43180969 TTACAAAGTTACAGTTAGATAGG - Intronic
1023808963 7:43896474-43896496 ATACAAAATTACAGTTAGGTAGG + Intronic
1024050528 7:45619251-45619273 GTACAAAATTACAGGTAGATAGG + Intronic
1024333020 7:48175787-48175809 ATACAAAATTACAGCTAGATAGG - Intronic
1024423303 7:49195797-49195819 ATACAAATATATAGTTAGATAGG - Intergenic
1024923207 7:54582946-54582968 GTACAAACATATAATTAGATAGG + Intergenic
1026209032 7:68286845-68286867 GCACAAAGTTACAGTTAGACAGG + Intergenic
1026369852 7:69688731-69688753 ATACAAAACTACAGCTAAATAGG - Intronic
1027401791 7:77816671-77816693 TTACAAAATCACAGTTAGATAGG - Intronic
1027614975 7:80411031-80411053 ATACAAAGTTACAGTTAGATAGG - Intronic
1027626186 7:80546932-80546954 ATATAAAAGTACAGTTAGATGGG + Intronic
1027809188 7:82871493-82871515 AGACAAATGTACAGTTAGATAGG + Intronic
1027913899 7:84289253-84289275 GTACAAAACTACAGTTAGATAGG + Intronic
1028102711 7:86840919-86840941 ATACAAAATTTCAGTTAGATAGG + Intronic
1028227920 7:88271150-88271172 ATACAAAATTACAGCTAGATAGG - Intergenic
1028412312 7:90543172-90543194 GTACAAAGTTTCAGTTAGAGAGG + Intronic
1028668528 7:93373784-93373806 GTACAAAATTACAGTTAGATAGG + Intergenic
1028862147 7:95664816-95664838 GTACAAAGTTATAGTTAGACAGG - Intergenic
1029793336 7:102868260-102868282 GTACAAAGTTACAGTGAGATAGG - Intronic
1029892152 7:103942253-103942275 GTACAAAGTTCCAGTTAGACGGG - Intronic
1029964890 7:104729474-104729496 GTACAAAGTTACAGTTAGATAGG - Intronic
1030232130 7:107219712-107219734 GTACAAAGTTACAGTTAGACAGG + Intronic
1030501618 7:110366611-110366633 GTATAAAGCTACAGCTAGATAGG + Intergenic
1030739941 7:113096823-113096845 GTACAAAGTTTCAGTTAGACTGG + Intergenic
1030783774 7:113634838-113634860 TTACAAAATTTCAGTTAGATAGG - Intergenic
1030896565 7:115068437-115068459 GTATAAAGTTACAGTTACATAGG + Intergenic
1031174241 7:118329127-118329149 GTACAAACTTTCAGTTAGACTGG + Intergenic
1031211929 7:118840306-118840328 TTACAAAACTTCATTTAGATAGG - Intergenic
1031229634 7:119089021-119089043 GTACAAAGTTTCAGTTAGAGAGG - Intergenic
1031265948 7:119580431-119580453 ATACAAAATTACAGCTAGATAGG + Intergenic
1031302224 7:120075449-120075471 ATACAAAAGTACAGCTAGATAGG + Intergenic
1031449860 7:121901957-121901979 GTACAAAGTTACAGTCAGATAGG - Intronic
1031457833 7:122006344-122006366 ATACAAAATTACAGCTAGATAGG - Intronic
1031472203 7:122180363-122180385 GTATAAACGTACACATAGATAGG - Intergenic
1031508041 7:122611292-122611314 GGACAAACTTTTAGTTAGATGGG + Intronic
1031792842 7:126132067-126132089 GTACAAAATTATAGTTAGATAGG + Intergenic
1032771315 7:135060504-135060526 ATACAAAATTCCAGTTAGATAGG - Intronic
1032919032 7:136525435-136525457 GTACAAAGTTTCAGATAGATAGG + Intergenic
1032930803 7:136667615-136667637 ATACAAAATTACAGCTAGATAGG - Intergenic
1032996275 7:137450168-137450190 AGACAAAGTTACAGTTAGATAGG + Intronic
