ID: 1193862803

View in Genome Browser
Species Human (GRCh38)
Location X:86691825-86691847
Sequence ACAGACAGATAGATAGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 459}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193862798_1193862803 24 Left 1193862798 X:86691778-86691800 CCTGTCTGTGGCAGCCTTAGCTA 0: 1
1: 0
2: 3
3: 8
4: 93
Right 1193862803 X:86691825-86691847 ACAGACAGATAGATAGGATGAGG 0: 1
1: 0
2: 5
3: 47
4: 459
1193862799_1193862803 10 Left 1193862799 X:86691792-86691814 CCTTAGCTAACTACTGCATTTGG 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1193862803 X:86691825-86691847 ACAGACAGATAGATAGGATGAGG 0: 1
1: 0
2: 5
3: 47
4: 459
1193862797_1193862803 28 Left 1193862797 X:86691774-86691796 CCATCCTGTCTGTGGCAGCCTTA 0: 1
1: 0
2: 3
3: 37
4: 226
Right 1193862803 X:86691825-86691847 ACAGACAGATAGATAGGATGAGG 0: 1
1: 0
2: 5
3: 47
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193862803 Original CRISPR ACAGACAGATAGATAGGATG AGG Intronic
900502519 1:3013321-3013343 ACAGAGAGACAGAAAGGAAGAGG - Intergenic
900908619 1:5578272-5578294 AGAGACAGAGAGACAGGAGGGGG - Intergenic
901221687 1:7587088-7587110 ACAGACAGATAGAATGACTGGGG - Intronic
903028540 1:20446507-20446529 ACAGACAGAGAGAGAGGGAGAGG + Intergenic
903814819 1:26057339-26057361 ACAGAAAGAGAGGCAGGATGAGG + Intronic
903854420 1:26328377-26328399 ACAGACAGACAGACAGGTGGAGG + Intronic
904324066 1:29716114-29716136 ACACACAGAAATATAGCATGTGG - Intergenic
904552887 1:31335529-31335551 ACAGAAAAATTAATAGGATGTGG - Intronic
905537310 1:38732566-38732588 ACTTACTGATAGATAAGATGTGG - Intergenic
905863937 1:41366634-41366656 ACAGACCGACAGACAGGGTGAGG + Intronic
907313247 1:53551855-53551877 ACAGACATATACACAGGAGGAGG - Intronic
908168656 1:61483598-61483620 ACAGAAAGAAAGCAAGGATGTGG - Intergenic
908849085 1:68356145-68356167 ATAGATAGATAGATAGAATTTGG - Intergenic
909059701 1:70866087-70866109 TCAGACAGAAAGATATGAAGGGG - Intronic
909132482 1:71755209-71755231 ACAGACTGATAGATTGGAGATGG - Intronic
909227100 1:73039746-73039768 TAAGACAGATAGATATGAAGTGG + Intergenic
909529922 1:76670873-76670895 ACAGACAGACAGAAAGGAAAAGG + Intergenic
909880046 1:80864280-80864302 ACAGACAGACAGACATGATTTGG + Intergenic
910147837 1:84103408-84103430 AGAGACAGAGAGATGGGGTGTGG + Intronic
911127825 1:94357473-94357495 ATAGACAGATAGATAGATAGAGG + Intergenic
911131152 1:94389676-94389698 ACACACAGAAATATAGCATGTGG - Intergenic
912181321 1:107222217-107222239 ACAGAGAGACAGATAACATGTGG - Intronic
912683935 1:111747304-111747326 GCAGACAGATAGATAGGTTGGGG - Intronic
912807518 1:112769429-112769451 TGAGACAGATACATAGGGTGTGG - Intergenic
915015774 1:152731964-152731986 ATAGAGAGATAAATAGGTTGAGG - Intergenic
915329989 1:155105343-155105365 ATAGATAGATAGATAGGATAGGG + Intergenic
915922360 1:159986042-159986064 ACAGATGGATAAACAGGATGTGG + Intergenic
916209310 1:162346997-162347019 ACAGAGAGATAGATAGACTTTGG + Intronic
916745071 1:167678837-167678859 ACAGACAGAAACAAAGGTTGAGG - Intronic
917779622 1:178379384-178379406 AGAGACAGAGAGAAAGGAAGGGG + Intronic
917807539 1:178627183-178627205 ATAGAGAAATAAATAGGATGAGG + Intergenic
917816657 1:178717218-178717240 ACAGACAGAGAGAAAGGGTAGGG + Intergenic
918400116 1:184154463-184154485 GCAGACAGGTAGGCAGGATGAGG - Intergenic
919108642 1:193188934-193188956 ACAGACAGACAGAAAGAAAGAGG - Intronic
919210802 1:194483286-194483308 ACAGACAGAGAGAGAGAATCAGG + Intergenic
919342146 1:196325270-196325292 ACAGACAGGAAGGTAGGAAGTGG - Intronic
919448168 1:197736319-197736341 ACAGACAGGTAGAAAGAATTGGG - Intronic
919559826 1:199102750-199102772 ACACACACATATATATGATGCGG - Intergenic
920457983 1:206115894-206115916 AGAGACAGAAAGAGAGGATGGGG - Intronic
920586494 1:207168211-207168233 ACAGACAGAGAGAGAGAATGAGG - Intergenic
920716841 1:208348156-208348178 ACAGACAGAGAGAGAGAAAGAGG - Intergenic
922923696 1:229330135-229330157 ACAGACAGACAGACACCATGAGG + Intronic
923354513 1:233140862-233140884 ACTGACAGACAGAGAGGAGGGGG - Intronic
923542041 1:234895384-234895406 ACAGACAGACAGACAGAAAGAGG + Intergenic
924360755 1:243239320-243239342 AAAGAAAGATATTTAGGATGTGG - Intronic
924517027 1:244774755-244774777 ACACACAGAAATATAGGGTGTGG - Intergenic
1064949874 10:20836548-20836570 TGAGACAGACAGATAGGAGGGGG + Intronic
1065014594 10:21450324-21450346 ACAAAATGATAGATAGGATGAGG + Intergenic
1065432256 10:25671628-25671650 ACAGAGAGAAAGATAGGGTCAGG + Intergenic
1065623019 10:27602443-27602465 AGAGTCAGATATTTAGGATGGGG + Intergenic
1065829288 10:29599777-29599799 ACGGTCAGATAGACAGGATATGG + Intronic
1067031709 10:42882460-42882482 ACAGACAGATGAAAAGGAGGGGG + Intergenic
