ID: 1193859983

View in Genome Browser
Species Human (GRCh38)
Location X:86653379-86653401
Sequence ATGTCTAAAAGCGTGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193859978_1193859983 24 Left 1193859978 X:86653332-86653354 CCGTGTAATATAATTCGAAGGCA 0: 1
1: 2
2: 56
3: 1060
4: 14480
Right 1193859983 X:86653379-86653401 ATGTCTAAAAGCGTGGTGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193859983 Original CRISPR ATGTCTAAAAGCGTGGTGGA AGG Intronic
901825327 1:11857748-11857770 ATGACTAACAGGGTGGTGGGTGG - Intronic
905037510 1:34927700-34927722 ATGCCTAAAAGAGTGGGGGGTGG - Intronic
907294753 1:53443312-53443334 ATGTCTAAATCCCTGGGGGAGGG + Intergenic
910699091 1:90053102-90053124 ATCTCTAAAAAGGTGGTGGGGGG - Intergenic
924687543 1:246310516-246310538 ATGTCTAAGAGAGTTGTGAAAGG + Intronic
1065082403 10:22141143-22141165 ATCTCTCCAAGCGAGGTGGAAGG - Intergenic
1065699776 10:28413805-28413827 AAGACTAAAAGCATGGTGCATGG + Intergenic
1065709685 10:28503591-28503613 ATGTTTAAAACTGTGATGGAAGG - Intergenic
1069140060 10:64811263-64811285 ATTTCTCATAGAGTGGTGGAAGG + Intergenic
1073802799 10:107061450-107061472 ATGTCGAAAAACCTGATGGATGG - Intronic
1076332469 10:129680556-129680578 ATGTCTTAAGGAGTGGTGGGTGG - Intronic
1078827770 11:14947110-14947132 AAGTTTAAAACCTTGGTGGATGG + Intronic
1081012025 11:37825453-37825475 ATGTCTAAAAGGTTTGTGGAAGG - Intergenic
1081590877 11:44422263-44422285 ATGTCAAAAAGGGAGGAGGAGGG + Intergenic
1087896377 11:103590877-103590899 ATCTCTAAAAGCATGGAGCAGGG - Intergenic
1094322679 12:29202771-29202793 AAGTTTACAAGCATGGTGGAAGG - Intronic
1097724397 12:63058334-63058356 ATGTCTAAAAGGCTGGTGGGAGG + Intergenic
1098010998 12:66051789-66051811 ATGTTTTAAAATGTGGTGGAAGG - Intergenic
1103525924 12:121568309-121568331 AAATATAAAAGCGTGGTGGCGGG + Intronic
1108941689 13:55963669-55963691 CAGTCTAAAAGTGTGGTGGGGGG - Intergenic
1112756305 13:102638176-102638198 ATGTTTAAAAGAGCGGGGGAAGG - Intronic
1117445911 14:55803801-55803823 GTGTCTAGATGGGTGGTGGAAGG + Intergenic
1120445702 14:84592417-84592439 ATATTTGAAAGCGTGGAGGATGG + Intergenic
1122250953 14:100439271-100439293 TTGTCAGAATGCGTGGTGGATGG + Intronic
1123783996 15:23650494-23650516 ATGACCAACAGCATGGTGGACGG - Intergenic
1127546564 15:59998820-59998842 ATTTGCAAAAGGGTGGTGGAAGG - Intergenic
1140905811 16:79408098-79408120 AAACCTAAAGGCGTGGTGGAGGG + Intergenic
1142601643 17:1055941-1055963 ATGTCTAAAGGCGTGCTGGCAGG + Intronic
1147512208 17:41080706-41080728 ATGTCTAAAGGCTTTATGGAAGG + Intergenic
1152449408 17:80367423-80367445 ATTTCTTAAAGCTTGGTGGGGGG + Intronic
1153328388 18:3846428-3846450 ATGCCTAAAAGCGTGATTGCTGG - Intronic
1156816522 18:41317801-41317823 CTGTCTAAATGCCAGGTGGAAGG - Intergenic
1158509520 18:58078232-58078254 ATTTCTAAAAGCTTGTTAGATGG + Intronic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1164850791 19:31482522-31482544 AAGTCTAAAATCATGGTGGAAGG + Intergenic
928571422 2:32613069-32613091 ATGTGTAAAGGCCTGGAGGAGGG - Intronic
930876160 2:56219635-56219657 ATCTCTAAAAGCATGGGGGAGGG - Intronic
932233616 2:70103144-70103166 ATTTCTCAAAGAGTGGTGGGGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
939328117 2:140721798-140721820 ATGTCAAAAGCCGAGGTGGACGG - Intronic
941230690 2:162908311-162908333 ATATTTGAAAGAGTGGTGGAAGG - Intergenic
943347064 2:186751624-186751646 CTATCTAAAAGCGTGGTTTAAGG + Intronic
943806010 2:192127093-192127115 CTGTCAGAAAGCCTGGTGGAGGG - Intronic
946096465 2:217278757-217278779 AAGTTTAAAATCATGGTGGAAGG + Intergenic
1175014892 20:55778979-55779001 ATGCCAAAAAGCTTGTTGGAAGG - Intergenic
1176956887 21:15115856-15115878 ATATTTAAAAGCCTGGGGGAAGG - Intergenic
1177515553 21:22147186-22147208 ATATTTACAATCGTGGTGGAGGG - Intergenic
1179094552 21:38300636-38300658 ATTTCTAAGAGCTTGGTGTAGGG + Exonic
1182824099 22:33248168-33248190 ATGTCTACAAGTGTTGGGGAAGG - Intronic
956790298 3:72674931-72674953 ATGTGTAAAAGCATCTTGGAGGG - Intergenic
961548078 3:127649976-127649998 ATGTCTAAAACAGAGGTGCAAGG - Intronic
963004670 3:140715333-140715355 ATGTGGAAAAGGCTGGTGGACGG - Intergenic
965922595 3:173936372-173936394 ATTTCTAAACCCGTGGTGTAAGG - Intronic
968699042 4:2046170-2046192 ATGTAGAAAAGCGTGTGGGAGGG + Intergenic
972029539 4:34436298-34436320 AACTCTAAAAGAGGGGTGGAGGG + Intergenic
973205407 4:47554741-47554763 TTGTCTAAAAGCCTGGTGTCTGG - Exonic
974344579 4:60662351-60662373 ATGTTTAAAAGCTCAGTGGAGGG + Intergenic
981720415 4:147796366-147796388 TTTTTTAAAAGCGTAGTGGAAGG + Intronic
984672041 4:182501362-182501384 ATGTCTAAAAGTGGGGGGGGGGG + Intronic
988237151 5:28560790-28560812 ATGTCTAGAAGTGAGGTGTATGG + Intergenic
989711223 5:44399647-44399669 ATGTTTAAGAGCCTGATGGAAGG + Intergenic
990928669 5:61060861-61060883 ATATCTAAGACCGTGGAGGAGGG - Intronic
998672796 5:144372685-144372707 ATGTCTAAAGGCTTGGTGATGGG + Intronic
998767758 5:145507211-145507233 ATGTCTGAATGCGGGGTGGGAGG + Intronic
998964555 5:147525051-147525073 ATGTCTAAAAGTGAGATAGAGGG + Intergenic
1001182920 5:169537805-169537827 ATGTATAAGCACGTGGTGGAAGG + Intergenic
1010636474 6:78264980-78265002 ATGTGGAAAAGCATTGTGGAAGG - Intergenic
1013711497 6:112905541-112905563 ATGTCTAAAAGTGTGGTCTCAGG - Intergenic
1014188486 6:118463384-118463406 ATTTCTAAAATCATGGGGGAGGG + Exonic
1018791291 6:167150096-167150118 ATGTTTAAACTCGTGGTGGTAGG + Intronic
1030842817 7:114377143-114377165 ATGTTTAAAAGAGTGATGGATGG + Intronic
1032283810 7:130526552-130526574 AGGGCAGAAAGCGTGGTGGAAGG + Intronic
1032285359 7:130535362-130535384 AGGGCAGAAAGCGTGGTGGAAGG + Intronic
1032656301 7:133934254-133934276 GTGTCAAAGAGCTTGGTGGAAGG - Intronic
1038380707 8:27090492-27090514 ATGTCTTAGAACGTTGTGGATGG - Intergenic
1040534364 8:48295138-48295160 ATAGCTAAAATCGTGCTGGAAGG - Intergenic
1044339585 8:91031753-91031775 ATTTCTAAAAGCATACTGGAAGG + Intronic
1053053253 9:34978371-34978393 ATGTATATAAGTGTGGTGGCAGG - Exonic
1054928663 9:70614080-70614102 TTGTCTAAAAGTGTGGCTGATGG + Intronic
1058365430 9:104203167-104203189 ATGTGTAAAAGCATGATTGAAGG - Intergenic
1058840453 9:108902470-108902492 ATGCCTATAATTGTGGTGGATGG - Intronic
1059936846 9:119320330-119320352 AAGTCAAAAAGCATTGTGGATGG + Intronic
1186289686 X:8083130-8083152 ATCTCTACAAGAGTGGGGGAGGG - Intergenic
1192263177 X:69520960-69520982 CTGTCTGAAAGTGTGGTTGATGG - Intronic
1193859983 X:86653379-86653401 ATGTCTAAAAGCGTGGTGGAAGG + Intronic
1194484691 X:94472566-94472588 AAGTTTATAATCGTGGTGGAAGG - Intergenic
1194933827 X:99923145-99923167 AGGTTAAAAAGGGTGGTGGAGGG - Intergenic
1202594305 Y:26520979-26521001 CTGTCTGGAAGCGTGGTGGTGGG - Intergenic