ID: 1193862798

View in Genome Browser
Species Human (GRCh38)
Location X:86691778-86691800
Sequence TAGCTAAGGCTGCCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 93}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193862798_1193862800 -9 Left 1193862798 X:86691778-86691800 CCTGTCTGTGGCAGCCTTAGCTA 0: 1
1: 0
2: 3
3: 8
4: 93
Right 1193862800 X:86691792-86691814 CCTTAGCTAACTACTGCATTTGG 0: 1
1: 0
2: 1
3: 12
4: 87
1193862798_1193862802 18 Left 1193862798 X:86691778-86691800 CCTGTCTGTGGCAGCCTTAGCTA 0: 1
1: 0
2: 3
3: 8
4: 93
Right 1193862802 X:86691819-86691841 AGACAGACAGACAGATAGATAGG 0: 8
1: 50
2: 199
3: 917
4: 2714
1193862798_1193862803 24 Left 1193862798 X:86691778-86691800 CCTGTCTGTGGCAGCCTTAGCTA 0: 1
1: 0
2: 3
3: 8
4: 93
Right 1193862803 X:86691825-86691847 ACAGACAGATAGATAGGATGAGG 0: 1
1: 0
2: 5
3: 47
4: 459
1193862798_1193862801 -6 Left 1193862798 X:86691778-86691800 CCTGTCTGTGGCAGCCTTAGCTA 0: 1
1: 0
2: 3
3: 8
4: 93
Right 1193862801 X:86691795-86691817 TAGCTAACTACTGCATTTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193862798 Original CRISPR TAGCTAAGGCTGCCACAGAC AGG (reversed) Intronic
900457221 1:2783164-2783186 CAGCCATGTCTGCCACAGACAGG - Intronic
902669663 1:17964356-17964378 TAGCTAAGGCTGCAGCACAAGGG - Intergenic
903540038 1:24091709-24091731 TAGCTAATGCTGCCACGGACAGG - Intronic
904209493 1:28877321-28877343 TAGGCAAGGCTGCCCGAGACCGG + Intergenic
905514578 1:38552848-38552870 CAGCTCAGGCTGCCATAAACTGG + Intergenic
907117882 1:51985757-51985779 TAGCTGTGACTGCCACAGATAGG + Intronic
908551599 1:65214054-65214076 TTGCTAGGGCTGCCACAGACTGG - Intronic
910492670 1:87789732-87789754 GAGCTAAGACTGGCATAGACTGG + Intergenic
911660394 1:100495309-100495331 TAGCTTAGATTGCCAGAGACTGG - Intronic
912687365 1:111778025-111778047 TGGCTAAGGCTGCCAGAGTGAGG + Intronic
920125514 1:203691124-203691146 TAGCTAAGGCTTCCCCAACCTGG + Intronic
1064251608 10:13710447-13710469 CAGCTACAGCAGCCACAGACGGG - Intronic
1067789957 10:49280286-49280308 TACCTAATGCTGCCAAAGATGGG + Intergenic
1071079990 10:81799297-81799319 AGGCTGAGGCTGCCAGAGACTGG + Intergenic
1071399144 10:85252538-85252560 TACCTAAAGCAGCTACAGACAGG + Intergenic
1071940988 10:90591745-90591767 TACCTAAGTATGCAACAGACAGG - Intergenic
1072461879 10:95626412-95626434 TACCTAATTCTGCCACATACTGG - Intronic
1073047315 10:100647298-100647320 CCCCTAAGGCTGTCACAGACTGG + Intergenic
1074765869 10:116699597-116699619 TAGGTCAGGATGCCACAGACGGG - Intronic
1075062302 10:119265641-119265663 CAGCTCAGGCTGCCATAGACTGG - Intronic
1080310528 11:30886399-30886421 CTGCTCAGGCTGCCACAAACTGG + Intronic
1095294051 12:40508295-40508317 TAGCTCAGTGGGCCACAGACAGG - Intronic
1095649321 12:44588323-44588345 TGGCTCAGGCTGCCTCAGAGAGG - Intronic
1096181711 12:49554763-49554785 AGGGTAAGGCTGCCTCAGACAGG - Intronic