1033387767 7:140895527-140895549 ATACAAAATTACAGCTAGATAGG - Intronic
1033446725 7:141429578-141429600 ATACATAATTACAGTTAGATAGG + Intronic
1033469317 7:141630303-141630325 GTGCAAAGTTGCAGTTAGATAGG + Intronic
1033489849 7:141832819-141832841 GTACAAAAATACAGTTAGAATGG - Intergenic
1033634707 7:143201237-143201259 CTACAAAGTTACAGTTAGATAGG - Intergenic
1033702169 7:143850485-143850507 GTACAAAGGTTCAGTTAGATAGG + Intergenic
1033901855 7:146152404-146152426 ATACAAAATTTCAGTTAGATGGG + Intronic
1034287283 7:149895278-149895300 ATACGTAACTACAGTTAGATAGG + Intergenic
1034663839 7:152797633-152797655 ATACGTAACTACAGTTAGATAGG - Intronic
1034757369 7:153635395-153635417 ATACAAAATTACAGCTAGATAGG - Intergenic
1035147830 7:156838326-156838348 GTACAAAATTTCAGTTAGGTAGG - Intronic
1035594602 8:846240-846262 GCACAAAGCTACAGTTAGATAGG - Intergenic
1035804435 8:2441145-2441167 GCACAAAGCTTCAGTGAGATCGG + Intergenic
1036384707 8:8269132-8269154 GCAGAAATCTACAGTTAAATTGG + Intergenic
1037000508 8:13712623-13712645 GCACAAAAATACAGTTAGATAGG - Intergenic
1037088885 8:14887955-14887977 GTACAAAGTTACAGTTCAATAGG + Intronic
1037110038 8:15154862-15154884 ATACAAAATTACAGCTAGATAGG + Intronic
1037127371 8:15367292-15367314 GTACAAAGCTTCTGTTAGATGGG + Intergenic
1037670848 8:21013955-21013977 TTACACACCTACACTTACATAGG + Intergenic
1037848920 8:22309770-22309792 ATAAAAACCTACATTTATATAGG - Intronic
1037868613 8:22469381-22469403 GTACAAACATACATTAAGATAGG + Intronic
1038289083 8:26232662-26232684 GTACAAACGTACAGTTAAATAGG - Intergenic
1038341180 8:26686513-26686535 GTACAAAGTTCCAGTTAGACAGG - Intergenic
1038352517 8:26790495-26790517 ATACAAAATTACAGCTAGATAGG + Intronic
1038624175 8:29174215-29174237 GAACAAACTTGCAGTTATATAGG - Intronic
1038809324 8:30823905-30823927 GTACAAAATTAGAGTAAGATAGG - Intergenic
1038938247 8:32276145-32276167 ATACAAAGTTACAGCTAGATAGG - Intronic
1039279595 8:35969548-35969570 CTACAAAATTACAGCTAGATAGG + Intergenic
1039298450 8:36183191-36183213 ATACAAAATTTCAGTTAGATAGG - Intergenic
1039419393 8:37423097-37423119 GTACAGAATTTCAGTTAGATAGG + Intergenic
1039657432 8:39424693-39424715 GTACAATGTTACAATTAGATAGG + Intergenic
1039681405 8:39741145-39741167 GTACATATTTACAGTTAAATAGG - Intergenic
1040027030 8:42791201-42791223 ATATAAAATTACAGTTAGATAGG - Intronic
1040487831 8:47891168-47891190 GTAATAAACTACAGTTAGACTGG - Intronic
1040710307 8:50180305-50180327 GTACAAACTTGAAGTTATATAGG + Intronic
1040727573 8:50400836-50400858 GTACAATGTTACAGTCAGATGGG + Intronic
1040742579 8:50597016-50597038 GTACAAAGTTACAGTTACACAGG - Intronic
1040793479 8:51262552-51262574 GTACAAAGTTTCAGTTAGACTGG + Intergenic
1040922642 8:52640288-52640310 GTACAAAGCTACAGCCAGATAGG + Intronic
1041154482 8:54971069-54971091 GTACAAAGTTTCAGTCAGATAGG + Intergenic
