ID: 1193862800

View in Genome Browser
Species Human (GRCh38)
Location X:86691792-86691814
Sequence CCTTAGCTAACTACTGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193862798_1193862800 -9 Left 1193862798 X:86691778-86691800 CCTGTCTGTGGCAGCCTTAGCTA 0: 1
1: 0
2: 3
3: 8
4: 93
Right 1193862800 X:86691792-86691814 CCTTAGCTAACTACTGCATTTGG 0: 1
1: 0
2: 1
3: 12
4: 87
1193862797_1193862800 -5 Left 1193862797 X:86691774-86691796 CCATCCTGTCTGTGGCAGCCTTA 0: 1
1: 0
2: 3
3: 37
4: 226
Right 1193862800 X:86691792-86691814 CCTTAGCTAACTACTGCATTTGG 0: 1
1: 0
2: 1
3: 12
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193862800 Original CRISPR CCTTAGCTAACTACTGCATT TGG Intronic
906648112 1:47490665-47490687 CCATAGCAAACTACTGAAGTAGG - Intergenic
909191692 1:72560297-72560319 TCTTAGCTGACTTCTGCATTTGG + Intergenic
910436117 1:87207883-87207905 CCCTAGCTAACTAATACAGTTGG + Intergenic
910436135 1:87208064-87208086 CCCTAGCTAACTAATACAGTTGG + Intergenic
920580268 1:207100141-207100163 CCTTAGACAACCACTACATTTGG - Intergenic
1064070117 10:12221534-12221556 CCTTTGCCAACTACTGGATTAGG - Intronic
1078019727 11:7646038-7646060 TCTTAGCAAATTACTGCTTTTGG - Intronic
1078255779 11:9657674-9657696 CCTTAGCAAACTAATACAGTTGG - Intergenic
1080402209 11:31946698-31946720 CCTTAGGTAACTACTTCATTTGG - Intronic
1081369674 11:42284450-42284472 CCCTAGCAAACTAATACATTAGG - Intergenic
1087216069 11:95496375-95496397 CCTTGGCTTCCTATTGCATTTGG - Intergenic
1088646199 11:111918563-111918585 GCTGAGCAAACTACTACATTAGG + Intronic
1096884649 12:54704664-54704686 CCTTAGCTGAAAATTGCATTAGG + Intergenic
1100504233 12:95204382-95204404 CCTTTGCTAACTGCATCATTCGG - Intronic
1102616569 12:114159816-114159838 CTTTAGCTAACTTCTGTCTTGGG - Intergenic
1107033990 13:35881596-35881618 CCTTAGCTGACTGCAGCACTTGG + Intronic
1107502611 13:40995829-40995851 CCTTTGATAAATCCTGCATTTGG - Intronic
1111572513 13:90105974-90105996 TCTTAACCAATTACTGCATTTGG - Intergenic
1114253217 14:20979444-20979466 CCATAGATAGCCACTGCATTAGG + Intergenic
1115253693 14:31376025-31376047 CCATAGCTCAGAACTGCATTTGG + Intronic
1115654744 14:35432439-35432461 CCTTGAATAACCACTGCATTCGG + Intergenic
1116944928 14:50827937-50827959 CCTGAGTTAACTACTTGATTGGG - Intronic
1117530855 14:56659323-56659345 TCTTTGTTAACTACTGCTTTAGG + Intronic
1127336862 15:57995341-57995363 CCTTTCCTCAATACTGCATTTGG - Intronic
1128192217 15:65713172-65713194 TCTTAACTAAGCACTGCATTTGG + Intronic
1133431597 16:5741893-5741915 CTTTTGCTAAATACTGCATATGG + Intergenic
1137089210 16:36167411-36167433 CATTAGATGACGACTGCATTCGG + Intergenic
1137091301 16:36194762-36194784 CATTTGCTGACTACTGCATTCGG + Intergenic
1143743097 17:8968073-8968095 TCTTACCTCACTACAGCATTTGG + Intergenic
1147125682 17:38366457-38366479 CATTAGCTAAATTCTGTATTCGG + Intronic
1150677707 17:67259143-67259165 CTTTGGCTAACTACTGAATCTGG + Intergenic
1150897265 17:69226810-69226832 TCTTAGCTAACTTCTGTGTTGGG - Intronic
926965506 2:18405511-18405533 CCTTAGTTAAGGCCTGCATTGGG + Intergenic
927384951 2:22522102-22522124 CCTTAGCAAACTAATGCAGGAGG - Intergenic
928107720 2:28482480-28482502 CCTTAGCTCATTACTGAGTTGGG + Intronic
928815779 2:35292997-35293019 ACTTAGCTAGCTGCTGCATGTGG - Intergenic
931212369 2:60209479-60209501 CCTTGGATGACGACTGCATTGGG - Intergenic
938817719 2:134921150-134921172 CATTAGTTCACTACTGCCTTTGG - Intronic
940243281 2:151586593-151586615 CCTTAGCTAACTACTCAATCTGG + Intronic
940244237 2:151597146-151597168 CCTTAGCTAACTACTCAATCTGG + Intronic
940245193 2:151607692-151607714 CCTTAGCTAACTACTCAATCTGG + Intronic
940647749 2:156409230-156409252 CTCTAGCAAACTAATGCATTAGG + Intergenic
941582661 2:167318682-167318704 CCTTAGCCAACGAGTGCAGTTGG - Intergenic
946107067 2:217380186-217380208 CCTTAGCCTACGACTCCATTTGG - Intronic
949079356 2:242084521-242084543 CCTGAGCTGACTACTGCCTTTGG + Intergenic