1099580170 12:84435996-84436018 TAGCCAAGGCTCCCACTGAGAGG - Intergenic
1104458106 12:128932155-128932177 GAGCTAAAGCTTCCCCAGACGGG - Intronic
1106231863 13:27826775-27826797 TAGCTATGGCGGCCACGCACAGG - Intergenic
1107028079 13:35823997-35824019 AAGGTAAGGCTGCTACACACAGG + Intronic
1110867879 13:80418292-80418314 TAGTAAAGGCTGCTGCAGACTGG - Intergenic
1112195250 13:97219413-97219435 CAACTCAGGCTGCCATAGACTGG + Intergenic
1114841000 14:26261634-26261656 TAGCTAAGGATATTACAGACAGG - Intergenic
1122885881 14:104710068-104710090 TAGCTGGGGATGGCACAGACAGG - Exonic
1124377772 15:29139646-29139668 GAGCAGAGGCTGCCACACACTGG + Intronic
1128589584 15:68883200-68883222 CTGCTAAGGCTGCCACTGTCAGG + Intronic
1133449226 16:5889694-5889716 TAGCATGGGCTGCCACGGACAGG - Intergenic
1134687832 16:16171026-16171048 TAGCTTAGGGTGCCAGAGAAAGG - Intronic
1146802587 17:35838524-35838546 CAGCTAAGGCAGCCATTGACTGG + Exonic
1151480763 17:74369001-74369023 GTGGTAAGGCTGCCACAGACAGG - Intronic
1153736464 18:8074186-8074208 TTGCTAAGACTACCACAGATTGG - Intronic
1156369233 18:36457780-36457802 TAGCTCAGGATGTCACAGCCTGG + Intronic
1158154358 18:54408738-54408760 TAGGGAAGGCTACCATAGACTGG + Intergenic
1158769389 18:60496181-60496203 TAGCTAATGCTACCACACTCAGG - Intergenic
1160313877 18:77822204-77822226 TCACTGAAGCTGCCACAGACGGG - Intergenic
1162041809 19:7975300-7975322 GAGCTGAGGCTGGCACTGACTGG + Intronic
928334988 2:30390326-30390348 TAGCCATGGCTCCCACTGACTGG - Intergenic
929770285 2:44885960-44885982 CAACTAAGGCTGCCACATGCAGG - Intergenic
930949639 2:57124393-57124415 TAGCTGAGGCAGCCAGAGAAGGG - Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
935697583 2:105783465-105783487 GAGCTAAGTCTGGCTCAGACAGG - Intronic
939070412 2:137533720-137533742 TAGCCTGGGCTGCCACTGACAGG + Intronic
939837542 2:147149801-147149823 TTGCTGCGGCTGCTACAGACAGG - Intergenic
939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG + Intergenic
941203956 2:162548292-162548314 TCCCTAAGGCTGCCAGAGGCAGG + Intronic
942234580 2:173891508-173891530 TAGATAAGGCAGCCACATAGGGG + Intergenic
1172920217 20:38474595-38474617 AAGCTAATGCAGCCAGAGACAGG - Intronic
1174287947 20:49485126-49485148 TCTCTAAGGATGCCACAGATGGG + Intergenic
1175068143 20:56308051-56308073 CAGCTAGGGTTGCCACAGGCTGG - Intergenic
1176044846 20:63087219-63087241 GAGCTCTGGATGCCACAGACAGG - Intergenic
1176732705 21:10516809-10516831 TAGCTAAGGCAGTCAAAGAAAGG - Intergenic
1177407364 21:20687220-20687242 TAGCTCAGACTGCCATAAACTGG - Intergenic
1181171687 22:21013622-21013644 TAGCTAATCCTGCCAGAGTCAGG + Intronic
1181177605 22:21046507-21046529 TAGCTAATCCTGCCAGAGTCAGG - Intronic
951609598 3:24477662-24477684 TAGCTAACGCTGCCAAAGCAAGG + Intronic
961524841 3:127490225-127490247 CTGCTCAGGCTGCCATAGACTGG - Intergenic