1041707762 8:60864703-60864725 GTACAAAAATAGAGTTAGACAGG - Intronic
1041882817 8:62772011-62772033 GTACAAAAATATAGTTAGATAGG - Intronic
1042803720 8:72748959-72748981 GTACAAAATTTCAGTTAGACGGG - Intronic
1042949932 8:74190571-74190593 GTACAAAGTTACAGTTAGATAGG - Intergenic
1043405079 8:79922359-79922381 ATACAAAATTTCAGTTAGATAGG + Intronic
1043667825 8:82839803-82839825 GTACATAGTTACATTTAGATAGG - Intergenic
1043709267 8:83394444-83394466 ATACAAAATTACAGCTAGATAGG + Intergenic
1043736866 8:83759008-83759030 GTACAAAGTTACAATTAAATAGG + Intergenic
1043773298 8:84232472-84232494 ATACAAAATTTCAGTTAGATAGG + Intronic
1044143429 8:88683580-88683602 GTACAAATATACAGTCAGATAGG - Intergenic
1044160537 8:88909024-88909046 ATACAAAGTTACAGTTAGATAGG + Intergenic
1044191899 8:89329240-89329262 ATACAAAATTACAGCTAGATAGG + Intergenic
1044198861 8:89411353-89411375 ATACAAAATTACAGTCAGATAGG + Intergenic
1044218690 8:89644348-89644370 ATACAAAACTACAGCTAGATAGG + Intergenic
1044359494 8:91264990-91265012 GCACAAAGTTACAGTTAGATAGG - Intronic
1044584127 8:93853403-93853425 GTACGAAATTTCAGTTAGATAGG + Intergenic
1044637968 8:94345993-94346015 ATACAAAGTTATAGTTAGATAGG + Intergenic
1044676986 8:94739111-94739133 ATACAAAATTACAGCTAGATAGG - Intronic
1045134082 8:99194360-99194382 GTACAAAGTTTCAGTTAGACAGG - Intronic
1045543692 8:103109581-103109603 GTGCAAATATGCAGTTAGATAGG + Intergenic
1045598632 8:103687621-103687643 ATACAAAATTTCAGTTAGATGGG - Intronic
1045717743 8:105068061-105068083 ATACAAAATTACAGCTAGATAGG - Intronic
1046219433 8:111193651-111193673 ATACAAAATTTCAGTTAGATAGG - Intergenic
1047036372 8:120943450-120943472 ATACAAAATTACAGCTAGATAGG - Intergenic
1047152492 8:122279970-122279992 ATACAAAATTACAGATAGATAGG + Intergenic
1048047684 8:130788518-130788540 GTACAAACTTACAGTTAGATAGG + Intronic
1049161009 8:141097611-141097633 GTACAAACATACAGTTAGATAGG - Intergenic
1050005159 9:1121834-1121856 GTACAAAATTATAGTTAGGTAGG - Intergenic
1050207472 9:3212457-3212479 GTACAAAGTTACAGTTTGATAGG + Intergenic
1050285247 9:4095131-4095153 ATACAAAATTACAGCTAGATAGG - Intronic
1050567430 9:6900899-6900921 ATACAAACATACATTGAGATAGG - Intronic
1050737632 9:8782451-8782473 ATATAAAATTACAGTTAGATAGG - Intronic
1050818975 9:9854099-9854121 TTACAAGACTACAATTAGATAGG - Intronic
1051201079 9:14624686-14624708 GTACAAAGTTACAATTAGAAAGG + Intronic
1051307414 9:15727492-15727514 GTACTGAGTTACAGTTAGATAGG + Intronic
1051812823 9:21069572-21069594 ATACAAAATTACAGTTACATAGG - Intergenic
1051864938 9:21669460-21669482 GTACAAAATTTCAGTTATATTGG - Intergenic
1052097237 9:24397787-24397809 ATACAAAATTACAGTTAGATAGG - Intergenic
1052255471 9:26451072-26451094 ATACAAAAATACAGTTAGATAGG - Intergenic
1052461305 9:28767121-28767143 GTACAAACTTTCAGTTATGTAGG + Intergenic
