ID: 1193862802

View in Genome Browser
Species Human (GRCh38)
Location X:86691819-86691841
Sequence AGACAGACAGACAGATAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3888
Summary {0: 8, 1: 50, 2: 199, 3: 917, 4: 2714}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193862798_1193862802 18 Left 1193862798 X:86691778-86691800 CCTGTCTGTGGCAGCCTTAGCTA 0: 1
1: 0
2: 3
3: 8
4: 93
Right 1193862802 X:86691819-86691841 AGACAGACAGACAGATAGATAGG 0: 8
1: 50
2: 199
3: 917
4: 2714
1193862799_1193862802 4 Left 1193862799 X:86691792-86691814 CCTTAGCTAACTACTGCATTTGG 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1193862802 X:86691819-86691841 AGACAGACAGACAGATAGATAGG 0: 8
1: 50
2: 199
3: 917
4: 2714
1193862797_1193862802 22 Left 1193862797 X:86691774-86691796 CCATCCTGTCTGTGGCAGCCTTA 0: 1
1: 0
2: 3
3: 37
4: 226
Right 1193862802 X:86691819-86691841 AGACAGACAGACAGATAGATAGG 0: 8
1: 50
2: 199
3: 917
4: 2714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193862802 Original CRISPR AGACAGACAGACAGATAGAT AGG Intronic
Too many off-targets to display for this crispr