ID: 1193862801

View in Genome Browser
Species Human (GRCh38)
Location X:86691795-86691817
Sequence TAGCTAACTACTGCATTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193862798_1193862801 -6 Left 1193862798 X:86691778-86691800 CCTGTCTGTGGCAGCCTTAGCTA 0: 1
1: 0
2: 3
3: 8
4: 93
Right 1193862801 X:86691795-86691817 TAGCTAACTACTGCATTTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 80
1193862797_1193862801 -2 Left 1193862797 X:86691774-86691796 CCATCCTGTCTGTGGCAGCCTTA 0: 1
1: 0
2: 3
3: 37
4: 226
Right 1193862801 X:86691795-86691817 TAGCTAACTACTGCATTTGGAGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193862801 Original CRISPR TAGCTAACTACTGCATTTGG AGG Intronic
910501705 1:87900039-87900061 TAACCAACTACTGAATTTGTTGG + Intergenic
915701750 1:157803102-157803124 TAGTTATCTCCTGCAGTTGGAGG + Intronic
918441265 1:184569531-184569553 TAGACAACTACTTAATTTGGAGG + Intronic
918665665 1:187147423-187147445 TAGCTAAGTATTTCATTTTGGGG + Intergenic
923614833 1:235528384-235528406 TAGTTTATTACAGCATTTGGTGG + Intergenic
1065873315 10:29974922-29974944 TAGCTAACTGCTTCTTTGGGGGG - Intergenic
1078342894 11:10513153-10513175 TAGCTAACTACTCCCTATGGAGG - Exonic
1081029092 11:38055471-38055493 TAGCTACCTACTGTAATAGGAGG - Intergenic
1081369672 11:42284447-42284469 TAGCAAACTAATACATTAGGAGG - Intergenic
1088862098 11:113810162-113810184 CATTTAACCACTGCATTTGGCGG + Intronic
1093430431 12:19079172-19079194 TACCTAACTAATACATTTAGTGG - Intergenic
1095596082 12:43959909-43959931 TAGCTAAACACAGCATTTAGGGG + Intronic
1098544707 12:71699025-71699047 TGGCCAATTATTGCATTTGGTGG + Exonic
1099592065 12:84606059-84606081 TAGCTGATTACTGCAGATGGAGG - Intergenic
1101346859 12:103894061-103894083 TAGCTAACTACTGGAGGTGGTGG + Intergenic
1101765762 12:107697890-107697912 TAAATAGCTACTGTATTTGGAGG - Intronic
1102745587 12:115246139-115246161 TAACAAAGTACTGCATATGGTGG - Intergenic
1106675979 13:31958470-31958492 TAACCAACTGCTGCCTTTGGAGG + Intergenic
1115928063 14:38459747-38459769 TAGGTAACTACTGCATATATAGG + Intergenic
1120361704 14:83512815-83512837 TTGTACACTACTGCATTTGGTGG - Intergenic
1121039302 14:90731864-90731886 TATCCAACTGCTGCACTTGGAGG + Intronic
1122530369 14:102421292-102421314 TATCTGATTACTGCCTTTGGTGG - Intronic
1124869980 15:33530941-33530963 TATCAAAGCACTGCATTTGGTGG - Intronic
1126233043 15:46349867-46349889 GAGTTAAGTACTGAATTTGGGGG + Intergenic
1126657638 15:50996433-50996455 TAGGTGACTTCTGAATTTGGAGG + Intronic
1129543326 15:76369658-76369680 TAGCAAATTACTGGATTTCGTGG + Intronic
1133578704 16:7121476-7121498 TAGCTAAGTATTGCATTTTTTGG - Intronic
1135254399 16:20929314-20929336 AAGCCAACTACTTCATCTGGTGG + Intergenic
1138022514 16:53497388-53497410 TTGCTAAGTCCTGCCTTTGGGGG + Intronic
1144017750 17:11212691-11212713 TTACTAACTATTGAATTTGGAGG - Intergenic
1144319487 17:14100322-14100344 TAGTTCACTGCTGTATTTGGGGG - Intronic
1146512837 17:33465237-33465259 TAGGAAACTTCAGCATTTGGAGG - Intronic
1150180492 17:63114399-63114421 CAGCCAACTACTTCATCTGGTGG - Intronic
1153341274 18:3977634-3977656 CAGCTAGCTGCTGCCTTTGGAGG + Intronic
1155429787 18:25743245-25743267 CAGCTACCTAATGCATTGGGTGG + Intergenic
1159990280 18:74899127-74899149 TGGCTCCCTACTGCTTTTGGAGG - Intronic
927443534 2:23137824-23137846 TAAATAACTAATGCATTTGGGGG - Intergenic
929343286 2:40849352-40849374 TAGCAAACTACTGAATTTCCTGG + Intergenic
929651592 2:43685229-43685251 TAGCTGAGTACTGCTTTTAGTGG - Intronic