1053670629 9:40358428-40358450 ATACAAACTTACAGCTAGATAGG + Intergenic
1053920418 9:42984773-42984795 ATACAAACTTACAGCTAGATAGG + Intergenic
1054381750 9:64498491-64498513 ATACAAACTTACAGCTAGATAGG + Intergenic
1054513984 9:66017872-66017894 ATACAAACTTACAGCTAGATAGG - Intergenic
1054718737 9:68582792-68582814 GTACAAAGTTTCAGTTAGACTGG + Intergenic
1054746590 9:68860151-68860173 GGACAAAATTTCAGTTAGATAGG - Intronic
1054833866 9:69655789-69655811 GAACAAAATTACAGTTAGATAGG + Intronic
1055207818 9:73753552-73753574 ATACAAAATTACAGATAGATAGG + Intergenic
1055345628 9:75334405-75334427 ATACAAAACAACAGCTAGATAGG + Intergenic
1055398603 9:75899491-75899513 GTACAAACTCACAGTTATGTAGG - Intronic
1055460197 9:76512231-76512253 GTACAAACTTTCAGTTATAAGGG - Intergenic
1055879172 9:80978228-80978250 GTACAAAATTACAGTTAGGTAGG - Intergenic
1056937308 9:90925938-90925960 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1057103069 9:92382457-92382479 ATACAAAATTACAGCTAGATAGG - Intronic
1057413889 9:94844597-94844619 GTACACAGTTACAGTTAGACTGG - Intronic
1057462580 9:95276751-95276773 GTACAAAGTTACAGTTAGACAGG + Intronic
1057628066 9:96695470-96695492 ATACAAAAGTACAGCTAGATAGG + Intergenic
1057876577 9:98759870-98759892 ATACAAAACTATAGCTAGATAGG + Intronic
1057992898 9:99790777-99790799 GTACAAAAATATAGTTAGATAGG - Intergenic
1058077452 9:100665399-100665421 GTACAAAATTACAATTAGAAAGG - Intergenic
1058241910 9:102573309-102573331 GTACAAAGTTACAGTTAGATAGG + Intergenic
1058313075 9:103530417-103530439 GTACAAACCTTCAGTTAGATAGG + Intergenic
1058382826 9:104396655-104396677 GTACAAAGTTTCAGTTAGATAGG + Intergenic
1058920977 9:109614634-109614656 GTACAAACTTGCAGTTATGTAGG + Intergenic
1059209420 9:112498846-112498868 ATACAAAATTACAGCTAGATAGG - Intronic
1059509541 9:114831312-114831334 GTACAAAGTTACAATTAGATAGG - Intergenic
1059608753 9:115868796-115868818 ATACAAAATTACAGCTAGATAGG + Intergenic
1059787658 9:117603668-117603690 ATACAAAAGTACAGCTAGATAGG + Intergenic
1059845769 9:118274898-118274920 GTGCAAACATACAGTTTGAATGG + Intergenic
1059934809 9:119299187-119299209 ATACAAAATTTCAGTTAGATAGG - Intronic
1060227778 9:121805861-121805883 ATACAAAATTACAGCTAGATAGG + Intergenic
1060329575 9:122654618-122654640 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1060595742 9:124847590-124847612 GTACAAAAATACACTTAGATAGG - Intergenic
1060686805 9:125622169-125622191 GTACAAAATTATAGCTAGATAGG + Intronic
1185785119 X:2884240-2884262 GTACAAAATTACAGCTAGATAGG + Intergenic
1185828699 X:3277461-3277483 GTACAAAGTTTCAGTTAGACAGG + Intronic
1186028459 X:5340203-5340225 GTACAAACTTTCTGTTGGATTGG + Intergenic
1186032178 X:5380192-5380214 ATACAAACTTACAGCTAGATAGG + Intergenic
1186649933 X:11548358-11548380 ATACAAACTTACATCTAGATAGG - Intronic