1067171760 10:43912588-43912610 ACAGACAGAGAGATGGGGTCAGG - Intergenic
1067342417 10:45416676-45416698 ACAGGCAGATGGATGGGTTGAGG + Intronic
1067460517 10:46454878-46454900 ACTCACCGATAGATTGGATGAGG + Intergenic
1067626675 10:47929725-47929747 ACTCACCGATAGATTGGATGAGG - Intergenic
1068244832 10:54351118-54351140 AAAGATAGATAGATAGTAGGTGG + Intronic
1068301493 10:55147840-55147862 ACAGAAAGATAGACAGGAAGAGG - Intronic
1068358972 10:55951187-55951209 ACAAATAGATATATAGGTTGAGG + Intergenic
1070574150 10:77664702-77664724 ATTGAGAGATAGGTAGGATGAGG + Intergenic
1070574973 10:77670843-77670865 ACAGAGAGACAGAGAGAATGAGG + Intergenic
1070812398 10:79305053-79305075 CCAGAGAGAAAGATAGGCTGTGG - Intronic
1071753245 10:88505472-88505494 ACAGAAAGAGAGAGAGGAGGAGG + Intronic
1072331569 10:94358796-94358818 ACACACAGGTAGATAGAAAGTGG - Intronic
1072788185 10:98298823-98298845 ATAGATAGATAGATAGGAGATGG + Intergenic
1072922299 10:99586328-99586350 ACAGTCAGAGAGGTAGGGTGAGG - Intergenic
1074313604 10:112343048-112343070 ACAGAAAGAGACATAGGAAGAGG - Intergenic
1075166391 10:120071732-120071754 ACAGACTAATACAGAGGATGAGG - Intergenic
1078412192 11:11133823-11133845 ACAGATAGATAGATGAGAAGGGG + Intergenic
1078437482 11:11337578-11337600 ACAGAGAGATATTTAGGAGGGGG + Intronic
1078476742 11:11636675-11636697 AAAGACAGAAAGACAGGATTTGG - Intergenic
1080584805 11:33672188-33672210 CCAGGCAGATAGATAGGCAGAGG - Exonic
1080844395 11:36014286-36014308 ACAGACAGATAGACAGAGAGAGG + Intronic
1083928982 11:65828626-65828648 ACAGACACACAGAGAGGAGGAGG - Intronic
1084097695 11:66922744-66922766 ACAGACAGCTGGAGAAGATGAGG + Intronic
1084961580 11:72719659-72719681 ATAGACAGAAAGATAGGAACGGG - Intronic
1085819085 11:79772758-79772780 ACAGAGAGATAGACAGGGAGAGG + Intergenic
1085836319 11:79960847-79960869 ATAAACAAATAAATAGGATGAGG + Intergenic
1085840195 11:80002608-80002630 ACATACAGATATATAGGACTTGG - Intergenic
1087461301 11:98452297-98452319 ACAGAGAGAGAGAGAGGAGGAGG - Intergenic
1090893412 11:130948001-130948023 ACAGACAGAGAGAGAGAAAGAGG + Intergenic
1091026399 11:132145464-132145486 ACAGACAGAAAGACATGATGAGG + Intronic
1091110331 11:132960585-132960607 ACAGACAGATGGAGAGGGGGAGG - Intronic
1091690292 12:2591639-2591661 ACAGAGAGAGAGAGAGCATGAGG + Intronic
1092391360 12:8082748-8082770 AGAGAGAGAGAGAAAGGATGAGG - Intronic
1093401878 12:18755407-18755429 ACAGACTGAGAGATTTGATGTGG + Intergenic
1093999658 12:25681200-25681222 ACAGAGGCAGAGATAGGATGTGG + Intergenic
1094147992 12:27250673-27250695 ACACACAGGTAGATAGTAAGTGG + Intronic
1094158756 12:27367577-27367599 ACAGAAAAATAGAAAGGAAGGGG - Intronic
1094206611 12:27846933-27846955 ACAGACACATAGACCAGATGTGG - Intergenic
1096088421 12:48882234-48882256 AGAGACAGAGAGATGGGAGGAGG + Intergenic
1097534551 12:60850189-60850211 ATAGATAGATAGATATAATGGGG - Intergenic
1097546984 12:61015533-61015555 AAAGACACATAGATAAGAAGTGG + Intergenic
1098820039 12:75215742-75215764 ATAGATAGATAGATAGTAGGTGG + Intergenic
1099548887 12:84018379-84018401 ACAGACAGAAAAATTGGATAAGG + Intergenic
1099800835 12:87454509-87454531 ACAGCCAGATACATAGGCAGGGG + Intergenic
1099910173 12:88821396-88821418 GCAGACAGATAGATACAAGGGGG + Intergenic
1100126829 12:91437037-91437059 ACAGACAGACACATGGGGTGAGG - Intergenic
1100495218 12:95118366-95118388 AGAGAGAGAGAGAAAGGATGAGG + Intronic
1100514968 12:95318648-95318670 TCACACAGGTAGATAGGGTGGGG - Intergenic
1100746335 12:97650351-97650373 ACAGAAAGCTAGACTGGATGTGG + Intergenic
1101387039 12:104267283-104267305 ACAGACAGACAGACAGAAAGAGG - Intronic
1101830646 12:108253846-108253868 AGAGAGAGAGAGAGAGGATGGGG + Intergenic
1102696843 12:114806717-114806739 ATGGACACATAGACAGGATGTGG + Intergenic
1102736133 12:115161573-115161595 ACAGATAGATAGATAGACAGTGG - Intergenic
1102800239 12:115726103-115726125 ACAGACAGAGAGGTAGGATAAGG + Intergenic
1103583655 12:121935245-121935267 AGAGAAAGAGAGATCGGATGCGG - Intronic
1104066534 12:125311482-125311504 ACTCACTGATTGATAGGATGTGG - Intronic
1104157236 12:126145154-126145176 ACAGACGCACAGATAGGACGGGG - Intergenic
1104388620 12:128373148-128373170 GCAGAGAGATAGAAAGAATGTGG - Intronic
1104489994 12:129185688-129185710 ACAGACAGATAGATAAGATATGG - Intronic
1104700649 12:130901364-130901386 ACAGACAGACAGATAGGGCCAGG - Intergenic
1105643901 13:22295921-22295943 GAAGACACATAGCTAGGATGTGG + Intergenic
1105668508 13:22587040-22587062 ATAGATAGATAGATATGTTGGGG - Intergenic
1105842990 13:24271870-24271892 ACAGACAGAAAGCAGGGATGTGG + Intronic
1106124103 13:26886002-26886024 ACAAAGAGAGAGATTGGATGGGG + Intergenic
1106385985 13:29286635-29286657 ACAGACAGATAGATAGTGCATGG - Intronic
1106416827 13:29552831-29552853 ACACACAGAAATATAGAATGTGG - Intronic
1106661481 13:31804587-31804609 ACAGATGCATAGTTAGGATGTGG - Intergenic
1107445706 13:40468629-40468651 ACAGACAGATAGATACAAATAGG - Intergenic
1108802007 13:54109514-54109536 ACAGAAAGATAGACAACATGGGG - Intergenic
1109041745 13:57347491-57347513 ATAGATAGATAGATAAGAGGAGG + Intergenic
1109397714 13:61782390-61782412 AAAGACAGAAAGAGAGAATGTGG - Intergenic
1109504001 13:63274694-63274716 ACAGACAGTGAGCTAGGCTGTGG - Intergenic
1109791966 13:67260523-67260545 AGAAACAGAAAGTTAGGATGAGG - Intergenic
1110382160 13:74865292-74865314 AGGGACAGATAGATATCATGTGG - Intergenic
1111627358 13:90806496-90806518 ACAGAGAGATTGTTAGCATGGGG - Intergenic
1111770381 13:92588625-92588647 ACAGACACATAGAAAGGACAGGG - Intronic
1111926522 13:94469058-94469080 ACAGAAAGATGGAAAGGAAGGGG + Intronic
1112027486 13:95424947-95424969 ACAGAAAGAGATAAAGGATGGGG + Intergenic
1112046182 13:95600636-95600658 ACAGACAGACAGACAGGCTTAGG + Intronic
1112262196 13:97887209-97887231 ACAGACAGAGAGATAGAGTAGGG + Intergenic
1112376694 13:98848844-98848866 ACTGACAGCTACACAGGATGGGG - Intronic
1113982577 13:114288709-114288731 ACCGACAGACGGATAGGGTGTGG + Intronic
1114375193 14:22138707-22138729 ACAGACAGATTGATAGGGTCAGG + Intergenic
1114677668 14:24454955-24454977 ACATACAGAAATATAGGGTGTGG + Intergenic
1116149132 14:41116229-41116251 ACAGACAGACAAAAAGGAGGAGG + Intergenic
1117160971 14:52989212-52989234 ACAGACAGAAAGAAAAAATGTGG + Intergenic
1117322038 14:54633626-54633648 GCTGACAGATACAAAGGATGGGG + Intronic
1117322212 14:54634702-54634724 ACAGATAGATAGATAGATAGAGG - Intronic
1117387567 14:55231371-55231393 AGAGAAAGAAAGAAAGGATGTGG - Intergenic
1117894669 14:60470743-60470765 ACAGAAAGCAAGGTAGGATGTGG + Intronic
1118000216 14:61516115-61516137 TCAGACAGACAGATGAGATGTGG + Intronic
1118509764 14:66459019-66459041 CCAGAAAGATAGGTAGGGTGAGG - Intergenic
1118895474 14:69942114-69942136 ACAAACAAACAGATAGGATATGG - Intronic
1119293206 14:73512367-73512389 AAAGAGAGATAGATACGATGGGG - Intronic
1119583637 14:75811328-75811350 ACAGACAGATAAACAGCTTGGGG - Intronic
1119960491 14:78850145-78850167 ACAGAGAGAGAGAGAGGAAGAGG + Intronic
1120421182 14:84287876-84287898 ACACACAGAAATATAGCATGTGG - Intergenic
1120458433 14:84761971-84761993 ACATACAGACAGATAGACTGAGG - Intergenic
1122561658 14:102619424-102619446 ACAGACAGATAGATAGATAGAGG - Intronic
1124020795 15:25921182-25921204 ACACACAGAAATATAGCATGTGG + Intergenic
1124098201 15:26669091-26669113 ACAGACAGATAGACGGAGTGTGG - Intronic
1124692716 15:31838987-31839009 CCAGACAGATAGCTGGGTTGGGG + Intronic
1124828172 15:33120718-33120740 ACAGACATATATATAAGATATGG + Intronic
1124854035 15:33369567-33369589 ACAGACAGATAGATAGATGAAGG - Intronic
1124915895 15:33973778-33973800 ATAGACAGATAAATTAGATGTGG - Intronic
1125759423 15:42086893-42086915 ACAGACAGGGAGAGAGGAAGAGG - Intronic
1126579710 15:50231759-50231781 GCAGACAGTCAGATAGGATGAGG + Intronic
1126687656 15:51262357-51262379 ACACACAGAAATATAGCATGTGG - Intronic
1127486406 15:59421700-59421722 ACAGACAGATAGATAGTTTAAGG - Intronic
1128552368 15:68606647-68606669 ACAGAAACATTGAAAGGATGAGG + Intronic
1128652732 15:69431115-69431137 ACTGAGAGCTAGTTAGGATGTGG + Intronic
1128676153 15:69610184-69610206 AGAGAGAGATAGAGAGGATGGGG - Intergenic
1129169659 15:73799827-73799849 AGAGACAGAAAGATAGAAAGTGG - Intergenic
1129973468 15:79801133-79801155 AGAGAGAGAGAGAGAGGATGGGG - Intergenic
1130857798 15:87856730-87856752 ACAGACAGGAAGATAGCTTGAGG + Intergenic
1133233308 16:4376484-4376506 ACAGACAGATAGACAGTCTGAGG - Intronic
1133932835 16:10246132-10246154 AGAGAGAGAGAGAGAGGATGAGG + Intergenic
1133980936 16:10632940-10632962 ACAGACAGAAAGCAAGGAGGTGG - Intronic
1134685492 16:16155349-16155371 ACAGACAGATGGATGGGATGGGG - Intronic
1134797527 16:17055042-17055064 ACAGAAAGAAAGATAGCAAGAGG - Intergenic
1135650750 16:24204306-24204328 ACAATCAGATACATAGTATGAGG + Intronic
1136638708 16:31543316-31543338 ACACACAGAAATATAGCATGTGG - Intergenic
1136659156 16:31740139-31740161 ACACACAGAAATATAGCATGTGG - Intronic
1137689751 16:50414685-50414707 AGAGACAGAGAGAGAGGAAGGGG - Intergenic
1137695188 16:50456778-50456800 TCAGAAAGATGGAGAGGATGAGG - Intergenic
1137792642 16:51187652-51187674 GGAGGCAGATAGATAGGATGTGG - Intergenic
1138302266 16:55941764-55941786 ACAGGCACATAGATAGCATAAGG + Intronic
1138839131 16:60476767-60476789 ACAGATAGAGAGATAGGCTTTGG + Intergenic
1139064487 16:63295645-63295667 ACAGAAAGACAGATATGAAGAGG - Intergenic
1139069447 16:63362402-63362424 AGAGACAGACAGACAGAATGAGG - Intergenic