933557726 2:83851305-83851327 TAGCTCATAACTGCATTCGGCGG + Intergenic
942095589 2:172534279-172534301 TAGCTCATACCTGCATTTGGTGG - Intergenic
945513338 2:210729918-210729940 TAAATTCCTACTGCATTTGGTGG - Intergenic
1174349968 20:49960059-49960081 TAGCAAACTACTGCATATTCAGG - Intergenic
1178092050 21:29174297-29174319 AAGATAACAACTGAATTTGGGGG + Intronic
1182378508 22:29867108-29867130 TAGGAAACTAGTGCATTTGCAGG - Intergenic
951549865 3:23866183-23866205 GAGCTATTTACTGCACTTGGGGG - Intronic
952783534 3:37129003-37129025 TAGCCAAGTACTGATTTTGGGGG + Intronic
956633302 3:71337530-71337552 TAGCTATGTAATGTATTTGGGGG - Intronic
957764632 3:84606931-84606953 TTAATAACTACTGCATTTGTTGG - Intergenic
960125292 3:113991916-113991938 TACCTAACTACTGCATTTTTGGG - Intronic
960162107 3:114361739-114361761 TTGCTACCTTCTGCATTTGAGGG - Intronic
963405439 3:144857223-144857245 TAGCAAACTACTGCATATACAGG - Intergenic
967910766 3:194540870-194540892 TAGCTGACTATTAAATTTGGGGG + Intergenic
971895352 4:32586107-32586129 TGGCTAACTTCTGCTTCTGGGGG + Intergenic
975502730 4:75104599-75104621 TTGTTAACCACTGAATTTGGGGG + Intergenic
977080539 4:92522014-92522036 AAACTAACTAGTGCTTTTGGGGG + Intronic
979278772 4:118841273-118841295 TAGCCAAAGACTGCACTTGGTGG + Intergenic
989839013 5:46036403-46036425 TAGCTAAATACTTCATTTGTTGG + Intergenic
991115334 5:62947685-62947707 AAACTAAAGACTGCATTTGGTGG - Intergenic
992927967 5:81610067-81610089 TAGCTTATACCTGCATTTGGCGG - Intronic
996051867 5:118943585-118943607 TTGTTAACTACTCCATTTGGTGG - Intronic
997950952 5:138242149-138242171 TAACTGACAACTGCATTAGGCGG + Intergenic
1004088007 6:12470985-12471007 TAGGTCACTAGCGCATTTGGCGG + Intergenic
1004303092 6:14476133-14476155 TAGCCAGTTACAGCATTTGGGGG + Intergenic
1008376958 6:50802728-50802750 TAGCCAACAATTTCATTTGGTGG - Intergenic
1012042594 6:94228329-94228351 TACCTAACTACTGTATTTTAAGG - Intergenic
1013944369 6:115704377-115704399 TAGCTTTCTACTGCATCTGCAGG + Intergenic
1017254609 6:152318937-152318959 TAGCTAACTTCTGAATTTGCCGG + Exonic
1018413015 6:163574364-163574386 TAGCTAACTACTCCTATTAGGGG + Exonic
1021277880 7:18677665-18677687 CAGCTAATGACTGCATTAGGTGG + Intronic
1024370515 7:48578478-48578500 TAGCTAAGTATTTCATTTTGGGG - Intronic
1030840166 7:114341747-114341769 TAGCTAACTACACCATTTTAAGG + Intronic
1032866754 7:135933587-135933609 TAGGTAAATACTGCTCTTGGTGG + Intronic
1034004576 7:147456126-147456148 TGGCTAAATACTGCTTTTGATGG - Intronic
1034544198 7:151779270-151779292 CAGCTCAGTACAGCATTTGGTGG - Intronic
1041036472 8:53796275-53796297 TAGCCAATTACTGAATTCGGGGG + Intronic
1041402673 8:57461653-57461675 TATCTATCTACGGCATTTGTAGG - Intergenic
1043659535 8:82720259-82720281 TAACTAATTACTGCATTTGCTGG - Intergenic
1046285876 8:112092430-112092452 TACCTAATCACTGCAGTTGGTGG - Intergenic
1048133511 8:131722946-131722968 TAGCTAATTTCTAAATTTGGAGG - Intergenic
1050599346 9:7234845-7234867 TAGCAAAATAATGCATGTGGGGG - Intergenic
1055990886 9:82104357-82104379 GAGCTATTTTCTGCATTTGGGGG + Intergenic
1057137252 9:92701286-92701308 TACCTAATTATTTCATTTGGGGG + Intergenic
1186030033 X:5358270-5358292 TAGTAAACTACTGCATTGGTAGG + Intergenic
1188373881 X:29403748-29403770 TTTCTAACTACTGGATTGGGAGG - Intronic
1193404026 X:81080633-81080655 AAGCAAACTAATACATTTGGAGG + Intergenic
1193862801 X:86691795-86691817 TAGCTAACTACTGCATTTGGAGG + Intronic
1200139555 X:153892511-153892533 TTTTGAACTACTGCATTTGGGGG + Intronic
1202054290 Y:20813842-20813864 TGGCTAATTGCTGCCTTTGGAGG - Intergenic