1186934761 X:14436284-14436306 GTACAAAGTTACAATTAGATAGG - Intergenic
1186957501 X:14699672-14699694 GTACTATGTTACAGTTAGATAGG - Intronic
1187136116 X:16549156-16549178 GTATAAAGTTACAATTAGATAGG - Intergenic
1187596579 X:20779018-20779040 GTACAAACATACAGTTAGAAAGG + Intergenic
1187650446 X:21397636-21397658 ATACAAAATTACAGTCAGATGGG + Intronic
1187837615 X:23450769-23450791 TTACAAAGTTACACTTAGATAGG + Intergenic
1187894863 X:23971266-23971288 GCACAAACATACAATTAGATAGG - Intergenic
1188013960 X:25087378-25087400 GCACAAACTTGCAGTTATATAGG - Intergenic
1188121468 X:26313809-26313831 GTACAAAGCTACAATTAAATAGG - Intergenic
1188175671 X:26985776-26985798 GTACAATGTTACAGTTAGACAGG + Intergenic
1188248555 X:27863384-27863406 GTACAAAATTTCAGTTAGATGGG + Intergenic
1188284077 X:28306575-28306597 ATACAAAATTTCAGTTAGATAGG - Intergenic
1188447835 X:30275030-30275052 ATACAAAGTTACAGTTAGATAGG + Intergenic
1188469668 X:30523961-30523983 ATACGAAATTACAGTTAGATAGG - Intergenic
1188579703 X:31695810-31695832 GTACAAAGTTCCAGTTAGACAGG + Intronic
1188619129 X:32197937-32197959 ATACAAAATTTCAGTTAGATAGG - Intronic
1188722318 X:33538233-33538255 GAACAAACTTGCAGTTATATAGG + Intergenic
1188731940 X:33659145-33659167 GTACAAAGTTATAGCTAGATAGG - Intergenic
1188899834 X:35717071-35717093 ATACAAAGTTTCAGTTAGATAGG - Intergenic
1188951832 X:36385576-36385598 ATACAAAATTTCAGTTAGATAGG - Intergenic
1188995297 X:36877541-36877563 ATACAAAGTTTCAGTTAGATGGG + Intergenic
1189081182 X:37974080-37974102 GTACAAAGTTGCAGTTATATAGG + Intronic
1189147386 X:38668992-38669014 GTACAAAGTCACAGCTAGATAGG + Intronic
1189163053 X:38830839-38830861 GTACAAAATTACAGTCAGATAGG + Intergenic
1189224938 X:39404823-39404845 GTACAAAGTTTCAGTTAGACAGG - Intergenic
1189407417 X:40737249-40737271 GTACAAAGTTTCAGTTAGATAGG - Intergenic
1189422436 X:40868142-40868164 GGACAAAGTTACAGTTAGATAGG - Intergenic
1189814694 X:44812875-44812897 ATACAAAATTACAGCTAGATAGG - Intergenic
1189844562 X:45121907-45121929 GTACAAAGTTTCAGTTAGGTAGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1189862077 X:45283017-45283039 GTACAAAACTATAGTTAGATAGG + Intergenic
1189876596 X:45442561-45442583 GTACAAAGCTACAATTATATAGG - Intergenic
1190133801 X:47775500-47775522 ATACAAACATACAGTTAGATAGG + Intergenic
1190154724 X:47980336-47980358 GTGCAAAGATATAGTTAGATAGG + Intronic
1190258651 X:48784174-48784196 GTACAAAGCTACAGTTAGATAGG + Intergenic
1190395699 X:49979884-49979906 ATACAAAATTTCAGTTAGATAGG - Intronic
1190512584 X:51188848-51188870 GTACAAAATTTCAGTTAGAAAGG + Intergenic
1190574602 X:51820859-51820881 GTACAAAATTACAGTTAAATAGG - Intronic
1190582306 X:51901184-51901206 GTACAAAGTTTCATTTAGATAGG - Intronic
1190687180 X:52885665-52885687 ATACAAAATTACAGTTTGATAGG - Intergenic