1139478943 16:67217698-67217720 AGAGACACATAGAGAGGGTGTGG - Intronic
1141209566 16:81964704-81964726 AGAGACATATAGATAAAATGCGG + Intergenic
1141789176 16:86221974-86221996 AAAGACTGACAGACAGGATGAGG + Intergenic
1141852876 16:86659400-86659422 ACAGACAGATAGATAGAGATTGG - Intergenic
1142371446 16:89685295-89685317 ACACACAGAAATATAGGGTGTGG - Exonic
1143319115 17:6056530-6056552 AGAGAAAGATAGAGAGGAGGAGG + Intronic
1144561228 17:16321737-16321759 ACAGACAGACAGACAGAAAGAGG - Intronic
1146293925 17:31633526-31633548 ACATACAGAAATATAGGGTGTGG - Intergenic
1146319589 17:31836368-31836390 ACAGACAGACAGTTAGGAAAAGG + Intergenic
1147810442 17:43166119-43166141 ACACACAGAGAGAGAGGAAGAGG - Intergenic
1148163418 17:45465037-45465059 ACAGCCTTATAGCTAGGATGGGG + Intronic
1148555442 17:48576408-48576430 ACAGAAAGAGAAATAGGAGGAGG - Exonic
1148805518 17:50261971-50261993 ACAGACAGAAGGAAAGGCTGGGG - Intergenic
1149090739 17:52775395-52775417 ATAGATAGATAGATAGGGTCAGG + Intergenic
1149503275 17:57171413-57171435 TCAGACAGACAGCAAGGATGGGG - Intergenic
1149854256 17:60066051-60066073 ACAGACAGGAAAATAGGAAGTGG - Intronic
1150780525 17:68117817-68117839 ACAGCCTTATAGCTAGGATGGGG - Intergenic
1151315728 17:73321121-73321143 AAGGACAGAGAGATAGGGTGAGG + Intergenic
1153151252 18:2095960-2095982 AAAGACTGATTGAGAGGATGAGG + Intergenic
1153215948 18:2821281-2821303 ACAGACAGAGAGAGAGAGTGAGG + Intergenic
1153469958 18:5433020-5433042 ACAGACAGATAGGAAAGAGGAGG + Intronic
1153841579 18:9012815-9012837 ACAGACAGACAGAGAGGAGAAGG + Intergenic
1155746414 18:29361090-29361112 ACAGGCAGAGAGAGAGGAAGAGG - Intergenic
1156145256 18:34167564-34167586 ACAGACAGACAGATAGATAGAGG + Intronic
1156457117 18:37301076-37301098 GCAGGCAGATAGAAAGGAAGGGG + Intronic
1156570332 18:38245226-38245248 ACAGATAGGCAGATAGGATGTGG - Intergenic
1156609907 18:38713756-38713778 ACACAGGGATAGACAGGATGGGG + Intergenic
1156929865 18:42628681-42628703 CCAGTCAAATAGATAGGGTGGGG + Intergenic
1158017816 18:52805502-52805524 AGAGCCAGAGAGGTAGGATGAGG + Intronic
1158272835 18:55734991-55735013 ATATACAGAAAGATAGAATGGGG - Intergenic
1158329813 18:56349447-56349469 AGAGAAAGAAAGAGAGGATGAGG - Intergenic
1159138966 18:64369552-64369574 AAAGAAAGAAAGAAAGGATGGGG - Intergenic
1159398982 18:67905193-67905215 AGAGATAGATAGATAGAGTGAGG - Intergenic
1161229350 19:3165161-3165183 AAAAACAGAAAGATAGGATGTGG - Intergenic
1161967781 19:7558105-7558127 GCACACACGTAGATAGGATGCGG + Intronic
1162200729 19:9018240-9018262 GCAGGCAGAGAGAGAGGATGAGG - Intergenic
1163186599 19:15643474-15643496 ACAGATAGATAGATAGAAGAGGG + Intronic
1164053229 19:21600676-21600698 ACAGAAAGAAAGGTAGGAGGGGG - Intergenic
1165939059 19:39406362-39406384 AGAGAGAGATAGACAGGGTGAGG - Intergenic
1166407398 19:42530620-42530642 AAATACAGCTAGATAGGAGGAGG + Intronic
1166573612 19:43816027-43816049 ATAGATAGATAGATAGAGTGGGG - Intronic
1166769595 19:45273255-45273277 ACAGACAGATAGAGCAAATGTGG - Intronic
1167645511 19:50703212-50703234 ACAGACAGAATGACAGGGTGAGG - Intronic
1167677735 19:50898013-50898035 AGAGTCAGAAAGCTAGGATGGGG + Intergenic
1167690277 19:50980738-50980760 AGAGACACAGAGATAGGAGGGGG + Intronic
1168115805 19:54220949-54220971 ACAGACAGAGACAGGGGATGGGG - Intronic
1168185683 19:54698057-54698079 ACAGACAGAGACAGGGGATGGGG + Intronic
925319584 2:2951932-2951954 ACAGACTGATAGGAAGCATGAGG - Intergenic
925828133 2:7870479-7870501 AGAGACAGACAGACTGGATGAGG - Intergenic
926655808 2:15404460-15404482 ACAGAGGGAAAGATAGGAAGTGG - Intronic
926756469 2:16240409-16240431 ACTTACAGATAGATAGCAAGGGG + Intergenic
927292183 2:21415595-21415617 ACAGAGAGAGAGATATGATTTGG + Intergenic
927663436 2:25012297-25012319 ACAGACAGACAGACATCATGGGG + Intergenic
928018550 2:27682033-27682055 ACAGACACAGAGCTATGATGAGG - Intronic
928513144 2:32020265-32020287 ATAGACAGGTAGATAGCTTGAGG + Intronic
928678893 2:33678938-33678960 ATAGACAGATAGATAGAACTAGG - Intergenic
928760852 2:34580427-34580449 ACAAACAGATAAATAAAATGTGG + Intergenic
929137343 2:38637570-38637592 AAAGAAAGAAAGAAAGGATGGGG + Intergenic
929209576 2:39340358-39340380 ACACAGAGAAAGATAGGATTTGG + Intronic
929969053 2:46557866-46557888 ACAGAAAGGTGGATAGGAAGTGG - Intronic
930183139 2:48384936-48384958 ACACACAGAAATATAGCATGTGG - Intergenic
930648993 2:53945479-53945501 ACAGACAGAAAGCTAGAAGGAGG + Intronic
931230852 2:60373169-60373191 AAAGATTAATAGATAGGATGAGG + Intergenic
932461028 2:71882219-71882241 AGAGACAGAGAGAGAGAATGGGG + Intergenic
932793253 2:74673835-74673857 ACAGACAGACAGCTGGGATGGGG - Intronic
933478923 2:82829379-82829401 GCAGACAGATAGAAATAATGGGG + Intergenic
933759314 2:85663214-85663236 ACAGACAGGCAGACAGGATGTGG - Intronic
935150792 2:100433336-100433358 ATAGATAGATAGATAAAATGTGG + Intergenic
935158938 2:100512263-100512285 ACAGACAGCTGGGTAGTATGGGG - Intergenic
935255389 2:101305679-101305701 ACAGACACATACATGGGGTGAGG + Intronic
935496231 2:103784637-103784659 ACAGAAAGATAAATTGGAAGAGG - Intergenic
935532402 2:104250593-104250615 AAAGACAGAAAGAGAGGGTGTGG + Intergenic
935807848 2:106766675-106766697 ACAGACAGACAGAGAGGAGTGGG + Intergenic
936369450 2:111891447-111891469 ACACACAGAAATATAGGGTGTGG - Intergenic
936521537 2:113214900-113214922 ACAGAAAGACAGACAGGTTGAGG - Intergenic
938539051 2:132271193-132271215 ACAGACAGATGGACAGGCAGAGG + Intergenic
938685277 2:133731930-133731952 ACAGACAGGTAGATAGAGTGGGG + Intergenic
938842856 2:135179749-135179771 ACACACACAAAGATAGGAAGAGG + Intronic
939754841 2:146097301-146097323 ACATACAGATATATGGGTTGAGG - Intergenic
940773728 2:157865499-157865521 ACAGACAGATAGGCAGGGCGCGG + Intronic
940860550 2:158766319-158766341 ACAGACAGATGGAGAGGAGGCGG + Intergenic
941108961 2:161396390-161396412 ACAGACAGATAAAGAAAATGTGG + Intronic
942426245 2:175863658-175863680 ACAGCCTGATGGATAGGCTGGGG - Intergenic
942546405 2:177068914-177068936 ATAGATAGATAGATAGGGTTGGG + Intergenic
943516801 2:188898710-188898732 ACAGACATGTAGACAGGAGGTGG - Intergenic
945774064 2:214082527-214082549 ACAGAAAGATGGATAGGACAAGG - Intronic
946699904 2:222401984-222402006 ACACACACACAGATAGGAAGGGG - Intergenic
946839317 2:223804391-223804413 ACAGGAAGATAGAAAAGATGAGG + Intronic
946922393 2:224593200-224593222 AGAGACAGAGACACAGGATGTGG - Intergenic
947269265 2:228315553-228315575 ATAGATAGATAGATAGAATGAGG - Intergenic
948045355 2:234939553-234939575 ACAGATAGATAGCTGGGAAGTGG - Intergenic
948331450 2:237169938-237169960 ACAGACAGACAGAAAGACTGAGG + Intergenic
948704912 2:239783879-239783901 ACAGACAGATAGATAGATAGGGG + Intronic
1170199438 20:13726608-13726630 TTAGACAGATAAATAGTATGAGG - Intronic
1174120044 20:48258185-48258207 AGAGACAGAGAGAGAAGATGGGG - Intergenic
1174332326 20:49830220-49830242 ACAGACAAAAAGATGGGATTTGG + Intronic
1174357263 20:50006757-50006779 ATAGATAGATAGATAGATTGTGG - Intergenic
1174726905 20:52872102-52872124 ACACACATATATATAGGATGTGG - Intergenic
1174750242 20:53104855-53104877 ACAGAAACATGAATAGGATGGGG - Intronic
1175440676 20:58988877-58988899 ACAAACAGCAAGATAGGAGGAGG - Intronic
1175711152 20:61222110-61222132 AGAGTCTGAGAGATAGGATGTGG + Intergenic
1175899983 20:62356166-62356188 ACAGACAGATGGTTGGGATGGGG - Intronic
1175989014 20:62778339-62778361 ACCATCAGATAGATAGGCTGGGG - Intergenic
1176023626 20:62974915-62974937 ACCCACAGATAGATAAGTTGCGG - Intergenic
1176982672 21:15401152-15401174 AAACACATATAGAAAGGATGAGG - Intergenic
1177630154 21:23716073-23716095 CCTGAAAGATAGACAGGATGTGG + Intergenic
1177684348 21:24417370-24417392 ACAGACAGAGAGGCAGGGTGAGG - Intergenic
1177720405 21:24899262-24899284 ACAGACAGAGAGACAGAAAGAGG + Intergenic
1177995721 21:28094842-28094864 ACAGACAGATAGATGGTAGATGG + Intergenic
1178056704 21:28807336-28807358 ACACACAGATGGATTGGATATGG - Intergenic
1178246966 21:30962325-30962347 GCAGACAGAAAAAGAGGATGTGG - Intergenic
1179193377 21:39142458-39142480 ACAGAGAGAGAGAGAGAATGGGG - Intergenic
1179426806 21:41286508-41286530 ACAGACACATAGATGGGATCAGG - Intergenic
1179453605 21:41482670-41482692 ACCGACTCACAGATAGGATGTGG - Intronic
1180012688 21:45061415-45061437 ACAGACAGATAGATAAAGAGGGG - Intergenic
1180862067 22:19089220-19089242 AAAGACAGAGAGAGAGGAAGGGG + Intronic
1182766361 22:32760725-32760747 ACAGACAGGGAGAGAAGATGAGG + Intronic
1183746441 22:39694536-39694558 AGAGACAGAAAGACAGGAAGAGG - Intergenic
949500908 3:4679278-4679300 ACATACAGATAGACAAGAGGGGG + Intronic
951033801 3:17910902-17910924 ATAGATAGATAGATAGGAGATGG - Intronic
951503236 3:23414043-23414065 AGACACAGATAAATGGGATGAGG - Intronic
951991070 3:28676868-28676890 ACAAAGAGGTACATAGGATGAGG + Intergenic
954579416 3:51695194-51695216 ACAGAAGGATAGATAGGACTGGG + Intronic
955359649 3:58262384-58262406 CTAGACAGAGACATAGGATGAGG + Intronic
955945142 3:64186734-64186756 ACAGGCAGATAAATAGATTGAGG + Intronic
956226473 3:66964808-66964830 AAAGTCAGAAAGATAGGCTGGGG - Intergenic
956331542 3:68115760-68115782 ACACACAAAAAAATAGGATGGGG - Intronic
956750942 3:72343534-72343556 ACAGACAGAGAGATAGAAGATGG - Intergenic
956867233 3:73381863-73381885 AGATAAAGATAGATAGGATTAGG - Intergenic
957862627 3:85975041-85975063 ACAGATAGATAGATAGATAGAGG + Intronic
958799328 3:98737349-98737371 AGAGACAGAGAGACAGGAAGGGG - Intronic
958852789 3:99349026-99349048 ACAAACAGACAGAAAAGATGAGG + Intergenic
959292760 3:104495320-104495342 GCACACAGCTAGATAGAATGTGG + Intergenic
959409560 3:106003612-106003634 ACATCCAGATGGACAGGATGAGG + Intergenic
960477038 3:118143227-118143249 ACAGACAGGCAAATAGGATAAGG - Intergenic
960519602 3:118639716-118639738 ATAGATAGATAGATAAGATAGGG + Intergenic
960628005 3:119700453-119700475 CCAGTCAGATATCTAGGATGGGG + Intergenic
962743764 3:138382296-138382318 ACAGACAGCAAGAGAGGATTTGG - Intronic
962898183 3:139734713-139734735 ACAGGGAGATAAATAAGATGGGG + Intergenic
963553950 3:146761695-146761717 AGAGAGAGATAGAGAGGAAGAGG + Intergenic
963609942 3:147454162-147454184 CCTGACAGATAAATAGGATGTGG + Intronic
964197549 3:154082082-154082104 ACACACAGAAATATAGGATGTGG + Intergenic
964764861 3:160169892-160169914 ACAGATAGAAAGATAGGAGGTGG - Intergenic
965005922 3:163023491-163023513 AAAGACATATAGATAGAATTAGG - Intergenic
966880500 3:184347251-184347273 ACTGACGGAGAAATAGGATGGGG + Intronic
967080875 3:186048463-186048485 AAAGACAGATACATTGGCTGGGG - Exonic
967282023 3:187832144-187832166 ACAGTGAGAAAGATAGGTTGGGG - Intergenic
967587842 3:191236187-191236209 ACAGAAAGAGAGAAAGTATGTGG - Intronic
969724100 4:8908867-8908889 ACAGACAGACGGACAGGATGAGG + Intergenic
970351945 4:15210107-15210129 TCAGACAGATAGAAAGGGGGAGG + Intergenic
970838685 4:20441475-20441497 AGAGAGAGAGAGATTGGATGAGG - Intronic
972368442 4:38397711-38397733 ACAGACAGATAGAAATGAGAGGG - Intergenic
973727549 4:53791103-53791125 GCAAACAGGTAGATAAGATGAGG - Intronic
974195243 4:58565801-58565823 AGATAGAGAGAGATAGGATGGGG + Intergenic
974255900 4:59454780-59454802 AGAGACAGAGAGATAGCCTGGGG + Intergenic
974332262 4:60495953-60495975 TTAGGCAGATAGAGAGGATGAGG - Intergenic
974867823 4:67602716-67602738 ACAGAGAGAGAGAGAGGAGGTGG - Intronic
975215193 4:71745218-71745240 ACAGACAGATAGTTAGAGTGGGG + Intronic
975225233 4:71863961-71863983 ACACACAGAAATATAGGGTGTGG - Intergenic
975992096 4:80267773-80267795 ACAGACAGATAGATAACTAGGGG + Intronic
976155844 4:82144015-82144037 AGAGAAAGATCGATAGGGTGTGG - Intergenic
976556917 4:86460949-86460971 ACACACAGAAATATAGCATGTGG - Intronic
976557524 4:86466472-86466494 ACACACAGAAATATAGCATGTGG - Intronic
976634435 4:87273572-87273594 ACTGACAGATTGAGAGGCTGAGG - Intergenic
978293554 4:107175655-107175677 ACATCCACATAGAAAGGATGTGG + Intronic
978873452 4:113608199-113608221 ACAGACAGATGGAAAGAACGTGG + Intronic
980093879 4:128469933-128469955 ACAGTCACATAGCTAGGAAGTGG + Intergenic
982109730 4:152042997-152043019 GAAGACACATAGATAGAATGAGG + Intergenic
982603773 4:157486622-157486644 ATAGACAGATAGATATTTTGTGG - Intergenic
982627075 4:157780918-157780940 ATAGATAGATAGATAGAAAGGGG + Intergenic
983081581 4:163391812-163391834 ACACAAATGTAGATAGGATGTGG + Intergenic
983248098 4:165311794-165311816 ACACACAGAGAGAAAGGAGGAGG - Intronic
983613161 4:169672246-169672268 ATAGATAGATAGATAAAATGAGG + Intronic
983827820 4:172286405-172286427 TCATGCAGATAAATAGGATGAGG + Intronic
984169595 4:176344164-176344186 ACACACAGAAATATAGCATGTGG - Intergenic
984170283 4:176350684-176350706 ACATACAGAAATATAGCATGTGG - Intergenic
984515643 4:180735694-180735716 ACAGACAGATAGATAGATAGAGG - Intergenic
984762989 4:183378319-183378341 ACACACAGAAATATAGGGTGCGG + Intergenic
985763368 5:1763334-1763356 ACAGTCAGAGAGAAAGGACGAGG - Intergenic
986149174 5:5111098-5111120 ATAGATAGATAGATAAGAAGGGG - Intergenic
986978889 5:13423421-13423443 TCTGACAGCTAGAAAGGATGTGG + Intergenic
987260036 5:16194175-16194197 ACAAACAGATGGAAATGATGGGG - Intergenic
987923028 5:24308239-24308261 ACAAACAGGTAGTGAGGATGTGG + Intergenic
987975635 5:25011524-25011546 ACAGACAGAATGATAGCATGGGG - Intergenic
989403809 5:41038476-41038498 AAAGAAAGATAGGTAGGATCTGG - Intronic
990121793 5:52463690-52463712 ACAGATAGATGGTTTGGATGGGG - Intergenic
990583625 5:57188975-57188997 ACAGACAGACAGACAGAAAGAGG - Intronic
990669679 5:58114263-58114285 ACAGACAGATAGATAGAAGTTGG + Intergenic
990669829 5:58115604-58115626 ACAGACAGAGAGAAAGGACATGG - Intergenic
991297345 5:65094878-65094900 ACAGATGGATAGATAAAATGAGG + Intergenic
991476339 5:67024086-67024108 AGAGACAGAAAGTTAGAATGGGG - Intronic
993291261 5:86074377-86074399 ACAGAGAGAGAGAGAGGTTGGGG + Intergenic
993957560 5:94254396-94254418 TAAGACAGCTGGATAGGATGAGG - Intronic
994138330 5:96314423-96314445 ACAAATACATAGAAAGGATGAGG - Intergenic
994174169 5:96692732-96692754 ACAGACTGTGAGATGGGATGAGG - Intronic
994368981 5:98947701-98947723 AGATGAAGATAGATAGGATGAGG - Intergenic
994909973 5:105891339-105891361 ATAGATAGATAGATAGCATTTGG - Intergenic
995911529 5:117193490-117193512 ATAGACAGATAAATAAGATATGG - Intergenic
998858993 5:146424760-146424782 ATAGACAGATAGATAGATAGTGG - Intergenic
998908969 5:146937339-146937361 ACAGATAGATAGGTAGTAAGTGG + Intronic
1000776000 5:165420961-165420983 ACAGAGAGAGAGATAGGGAGAGG - Intergenic
1001567318 5:172707935-172707957 AGAGAGAGATGGATAGGATGGGG + Intergenic
1002615643 5:180453706-180453728 ACAGACAGATGGAAAATATGAGG + Intergenic
1003433925 6:6068158-6068180 ACACACAGAAATATAGCATGTGG + Intergenic
1004636883 6:17477537-17477559 ACAGACAGAAAGACAAGAGGAGG - Intronic
1005980523 6:30833031-30833053 ATAGATTGATAGATAGAATGAGG - Intergenic
1008413526 6:51212654-51212676 ACAAATGGAGAGATAGGATGTGG + Intergenic
1008693897 6:54011454-54011476 ACAGACAGACAGACAGAAAGTGG + Intronic
1009980687 6:70722551-70722573 ACAGACAGAAATATAGCCTGTGG + Intronic
1010182428 6:73103065-73103087 ACAGACAGATAAAGAAAATGTGG + Intronic
1010325989 6:74562362-74562384 ACAGACAGACAGATAGAGAGGGG + Intergenic
1010604960 6:77876874-77876896 AAAGACAAATAGAAAAGATGTGG + Intronic
1012701831 6:102467399-102467421 ACAGACAGATAGATAGTAGAAGG - Intergenic
1013465169 6:110411639-110411661 AGAGAGAGATAAATAGGAGGGGG + Intronic
1014665206 6:124229548-124229570 ACAGACAGACAGACAGGGTTTGG + Intronic
1014946879 6:127509334-127509356 ATAGACAGATAGATGTGAGGAGG + Intronic
1014961594 6:127693060-127693082 ACAGACAGATGGGTAAAATGAGG - Intergenic
1015320492 6:131867880-131867902 ACAGACAGATAGATAGATAAGGG - Intronic
1015407594 6:132855191-132855213 AGAGACAGAGAGAGAGGAGGAGG - Intergenic
1015588508 6:134800650-134800672 GCATACAGAGAGAAAGGATGGGG - Intergenic
1016197537 6:141363891-141363913 ACAGACAGATAGATAGATGATGG + Intergenic
1016559544 6:145379289-145379311 AGAGAGAGAGAGAAAGGATGGGG + Intergenic
1017373274 6:153737614-153737636 ACACACAGAAATATAGGGTGTGG + Intergenic
1018765293 6:166928100-166928122 ACAGACAGAGTGAGATGATGGGG - Intronic
1018879049 6:167857207-167857229 AGAGAGCGAGAGATAGGATGGGG + Intronic
1019142107 6:169954928-169954950 ACAGAGAGAAAGATAAGAAGGGG - Intergenic
1019405550 7:882050-882072 GCAGACGGATAAAGAGGATGTGG - Intronic
1020032527 7:4942914-4942936 ACAGAAGTATAGACAGGATGGGG - Intronic
1020929811 7:14378671-14378693 ACAGAAACATATATAGGCTGAGG - Intronic
1020947080 7:14625125-14625147 ACAGACAGATGGATACACTGAGG - Intronic
1021282990 7:18743301-18743323 TCAGACAGCTAGAAAGGAAGTGG - Intronic
1021627943 7:22613103-22613125 ACAGAGAGAGAGAGAGGAGGAGG + Intronic
1021855516 7:24851041-24851063 ACAGGCAGATTGACAAGATGAGG + Intronic
1022275997 7:28855573-28855595 ACTGACAGATAGGAGGGATGAGG - Intergenic
1022604237 7:31792673-31792695 ACACAATGAAAGATAGGATGTGG - Intronic
1023283128 7:38591928-38591950 ACACACAGAAATATAGCATGTGG + Intronic
1023594566 7:41815346-41815368 CCAGATAGAGAGATGGGATGGGG + Intergenic
1024182402 7:46909312-46909334 ACATACCAATAGATAAGATGTGG + Intergenic
1024247917 7:47484473-47484495 ACAGACAGAACCACAGGATGAGG + Intronic
1024322234 7:48082941-48082963 ACACGCAGAGAGCTAGGATGAGG - Intergenic
1025067945 7:55873957-55873979 ACAAACAGGTAGTGAGGATGTGG + Intergenic
1025819708 7:64950713-64950735 ACACACAGAAATATAGCATGTGG - Intergenic
1025825727 7:65008853-65008875 ACAGACAGAGAGACAGGAGTGGG + Intergenic
1025946916 7:66111760-66111782 ACAGACAGAAGGCTAGGTTGGGG - Intronic
1026621941 7:71957233-71957255 TCAGAAAGATTGATAGGAGGTGG + Intronic
1027545861 7:79526736-79526758 ACAGACAGATAAAGAAAATGTGG - Intergenic
1027937501 7:84628564-84628586 ACAGACAGATAGATAGACCAAGG - Intergenic
1028493274 7:91437799-91437821 AAAGACAGATAGATTGGATGTGG + Intergenic
1029197450 7:98815768-98815790 ACAGATAGATAGATAGGAGATGG + Intergenic
1030146058 7:106357232-106357254 ACAGTCACATAGATAGGAAATGG + Intergenic
1030206501 7:106957137-106957159 AGAGAGAGAGAGAGAGGATGAGG + Intergenic
1030384755 7:108855182-108855204 ACAGACACAGACATGGGATGTGG + Intergenic
1031750905 7:125572628-125572650 ACAGACATATTGATTGGCTGGGG + Intergenic
1032518048 7:132521630-132521652 ACAAACACAGAGATAGGGTGAGG - Intronic
1032841767 7:135719861-135719883 ACAGATAGATAGATAGAAAGAGG + Intronic
1033211338 7:139462383-139462405 ACACACAGAGAGAAGGGATGGGG - Intronic
1034822940 7:154233906-154233928 ACAGACAGTGAGAAAGGCTGTGG + Intronic
1034945492 7:155259179-155259201 ACAGAGAGAGAGAGAGGAGGAGG - Intergenic
1035234917 7:157490188-157490210 ACAGACAGATCAATAAAATGTGG - Intergenic
1035647129 8:1233169-1233191 ACAAACAGATAAATACAATGGGG - Intergenic
1036080578 8:5551003-5551025 ACAGACAGGGAGATGGGATGGGG - Intergenic
1036221331 8:6923457-6923479 ACAGTCAGATAGGAAGGGTGGGG - Intergenic
1036589960 8:10160196-10160218 TTAGAAATATAGATAGGATGGGG + Intronic
1038953633 8:32444097-32444119 ACAGACAGACAGAAAGAAAGAGG - Intronic
1040744612 8:50626424-50626446 ACACACAGAAATATAGCATGTGG + Intronic
1041370552 8:57155309-57155331 ACAGACAGACAAATAAAATGTGG - Intergenic
1041414610 8:57594168-57594190 ACAGCAATATAGGTAGGATGTGG - Intergenic
1041682045 8:60603933-60603955 ATAGACAGACAGATAGGGTTTGG + Intronic
1042127342 8:65551641-65551663 ACAGACAAATAGACAGGCAGAGG + Intergenic
1042144222 8:65711495-65711517 ATTGCCAGATAGATAGAATGAGG + Intronic
1042306373 8:67337558-67337580 ACAGAGAGAAAGATGGGAGGGGG - Intronic
1042446280 8:68889096-68889118 ACACACAGAAATATAGGGTGTGG - Intergenic
1042873195 8:73416625-73416647 ACAGAGAGATAGAGAGGGAGAGG + Intergenic
1042939219 8:74090371-74090393 AAATACAAATAGATAGGATTAGG + Intergenic
1044118382 8:88363369-88363391 AATGAAAGATAGATAGGATTTGG + Intergenic
1044305445 8:90635293-90635315 AAGCAAAGATAGATAGGATGAGG + Intronic
1045346974 8:101302156-101302178 ACAGACAGACAGAGAGTATGAGG - Intergenic
1047261555 8:123265899-123265921 AAAAACAGATAGAGAGGATAGGG - Intronic
1047973076 8:130102979-130103001 ACAGACAGCTAGGCTGGATGTGG - Intronic
1048005235 8:130414132-130414154 CCAGACAGAAAGGTAGGAAGAGG + Intronic
1048850818 8:138643662-138643684 ATAGACAGATAGATTGCATAGGG + Intronic
1049007812 8:139866741-139866763 ACAGACAGAAAGAGATGTTGAGG + Intronic
1049229589 8:141475076-141475098 ACAGACAGACACTTAGGGTGAGG - Intergenic
1049785994 8:144451102-144451124 GCAGACACACAGACAGGATGCGG + Intronic
1051175878 9:14359384-14359406 AGAGACATAAAGATAAGATGAGG + Intronic
1051336366 9:16069986-16070008 ACAGACAGATGGACAGGGAGAGG - Intergenic
1051877328 9:21806283-21806305 ACACAGAGATGGATAAGATGTGG + Intronic
1052568847 9:30194640-30194662 ACAGACAGATAGGTAGATAGAGG - Intergenic
1054847920 9:69816682-69816704 ACAGAGAGACAGAGAGGAGGAGG + Intergenic
1055111135 9:72560782-72560804 GCAGACAGATAGAGAAAATGAGG - Intronic
1055331952 9:75194049-75194071 AGAGAGAGATAGAAAGGAGGAGG - Intergenic
1055625423 9:78172546-78172568 ATAGATAGATAGATATAATGGGG - Intergenic
1055625474 9:78173017-78173039 ACACACAGAAAAATAGGGTGTGG - Intergenic
1056777470 9:89524144-89524166 CCAGACAGACAGATAGGAGGAGG + Intergenic
1057777503 9:98022730-98022752 ACAGACAAATAGTTAAGATGAGG - Intergenic
1058187697 9:101874797-101874819 ACAAAGAGATAGATATCATGAGG - Intergenic
1058226266 9:102368306-102368328 ACACACAGAAATATAGGGTGTGG - Intergenic
1059427558 9:114230729-114230751 ACAGATAGAGAGAAAGCATGAGG + Intronic
1060681544 9:125569338-125569360 ACTGAGCGATAGATAGCATGGGG - Intronic
1061792479 9:133066041-133066063 ACAGACAGGCAGACAGGCTGAGG + Intronic
1062576746 9:137212395-137212417 ACAGGCAGGTGGGTAGGATGGGG - Intronic
1062687305 9:137820771-137820793 GCAGACTGATTGATAGGACGAGG - Intronic
1185873051 X:3680442-3680464 CCAGACAGAAAGCTGGGATGTGG - Intronic
1185954810 X:4478021-4478043 ACAGAGAGAGAGAGAGAATGAGG + Intergenic
1186091160 X:6050365-6050387 ACAGACAGGTAGGTAGGTAGAGG - Intronic
1186153793 X:6705144-6705166 ACAGATAAATAGATAGGCAGAGG + Intergenic
1187194751 X:17072465-17072487 ACAGACAGACAGATGGGGTGAGG - Intronic
1188057654 X:25560263-25560285 ACAGACAAATAGAAAGGGTGGGG - Intergenic
1188303771 X:28537376-28537398 ACAGACAGAAAGAGAGTAGGTGG + Intergenic
1188591876 X:31846810-31846832 ACTGGCAGATAGATAGGATCAGG + Intronic
1189175318 X:38951113-38951135 ACAGACAGAGAGAGAGGGAGAGG + Intergenic
1189874875 X:45425635-45425657 ACAGAGAGATTGATTGGATCAGG + Intergenic
1190270820 X:48861962-48861984 ACAGAGAGAGAGAGAGAATGGGG - Intergenic
1190555942 X:51635656-51635678 ACAGACATATAGGTCAGATGTGG - Intergenic
1190726420 X:53193345-53193367 ACAGGCAGAAAGACAGGTTGTGG + Intronic
1191149237 X:57203079-57203101 ACACACAGAAATATAGGGTGTGG + Intergenic
1191149782 X:57208604-57208626 ACACACAGAAATATAGGGTGTGG + Intergenic
1193093719 X:77524148-77524170 ACACAAAGATAGATGGGGTGGGG + Intronic
1193573089 X:83168680-83168702 ACAGAAAGATAAATATGATATGG - Intergenic
1193862803 X:86691825-86691847 ACAGACAGATAGATAGGATGAGG + Intronic
1194543588 X:95204932-95204954 ACACACAGAAATATAGCATGGGG - Intergenic
1195486214 X:105409860-105409882 ACAGACAGATAGATAGAGTGTGG + Intronic
1196536212 X:116847812-116847834 ACAGAGAGAGAGAGAGGAGGGGG - Intergenic
1197425697 X:126295078-126295100 TGAGACAGACAGATAGGATGGGG - Intergenic
1197673113 X:129300240-129300262 AAAGACAGAGAGAAAAGATGGGG - Intergenic
1198941256 X:141958658-141958680 ACAGAAAGATAGATAGTATATGG - Intergenic
1199100114 X:143789789-143789811 AGAGACAGATAGATATGAAAGGG + Intergenic
1199534438 X:148886213-148886235 ACAGAGAGAGAGATGGGAGGGGG - Intronic
1200663568 Y:5991717-5991739 ACACACAGAAATATAGCATGTGG + Intergenic
1201428165 Y:13877024-13877046 ACAGACAGCTACATTGGAAGTGG - Intergenic