1169316675 20:4597509-4597531 CCTTAGCAAACTAAGGCATGTGG + Intergenic
1174683307 20:52429289-52429311 CCCTAGCAAACTAATACATTAGG - Intergenic
1179412208 21:41170538-41170560 GCTTTCCTGACTACTGCATTAGG + Intronic
1181527143 22:23496462-23496484 CCTTAGATCACTACTGCTGTGGG - Intergenic
1181689276 22:24549375-24549397 CCTGAGCTAACTCCTGCCCTTGG + Intronic
949416179 3:3816716-3816738 CCTTGGTTAACTAGAGCATTAGG - Intronic
952983051 3:38753970-38753992 CTTTAGATAAAAACTGCATTAGG + Intronic
956521925 3:70114037-70114059 CCTGAGCTGACTAATGCAATAGG + Intergenic
958774297 3:98462744-98462766 CCTTGGCTGACCACTGCAGTGGG + Intergenic
963930366 3:150998361-150998383 CCTTAGCTGACTACGGCAAGGGG + Intergenic
967933018 3:194704052-194704074 CCTAGGCTAACTCTTGCATTTGG + Intergenic
971023201 4:22559784-22559806 CCTTAGCAAACTAATGCAGTAGG - Intergenic
971259904 4:25046617-25046639 CCCTAGCAAACTAATGCACTTGG - Intergenic
975995338 4:80307633-80307655 ACTCAGCCAGCTACTGCATTAGG - Intronic
978450724 4:108830245-108830267 CCTTAGCTGATTTCTTCATTTGG - Intronic
979295260 4:119025501-119025523 CCTTTGCTTTCAACTGCATTTGG - Intronic
979887275 4:126045049-126045071 CCTTAACAAAGTAATGCATTTGG + Intergenic
980528594 4:134020949-134020971 TCCTAACTAACTACTTCATTTGG + Intergenic
987805715 5:22763913-22763935 CTTTAGCCAATTACTGCATAGGG - Intronic
993063678 5:83072847-83072869 CCTTTGATAACCACTTCATTAGG - Intronic
1004133030 6:12939267-12939289 CCTTAGGTAACTGATGCCTTAGG + Intronic
1005140729 6:22628504-22628526 CCTTAGCAAACTAATGCAGGAGG - Intergenic
1006572607 6:35017989-35018011 CCTTATCCAACTGCAGCATTGGG + Exonic
1009881123 6:69567487-69567509 CCCTAGCTAACTAATACACTTGG - Intergenic
1011707906 6:90021823-90021845 CTTTAGCTATCTAAGGCATTAGG - Intronic
1014428332 6:121335768-121335790 AATTGTCTAACTACTGCATTAGG + Intergenic
1014710060 6:124796145-124796167 CCCTAGCTAACTAATTCATGGGG - Intronic
1014995311 6:128135647-128135669 TCTTAGCTAAATCCTGCACTAGG + Intronic
1015448529 6:133336973-133336995 CCTTGGCTAACTACAGCTGTTGG + Intronic
1015448602 6:133337963-133337985 CCTTGGCTAACTACAGCTGTTGG - Intronic
1016601611 6:145867953-145867975 CCCTAGCAAACTAATGCACTTGG - Intronic
1020255453 7:6500718-6500740 CCTTACCTAGCTTCAGCATTAGG + Intronic
1023774182 7:43588027-43588049 ACTTAGCTTTCTAATGCATTTGG - Intronic
1024387533 7:48770087-48770109 CCTTAGCTAACTGGTGATTTTGG - Intergenic
1025640018 7:63357736-63357758 CCTTGGCTTCCTACTGCATTAGG + Intergenic
1025642681 7:63390356-63390378 CCTTGGCTTCCTACTGCATTAGG - Intergenic
1025711941 7:63919887-63919909 CCTTGGCTTCCTACTGCATTAGG - Intergenic
1027536605 7:79411064-79411086 CCTTAGAGAAATATTGCATTCGG + Intronic
1030235808 7:107260878-107260900 ACTTAGCTAACTATTGGACTTGG - Intronic
1035537507 8:403609-403631 CCTGAGCTGAGTACTGCGTTTGG + Intergenic
1036463103 8:8971773-8971795 GTTAAGCTAACTACTGGATTAGG - Intergenic
1039135804 8:34321597-34321619 CCTTAATTAAGTACAGCATTAGG - Intergenic
1042854059 8:73247205-73247227 CCTTAGCAAACTAATGCAGGAGG - Intronic
1043199598 8:77350060-77350082 CCCTAGCAAACTAATACATTTGG - Intergenic
1044012685 8:87013914-87013936 ATTTAGCTAACTACTGCCTAGGG + Intronic
1047646140 8:126872190-126872212 CCTGTGCTAACTACCTCATTAGG + Intergenic
1047711468 8:127556685-127556707 GCTTTGCTGACTACTGCTTTAGG - Intergenic
1053946765 9:43317673-43317695 CATTAGATGACGACTGCATTCGG + Intergenic
1054997229 9:71406446-71406468 CCTTAGCTAAATACTGAGATTGG - Intronic
1058133097 9:101275584-101275606 CCCTGGCTAACTACTGCCTCAGG + Intronic
1060864648 9:126986075-126986097 CCTCAGTTATCAACTGCATTTGG - Intronic
1203589895 Un_KI270747v1:46231-46253 CATTAGATGACGACTGCATTCGG + Intergenic
1186524064 X:10231894-10231916 CCTAAGCTAACTATTACATTGGG + Intronic
1186701808 X:12098637-12098659 CCATAGCTAACTATTTCTTTGGG - Intergenic
1193862800 X:86691792-86691814 CCTTAGCTAACTACTGCATTTGG + Intronic
1199706118 X:150426868-150426890 CCCTAGCAAACTAATACATTGGG - Intronic