1190698802 X:52970127-52970149 ATACAAAATTACAGTTTGATAGG + Intronic
1190905930 X:54728215-54728237 GTACAAATTTACAGTTAGACAGG + Intergenic
1190957834 X:55213369-55213391 CTACAAAATTACAGTTAGATAGG - Intronic
1190977865 X:55424727-55424749 TTACAAAATTTCAGTTAGATAGG + Intergenic
1191708849 X:64125584-64125606 GTACATAGCTTCAGTTAGATAGG + Intergenic
1191767801 X:64719207-64719229 ATACAAAATTACAGCTAGATAGG + Intergenic
1192637746 X:72835702-72835724 GTACAAAGTTCCAGTTAGACAGG + Intronic
1192637889 X:72837059-72837081 GTACAAACTTTCAGCTAGACAGG + Intronic
1192643825 X:72883756-72883778 GTACAAACTTTCAGCTAGACAGG - Intronic
1192643968 X:72885113-72885135 GTACAAAGTTCCAGTTAGACAGG - Intronic
1192688753 X:73336257-73336279 ATACAAAATTTCAGTTAGATAGG + Intergenic
1192911621 X:75610623-75610645 ATACAAAGTTACAGTTAGACAGG + Intergenic
1193143251 X:78051720-78051742 GTACAAAGATACAATTAGATAGG - Intergenic
1193302970 X:79914642-79914664 ATACAAAACTACAGTTAGATAGG - Intergenic
1193304824 X:79936177-79936199 ATACAAAGCTACAGTTAGATAGG - Intergenic
1193344961 X:80394970-80394992 GTCCAAAGTTACAATTAGATAGG - Intronic
1193436910 X:81485202-81485224 ATACAAAATTACAGCTAGATGGG + Intergenic
1193443751 X:81574569-81574591 GTATAAACATACAGTTAGAGAGG + Intergenic
1193623128 X:83781785-83781807 GTACAAAGTTACAATTAGAAAGG + Intergenic
1193664121 X:84295262-84295284 ATACAAAATTACAGTTATATAGG - Intergenic
1193693929 X:84682549-84682571 GTACAAAACTTGAGATAGATCGG + Intergenic
1193792569 X:85833383-85833405 GTACAAAGTTTCAGTTAGATAGG + Intergenic
1193847049 X:86485412-86485434 GTACAAACCTACAGTTAGATAGG + Intronic
1194234377 X:91364132-91364154 GTACAAACATACAGTTAGATAGG - Intergenic
1194726206 X:97400634-97400656 GTACAAAGTTCCAGTTAGACAGG - Intronic
1194753482 X:97709826-97709848 ATACAAAATTTCAGTTAGATTGG - Intergenic
1194855951 X:98928810-98928832 ATACAAAATTACAGTTAGATAGG + Intergenic
1194906345 X:99580925-99580947 GTAAAAAAATACAGTTAGATAGG - Intergenic
1195073843 X:101307080-101307102 ATACAAAATTACAGTTAGAGAGG + Intergenic
1195142983 X:101982268-101982290 CTACAAACCTACAGTAATAAAGG + Intergenic
1195400904 X:104459942-104459964 GTACAAACATACAGTTCTGTAGG + Intergenic
1195407347 X:104529938-104529960 GTATAAAGTTACAATTAGATAGG + Intergenic
1195457609 X:105086506-105086528 GTATAAAGTTTCAGTTAGATAGG + Intronic
1195501559 X:105606936-105606958 ATACAAACCTACAACTATATAGG + Intronic
1195565401 X:106333919-106333941 GTACACACCTACACTCTGATGGG - Intergenic
1195602170 X:106762212-106762234 GTACAAACTTACAGTTAGGCAGG - Intronic
1195612209 X:106880576-106880598 GTACAAAGTTACAGTTAGATAGG + Intronic
1195712233 X:107782572-107782594 GTTCAAAGCTTCAGTTACATGGG - Intronic
1195761587 X:108252083-108252105 GTATAAACTTATAGTTAGATAGG - Intronic
1195811742 X:108841104-108841126 ATACAAAGTTTCAGTTAGATAGG - Intergenic
1196029522 X:111081110-111081132 GTATAAAGTTTCAGTTAGATAGG + Intronic
1196164516 X:112523927-112523949 ATACAAAATTCCAGTTAGATAGG - Intergenic
1196558045 X:117114348-117114370 ATATAAAACTTCAGTTAGATGGG + Intergenic
1196575231 X:117309342-117309364 GTAAAAACCTACAGTTAGATAGG + Intergenic
1196642711 X:118081693-118081715 GTACCAACATACAGTTAAATAGG - Intronic
1196927126 X:120644617-120644639 ATACATATTTACAGTTAGATAGG + Intergenic
1196981962 X:121224264-121224286 GTACAAAAATACAGTTAGATAGG - Intergenic
1197133629 X:123035047-123035069 ATACACAACTACAGCTAGATAGG + Intergenic
1197303595 X:124812035-124812057 ATAAAAACTTACAGTTAGATAGG + Intronic
1197308278 X:124871102-124871124 GTACAAAGTTACAATTAAATAGG - Intronic
1197390156 X:125853432-125853454 GTACAAAGGTACAGTTAGAAAGG - Intergenic
1197476789 X:126934709-126934731 GTACAAAATTTCAGTTAGACTGG + Intergenic
1197494763 X:127164121-127164143 GGACAAAGTTACAGTTAGATAGG + Intergenic
1197653440 X:129089941-129089963 AGACAAAACTACAGCTAGATAGG + Intergenic
1197670031 X:129266639-129266661 ATACAAAGTTTCAGTTAGATAGG - Intergenic
1198121915 X:133602293-133602315 ATACAAAATTACAGCTAGATAGG + Intronic
1198143371 X:133828717-133828739 GTATAAAGATTCAGTTAGATAGG + Intronic
1198609290 X:138379752-138379774 GTACAAAGTTTCAGTTACATAGG + Intergenic
1198632827 X:138660703-138660725 GTACAAAAATATAGTTAGATAGG - Intronic
1198698313 X:139367804-139367826 GTACTAAGTTTCAGTTAGATAGG - Intergenic
1198885503 X:141331516-141331538 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1198993986 X:142551792-142551814 GTACAAGGCTACAGTTACATAGG + Intergenic
1199019536 X:142861161-142861183 GTACAAAGTTTCAGCTAGATAGG - Intergenic
1199055001 X:143283319-143283341 GTACAAAGCTTAAGTTAGACAGG + Intergenic
1199132840 X:144213512-144213534 GTACAAAGTTTCAGTTAGACAGG + Intergenic
1199140994 X:144312109-144312131 GTACAAAAAAATAGTTAGATAGG + Intergenic
1199406358 X:147466071-147466093 GGACAAAGTTACAGTTAGGTAGG + Intergenic
1199528830 X:148824314-148824336 GTACAAACTTTCAGTTATGTAGG + Intronic
1199554770 X:149094597-149094619 ATACAAAATTACAGTTAGGTAGG + Intergenic
1199687624 X:150278761-150278783 ATACAAAATTACAGCTAGATAGG - Intergenic
1199756350 X:150868596-150868618 ATACAAAATTACAGCTAGATAGG - Intronic
1199926355 X:152469340-152469362 ATACAAAGCTTCAGTTAGAAAGG + Intergenic
1200177782 X:154129387-154129409 GTACAAAATAACAATTAGATGGG + Intergenic
1200381330 X:155840502-155840524 TTACAAAATTACAGCTAGATAGG + Intergenic
1200972175 Y:9164333-9164355 TTACATGCCTGCAGTTAGATAGG + Intergenic
1201014315 Y:9583503-9583525 ATACAAAATTTCAGTTAGATAGG + Intergenic
1201357037 Y:13108423-13108445 ATACAAATATACAGTAAGATAGG - Intergenic
1201722888 Y:17121044-17121066 GTACAAAGATGCACTTAGATAGG - Intergenic