962377490 3:134870602-134870624 TATCTAATGCTGCCCCAGATTGG + Intronic
964687800 3:159416849-159416871 TACCTGAGGCTGCATCAGACAGG + Intronic
967682990 3:192386960-192386982 TAGGTAAGGAAGCAACAGACAGG - Intronic
967880005 3:194295074-194295096 TATTTAAGGCTGCCCCAGAGAGG - Intergenic
968539604 4:1157989-1158011 AAGCTATAGCTGCCACAGATAGG - Intergenic
969279840 4:6162337-6162359 CAGCTAAGGCAGCCAGAGCCTGG + Intronic
970589620 4:17547893-17547915 GTGCTAGGGCTGCCACAGACTGG - Intergenic
975793367 4:77980596-77980618 TTGCTAAGTCTGCTACAGATAGG - Intergenic
977609519 4:99017793-99017815 TGGCATTGGCTGCCACAGACTGG + Intronic
979252726 4:118582221-118582243 CAACTCAGGCTGCCATAGACTGG + Intergenic
986336919 5:6762279-6762301 TACCAAAGTCTGTCACAGACAGG + Intergenic
986836182 5:11640417-11640439 TCCCTAAGGTTGCCACACACTGG + Intronic
987492167 5:18594926-18594948 TATCTAAGGCTGCATCAGCCTGG + Intergenic
998494617 5:142576974-142576996 TAGCTAAAGGTTCCACAGATAGG - Intergenic
1002680005 5:180954443-180954465 AAACTAAAGCAGCCACAGACAGG + Intergenic
1003105298 6:3210691-3210713 TAGCTCAGCCTCCTACAGACTGG - Intergenic
1006283911 6:33078586-33078608 TTGCTAAGGGTTCCACAAACAGG + Intronic
1006896191 6:37472619-37472641 GAGCTAAGGCTGCCACAGGTGGG + Intronic
1007621128 6:43215289-43215311 TCGCTCTGGCTGCCACAGAAAGG - Exonic
1011167575 6:84466652-84466674 TAGCTCAGGCAGCCACATTCAGG - Intergenic
1011239499 6:85255936-85255958 TAGCTCAGGCTGACATAGGCTGG - Intergenic
1011759460 6:90545684-90545706 TAGCTGTGTCTGCCACAGATGGG - Intronic
1012406794 6:98909892-98909914 TAGCTAAAGTTGCCACATAAAGG - Intronic
1012900347 6:104997782-104997804 TAGCTAAGGCTGACACTTCCGGG + Intronic
1019628393 7:2033047-2033069 CAGCTGACGCTGCCACTGACTGG + Intronic
1024301445 7:47890297-47890319 TAGCTAAAGCTGGCACAGCCGGG - Intronic
1027857974 7:83537233-83537255 TAGCTCAAGCTACCACAGAATGG - Intronic
1032420220 7:131772963-131772985 TGACTAAGGCTGCCACAAGCAGG + Intergenic
1034596880 7:152204709-152204731 TAGCTAAGGCAGTCAAAGAAAGG + Intronic
1036404203 8:8440670-8440692 TAGAAAAGGCTGCCTAAGACTGG + Intergenic
1043928711 8:86066525-86066547 TAGCTAAGGATGACAGAGAATGG + Intronic
1044942157 8:97354295-97354317 GAGCTAAGGCTGGCAGAGAAAGG - Intergenic
1045981904 8:108199604-108199626 AATCGAATGCTGCCACAGACTGG + Intergenic
1051799728 9:20918958-20918980 TAGCTACGGCTGCCACAGGCTGG + Intronic
1053105647 9:35405736-35405758 GGACTGAGGCTGCCACAGACAGG + Intergenic
1059415753 9:114161626-114161648 GGGCTAAGGCTGGGACAGACAGG - Intronic
1060898683 9:127238290-127238312 TAGCTGTGGCAGCCACAGCCAGG - Intronic
1187333086 X:18358382-18358404 TAACTAAGCCTGGCAGAGACTGG + Intergenic
1189198789 X:39174296-39174318 CAGCTAGGGCTGCCACAGCCAGG + Intergenic
1191940338 X:66473095-66473117 TAGCTAAGGGAGTCACAGAAAGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic