ID: 1193868758

View in Genome Browser
Species Human (GRCh38)
Location X:86770335-86770357
Sequence TTAGTTCAGAACATATTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193868756_1193868758 19 Left 1193868756 X:86770293-86770315 CCTAATTTCAATGTGTTGAAGGA 0: 1
1: 0
2: 0
3: 20
4: 252
Right 1193868758 X:86770335-86770357 TTAGTTCAGAACATATTTTGAGG 0: 1
1: 0
2: 2
3: 24
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193868758 Original CRISPR TTAGTTCAGAACATATTTTG AGG Intronic
900017304 1:161288-161310 TTAGTAGAGAACACAGTTTGAGG - Intergenic
900047563 1:519884-519906 TTAGTAGAGAACACAGTTTGAGG - Intergenic
900069776 1:761752-761774 TTAGTAGAGAACACAGTTTGAGG - Intergenic
903037536 1:20503098-20503120 ATGGTCCAGAACATACTTTGGGG - Intronic
905085261 1:35368591-35368613 ATAATTAAGAACATTTTTTGGGG + Intronic
906504698 1:46370045-46370067 GCTGTTCAGACCATATTTTGAGG + Intergenic
907188591 1:52631182-52631204 TTAGTTAAAAACATTATTTGTGG + Intergenic
907736928 1:57122488-57122510 TTTGTTCAGAAAATACTCTGAGG + Intronic
909502267 1:76347830-76347852 TTATCTCAGAGAATATTTTGAGG + Intronic
909595403 1:77400544-77400566 TTAGCTCAGAGAATATTTTTTGG - Intronic
910641422 1:89467025-89467047 TTTGTTGAGAATTTATTTTGAGG - Intergenic
911212409 1:95156282-95156304 CTAGGTCAGAAAACATTTTGAGG + Intronic
911774901 1:101796593-101796615 TTTGGTCAGAAAACATTTTGTGG - Intergenic
912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG + Intergenic
914776992 1:150746392-150746414 TCAGTTCAATACATATATTGAGG + Intronic
915111935 1:153569349-153569371 ATACCTCAGAACTTATTTTGTGG - Intergenic
916650857 1:166833123-166833145 TTAGATCAGTACATGTTTGGTGG - Intergenic
918322341 1:183376230-183376252 TTAGTTGAGAACCTATTAAGTGG + Intronic
918808838 1:189088308-189088330 TTAGTTGTGAAAATATTTTGAGG - Intergenic
919137580 1:193530197-193530219 TTTGTTGAGAACATACTATGTGG + Intergenic
919157754 1:193788276-193788298 TGTGTTCAGAAAATAATTTGAGG + Intergenic
919235435 1:194835927-194835949 TTAATTTAGAAAATATTTTAAGG + Intergenic
919704269 1:200661368-200661390 TGAGTTTAGTAAATATTTTGGGG - Intronic
920702643 1:208229499-208229521 TTAGTTCAAATCATTTCTTGAGG - Intronic
921551437 1:216540452-216540474 ATATTTTAGCACATATTTTGTGG - Intronic
922105149 1:222507221-222507243 TTAGTAGAGAACACAGTTTGAGG - Intergenic
922112208 1:222571491-222571513 TTAGTTCAGTAAATTTTTAGTGG - Intronic
922265463 1:223979740-223979762 TTAGTAGAGAACACAGTTTGAGG - Intergenic
922805001 1:228381162-228381184 TTAGTGCAGAACAAATTGTTGGG - Intergenic
922890655 1:229059208-229059230 TCATTTCAAATCATATTTTGGGG - Intergenic
923096377 1:230778368-230778390 TGTGTTGAGAACAGATTTTGGGG - Intronic
924347321 1:243084742-243084764 TTAGTAGAGAACACAGTTTGAGG - Intergenic
924773289 1:247095602-247095624 TTAATTCCCAACCTATTTTGTGG + Intergenic
924910790 1:248511190-248511212 TTAATTAGTAACATATTTTGGGG + Intergenic
924913311 1:248536850-248536872 TTAATTAGTAACATATTTTGGGG - Intergenic
1066729034 10:38420134-38420156 TTAGTAGAGAACACAGTTTGAGG + Intergenic
1068068294 10:52162254-52162276 TTTGTTCAGAAAGTATTTTCTGG - Intronic
1068184652 10:53569335-53569357 TTTGTTTAGACCATATTTGGTGG + Intergenic
1068282234 10:54888745-54888767 TTTTTTCAGTACACATTTTGGGG + Intronic
1068654829 10:59563945-59563967 TAAGTGCTGAACATATTTTGAGG + Intergenic
1069355064 10:67575466-67575488 TTTTTTCACAACATAATTTGAGG - Intronic
1072868523 10:99090376-99090398 TTCGTTCAGAACATATTTATTGG - Intronic
1074244822 10:111678725-111678747 TCAGTTCAGACCATATTTTATGG + Intergenic
1075627853 10:123975759-123975781 TTAGTTGAGATCATATTATATGG - Intergenic
1076029926 10:127148732-127148754 TTATTTCAGAAAATGTTTTGTGG - Intronic
1076973905 11:156516-156538 TTAGTAGAGAACACAGTTTGAGG - Intergenic
1078352126 11:10603282-10603304 TTAGTCCATAACATTATTTGAGG - Intronic
1078893417 11:15577698-15577720 TTAGTTATGAAGACATTTTGTGG + Intergenic
1079534770 11:21500327-21500349 TTATTACAGAAAATATTTTTGGG - Intronic
1079773473 11:24494369-24494391 TAAATTCAGAATAAATTTTGTGG - Intergenic
1080166063 11:29238885-29238907 TTGGTTCAGAAACTATTTTCTGG + Intergenic
1080227666 11:29978016-29978038 TTATTTCATAACATGATTTGTGG - Intergenic
1080497544 11:32834551-32834573 GTAGTTCACATTATATTTTGGGG - Intronic
1082109962 11:48263702-48263724 TTGTCTCAGAACATGTTTTGGGG + Intergenic
1082853647 11:57787376-57787398 CTAGTTCACAAAATAGTTTGAGG + Intronic
1086076384 11:82857543-82857565 TTCGTTGAGAACAGATTCTGAGG - Intronic
1086343731 11:85874148-85874170 TTCATTCAGTACATATTTAGTGG + Intronic
1086366647 11:86113795-86113817 TGAGTGTAGAACATGTTTTGGGG - Intergenic
1086668284 11:89512943-89512965 TCAGTTCTGAAAATATGTTGAGG + Intergenic
1086878445 11:92126244-92126266 GTAGTTCAGCAAACATTTTGAGG - Intergenic
1090514176 11:127407487-127407509 TTAGTTCAGCATCTATTTGGGGG + Intergenic
1091157578 11:133387829-133387851 TTAATTCAGAACATATGGAGGGG + Intronic
1091203806 11:133803625-133803647 TTGGTTTAAAAAATATTTTGGGG - Intergenic
1091947890 12:4565162-4565184 ATAGCTCACCACATATTTTGAGG + Intronic
1092642457 12:10530013-10530035 TTAGTCCATAACATATTTATAGG + Intergenic
1092758386 12:11786299-11786321 TTAATTGATAACAGATTTTGTGG - Intronic
1093328570 12:17808910-17808932 CTATTTCAGAAAATATCTTGGGG + Intergenic
1093610018 12:21144036-21144058 TTAGTTCAGTACAAAAATTGAGG - Intronic
1094253726 12:28397562-28397584 TTAGGTAAGCAAATATTTTGAGG + Intronic
1094274103 12:28649598-28649620 TTTGTTCAGTAGATCTTTTGTGG + Intergenic
1096425381 12:51497246-51497268 TTAGCTGAGAACATCTTTGGGGG - Intronic
1096821214 12:54236452-54236474 CTAATTCAGAACATGTTTTTGGG + Exonic
1098729846 12:74021283-74021305 GTAGTTAAATACATATTTTGTGG + Intergenic
1098945396 12:76583973-76583995 TTAGTTTATGACATATATTGAGG - Intergenic
1098982869 12:76976840-76976862 TTTGTTGAGAACAAATTTTGTGG + Intergenic
1099500540 12:83408498-83408520 TTAGTTCAGAGCAAAATCTGTGG + Intergenic
1099583871 12:84490448-84490470 TTAGTTCAGAGCTTGTATTGAGG + Intergenic
1099595788 12:84663852-84663874 TTCATTCAGTACATTTTTTGAGG + Intergenic
1099628836 12:85113541-85113563 TTTGTTCAACAAATATTTTGGGG - Intronic
1100972763 12:100089230-100089252 GTAATTCAGAAAATATTTTAGGG - Intronic
1101181271 12:102220899-102220921 TTAGTTCAGAAAATAGTTCTAGG - Intergenic
1102126624 12:110487485-110487507 TTCTTTTAGAATATATTTTGTGG + Intronic
1104750379 12:131234658-131234680 TTAGTTCAGAACTGCTTTTGAGG + Intergenic
1104782341 12:131429804-131429826 TTAGTTCAGAGCTGCTTTTGAGG - Intergenic
1105800804 13:23901775-23901797 TTAAATAAGAACCTATTTTGGGG - Intronic
1105938394 13:25123691-25123713 TTTGTTGAGAACTTGTTTTGTGG - Intergenic
1107216662 13:37928980-37929002 TTATATCTGTACATATTTTGAGG - Intergenic
1107263598 13:38524792-38524814 TTATTTTAAAACATGTTTTGTGG - Intergenic
1108313496 13:49217774-49217796 TGAGTACAGAAACTATTTTGAGG + Intergenic
1109187024 13:59282038-59282060 TTAGTTAAGAACAGATCTTCAGG + Intergenic
1109366241 13:61359993-61360015 TTACTTCAAAACAGTTTTTGTGG + Intergenic
1110582085 13:77142324-77142346 TTAGTTCAGCAAATGTTTTTTGG - Intronic
1110768843 13:79312270-79312292 CTACTTCAGAACATATTGTCTGG - Intronic
1111831630 13:93337609-93337631 TTAGTTAAGAGCATATATTTTGG - Intronic
1111876249 13:93900013-93900035 TTACTTCTGAAAATAATTTGTGG + Intronic
1113187051 13:107700153-107700175 TTAGTTCTGAATAAATTTTGAGG - Intronic
1113863380 13:113505949-113505971 TTAATTCAGAACACCTTATGAGG - Intronic
1114175156 14:20311663-20311685 TCAGTTCAGACCATTTTTTGCGG - Exonic
1114301317 14:21381312-21381334 TCAGTTAGGTACATATTTTGAGG - Intronic
1114738139 14:25064101-25064123 TTATTTCAGAACATTTGTTTTGG - Intergenic
1115176748 14:30570847-30570869 TTTTTTCAGAAAATATATTGTGG + Intronic
1115347531 14:32359178-32359200 TTAGTACAAAAAAAATTTTGGGG + Intronic
1115653372 14:35419920-35419942 TTGCTTTAAAACATATTTTGAGG + Intergenic
1115811045 14:37107481-37107503 TTAGCTAAGAAGATATTTTTTGG - Intronic
1116098295 14:40401559-40401581 ATGTTTCAGAACATGTTTTGGGG + Intergenic
1116222414 14:42105171-42105193 TTAATTCACCACAGATTTTGGGG - Intergenic
1116495788 14:45558563-45558585 TTATTTCATAAAATATTTTAAGG - Intergenic
1116859908 14:49986295-49986317 TTTTTACAGACCATATTTTGGGG + Intronic
1117364044 14:55007420-55007442 TCAGTTCTGCATATATTTTGGGG - Intronic
1117534863 14:56694177-56694199 TTAGTTCAGAAAATATGCTAAGG + Intronic
1117604320 14:57410962-57410984 TTGGTTTGGAATATATTTTGTGG + Exonic
1118472569 14:66088666-66088688 TCTCTTAAGAACATATTTTGGGG - Intergenic
1118941362 14:70342089-70342111 CTACATCAGATCATATTTTGTGG + Intronic
1119714148 14:76846619-76846641 TGAATTCAGAATATACTTTGGGG + Intronic
1120026866 14:79596438-79596460 TTGGTTCAGAACACATTTGAGGG - Intronic
1120339142 14:83196648-83196670 TCAGTTCCAAACATATATTGTGG + Intergenic
1120403589 14:84065487-84065509 TTACTTAAAACCATATTTTGTGG - Intergenic
1120563183 14:86021884-86021906 TTAATTCAGAAAATATTTATTGG - Intergenic
1120763292 14:88305490-88305512 TTTGTTCTGAAGATATCTTGGGG + Intronic
1120999006 14:90437887-90437909 TTAGTGAAGAACTTATTTTCAGG + Intergenic
1121144911 14:91575020-91575042 GCAGTTCAGAACCGATTTTGTGG + Intergenic
1121493055 14:94373556-94373578 CAATCTCAGAACATATTTTGAGG + Intergenic
1122528052 14:102403635-102403657 TTAGTTCAAACAATTTTTTGTGG - Intronic
1124258419 15:28164817-28164839 TTAATGCAGAACTTATTCTGAGG - Intronic
1125056496 15:35364191-35364213 TTTTTTCCCAACATATTTTGAGG + Intronic
1126005135 15:44249126-44249148 ATTTTTCAGAAGATATTTTGGGG - Intergenic
1126769153 15:52037839-52037861 TTCATTCAGTACATATTTTAGGG + Intronic
1127405215 15:58637233-58637255 TTTGTGAAGAACATCTTTTGAGG - Intronic
1130735814 15:86547563-86547585 TAAATTCAAAACACATTTTGAGG + Intronic
1132439925 15:101850795-101850817 ATAGTACAGAACAAAATTTGTGG + Intergenic
1137492660 16:48945822-48945844 TTATTTCAGAGATTATTTTGAGG - Intergenic
1139946049 16:70642945-70642967 TGAGTTCAGAGTTTATTTTGGGG + Intronic
1140221898 16:73049561-73049583 TTAGTCCAGAATAGATTCTGGGG + Intronic
1142446358 16:90141169-90141191 TTAGTAGAGAACACAGTTTGAGG + Intergenic
1142461147 17:94294-94316 TTAGTAGAGAACACAGTTTGAGG - Intergenic
1143813792 17:9494314-9494336 TTACTTAAGAACATATCATGGGG - Intronic
1149380433 17:56088227-56088249 CTAGTTCAGAACATATTCCCTGG + Intergenic
1149892388 17:60401524-60401546 TTCTTTTAGAACAAATTTTGAGG - Intronic
1150927283 17:69546085-69546107 ATAGCTCAGTACATAATTTGGGG + Intergenic
1152121401 17:78420882-78420904 TTGGTTAAGTACACATTTTGGGG - Intronic
1153282591 18:3427898-3427920 TCAGTTAAGAATATATTCTGAGG - Intronic
1153563414 18:6395036-6395058 TTACTTCATAAAATATTATGAGG + Intronic
1155390952 18:25336067-25336089 TTATTTGAGACCTTATTTTGGGG - Intronic
1155908531 18:31482009-31482031 TTTCCTCAGAACATATTTTGTGG + Intergenic
1156142337 18:34130322-34130344 TTATTTTAAAATATATTTTGAGG + Intronic
1156872303 18:41960047-41960069 TTAGTTCAGATAGTATTTTAGGG + Intronic
1157413576 18:47483970-47483992 TTATTTCAAAAGATATTCTGAGG + Intergenic
1158897182 18:61925584-61925606 TTAGTTTAGAAAATTCTTTGTGG + Intergenic
1160616683 18:80136162-80136184 TGATTTCAGAACATATTAAGAGG + Exonic
925962531 2:9031326-9031348 ATCTTTCAGATCATATTTTGAGG - Intergenic
926114758 2:10205342-10205364 CCAGGTCAGAACACATTTTGGGG + Intronic
926757723 2:16249641-16249663 CTAGTTCCAAACATGTTTTGGGG - Intergenic
927249302 2:20983426-20983448 TTAACTCAGAAAATATTTTAGGG + Intergenic
927375755 2:22411690-22411712 ATGGTTCTTAACATATTTTGAGG - Intergenic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
929983732 2:46705096-46705118 TTATTACAAAACATATTTTAAGG - Intronic
933062176 2:77751815-77751837 TTATTTCAGTGCATGTTTTGTGG + Intergenic
933131624 2:78679642-78679664 TTATTTCAGAACATTATTTAGGG - Intergenic
934489748 2:94754048-94754070 TTATTTAAGAAAATGTTTTGTGG - Intergenic
935482871 2:103615338-103615360 TTAATTCAACAAATATTTTGAGG + Intergenic
935922239 2:108028938-108028960 CTAGTTCAGAAAATACTTGGAGG - Intergenic
936896405 2:117432804-117432826 TTAGTTCAGAACTTTTTTTAAGG + Intergenic
936926548 2:117742826-117742848 TTAATTGAGAAAATATTTTAAGG + Intergenic
937033967 2:118765292-118765314 TGTATTCAGAACATCTTTTGGGG - Intergenic
937376590 2:121340482-121340504 TCAGTTAATAACATATTTGGGGG - Exonic
938042741 2:128089801-128089823 ATAGTTCTCAACTTATTTTGGGG - Intergenic
938808827 2:134832818-134832840 TTTGTGCATTACATATTTTGAGG + Intergenic
939430420 2:142098206-142098228 TTTGTTGAAAACATATTTTCTGG - Intronic
940159382 2:150694944-150694966 TTTGTTAAGAACATAGTTTCAGG + Intergenic
940488254 2:154324214-154324236 TTTTTTTAGAACATATTTTTAGG + Intronic
942165666 2:173238257-173238279 CTAGTTCATAAAATATCTTGGGG - Intronic
942408283 2:175679076-175679098 TAGGTTCAGATCATATTATGAGG - Intergenic
942568613 2:177290909-177290931 TCACTTCAGAATATATCTTGAGG + Intronic
943447784 2:188010453-188010475 TCAGTTAAGATCATATTTTACGG + Intergenic
944537178 2:200722697-200722719 TTATTTCAGAACAAATTTAAGGG + Intergenic
945145467 2:206733514-206733536 TTAGGTAAGAACATATTTCTTGG - Intergenic
945943806 2:215974958-215974980 TTATTTCCTAACACATTTTGTGG - Intronic
947064388 2:226205395-226205417 TTTGTTCAGATCATATTTATTGG + Intergenic
947120395 2:226808163-226808185 AAAGTTCTGAATATATTTTGAGG + Intergenic
947329079 2:229009394-229009416 TTCTTTCAGAACATATTTATGGG + Intronic
1169707071 20:8517743-8517765 CTAGTTCAGAACATACATTCAGG + Intronic
1174414095 20:50355858-50355880 TTAATTCAGCAGATATTTTATGG + Intergenic
1175634888 20:60572994-60573016 TTATTTCTTAACATATTTTAAGG + Intergenic
1178377080 21:32075691-32075713 TTAGTTTAAAACAAATTTAGTGG - Intergenic
1178687768 21:34724580-34724602 TTAGTTCAGTCCACATTTTGGGG - Intergenic
1179956130 21:44739882-44739904 CTTGTTCAGAACATCTTATGAGG - Intergenic
1180670181 22:17547114-17547136 TTAGTTAAGACCTTATTTTTAGG + Intronic
949180947 3:1130688-1130710 TTGATTCAGAATCTATTTTGGGG + Intronic
949193138 3:1273476-1273498 TTAATTCAGATCATTTTCTGAGG - Intronic
952121551 3:30250427-30250449 TAGGTTCAGAACAACTTTTGGGG + Intergenic
952465572 3:33581369-33581391 GTAGTTCAGATGTTATTTTGTGG + Intronic
953655670 3:44851546-44851568 TTTGTTTAGAAAATGTTTTGAGG + Intronic
954334315 3:49907423-49907445 GTAGTTCAGCATATATTCTGGGG - Intronic
955915166 3:63900450-63900472 TTAGTCCAGAACATTTTAAGAGG - Intronic
956119715 3:65954299-65954321 TTTTTTCAGAAGCTATTTTGTGG + Intronic
956200213 3:66697823-66697845 TTAGTTCTGAACATGATATGTGG - Intergenic
956249784 3:67223965-67223987 TGAGTTCAGTAGATGTTTTGAGG + Intergenic
956455213 3:69414349-69414371 TTAGTGCAGAACTGTTTTTGTGG - Intronic
956677065 3:71745448-71745470 ATAGTTCAGAACATTTTATATGG + Intronic
957265983 3:77966397-77966419 TTAGTAGTGAACATATTTTGGGG + Intergenic
957752859 3:84445009-84445031 ATCCCTCAGAACATATTTTGTGG + Intergenic
957791156 3:84942734-84942756 TTAATTCTGAACCCATTTTGGGG - Intergenic
957832834 3:85545499-85545521 TCAGTTCATAACATATATTTTGG - Intronic
957839270 3:85645783-85645805 TTATTTCTGAATATATTTTTAGG - Intronic
958442771 3:94176601-94176623 TTATTTTCCAACATATTTTGTGG - Intergenic
958878424 3:99641524-99641546 TTAGTTAAAAACATGTTTTAAGG - Intronic
959981264 3:112520285-112520307 TTGGCTCAGGACAAATTTTGAGG + Intergenic
960164235 3:114383854-114383876 TTAGTTGAAAATACATTTTGAGG + Intronic
960182897 3:114603381-114603403 TTAATCCAGAAGATATTTTAAGG - Intronic
960460709 3:117931603-117931625 TTAGTTCATTTAATATTTTGAGG + Intergenic
961423327 3:126825124-126825146 ATAGATTAGAAAATATTTTGAGG - Intronic
962964109 3:140337715-140337737 TTAGTTGAGAACCTAATCTGGGG - Intronic
964088070 3:152842393-152842415 TTTGATCTGACCATATTTTGGGG - Intergenic
964598155 3:158461493-158461515 TTTGTTTAGATAATATTTTGGGG - Intronic
964984227 3:162719234-162719256 TTAGTTCATTATTTATTTTGAGG - Intergenic
965324610 3:167288115-167288137 GTAATTCAGCATATATTTTGAGG - Intronic
965408887 3:168305022-168305044 TTAATTCTTTACATATTTTGAGG - Intergenic
965560123 3:170054064-170054086 TTAGTTTATAAAATATTTTATGG - Intronic
965951473 3:174313241-174313263 TGAGTTCAAAATATATATTGTGG + Intergenic
966396850 3:179512866-179512888 CTATTTCAGAACATACTTTCAGG - Intergenic
967482113 3:189984989-189985011 TTAGTAAATAACATATTTTAAGG + Intronic
967843810 3:194028994-194029016 TTTGTTCAGCATTTATTTTGAGG + Intergenic
968366983 3:198193326-198193348 TTAGTAGAGAACACAGTTTGAGG + Intergenic
969492445 4:7507573-7507595 TTGGTTTAGAGCATATTTAGTGG - Intronic
970408911 4:15788826-15788848 TTAGTTCAGAGAATATTTTGAGG + Intronic
971394221 4:26213872-26213894 TATTTTCAGAACACATTTTGGGG - Intronic
971479349 4:27100271-27100293 AGACTTCAGCACATATTTTGGGG + Intergenic
972807163 4:42540900-42540922 TTAGTACAATACATCTTTTGTGG - Intronic
972868324 4:43262189-43262211 TCAGTTCAAATCATTTTTTGGGG + Intergenic
973044840 4:45523192-45523214 TTGATTGAGAATATATTTTGGGG + Intergenic
975358917 4:73443224-73443246 TTAGTAAAAAACATATTTTATGG + Intronic
975450700 4:74522519-74522541 ATAGTTCAGAAAAAAGTTTGAGG + Intergenic
975652407 4:76607206-76607228 TTGATTTAGTACATATTTTGTGG + Intronic
976584743 4:86782987-86783009 GAAGTTCAGAACATATTGTATGG - Intronic
976709053 4:88049811-88049833 GTACTTCAGAACATATGTTGGGG - Intronic
976858683 4:89635763-89635785 TTATTTCAGAGCAGAATTTGGGG - Intergenic
977020879 4:91757767-91757789 TTTTTACAGAACATGTTTTGTGG + Intergenic
977310754 4:95384393-95384415 TTAGATGAGATCATGTTTTGCGG + Intronic
977852950 4:101852125-101852147 TTACATAAGAACAAATTTTGAGG - Intronic
978388967 4:108204387-108204409 TGAATTCTGGACATATTTTGAGG + Intergenic
978891744 4:113837135-113837157 TTAGTTCAGAATATTTTGTGAGG + Intergenic
979255393 4:118602934-118602956 TTAGTAGAGAACACAGTTTGAGG + Intergenic
979332945 4:119437579-119437601 TTAGTAGAGAACACAGTTTGAGG - Intergenic
979347969 4:119611356-119611378 TTACTTCAAGAAATATTTTGAGG - Intronic
979535033 4:121809958-121809980 TCATTTCAGAACATATTTATTGG + Exonic
980312866 4:131157008-131157030 TTTGTTCATAACATATGATGGGG - Intergenic
980328578 4:131380545-131380567 TCAGTACAGATCATACTTTGAGG + Intergenic
982393224 4:154888622-154888644 TAAACTCAGAACTTATTTTGTGG + Intergenic
982445693 4:155488221-155488243 TTAATTCAGGACATTGTTTGAGG + Intergenic
982898729 4:160970421-160970443 TTATTTCTAAATATATTTTGGGG + Intergenic
983376294 4:166933025-166933047 TTTGCTCAGAAGGTATTTTGGGG + Intronic
983427179 4:167600120-167600142 TCCATTCAGAATATATTTTGGGG + Intergenic
983824494 4:172241016-172241038 TTATTTCAGAACATTTTCAGAGG + Intronic
984093143 4:175400951-175400973 TAAGTTTACAACATATTATGTGG - Intergenic
984632070 4:182071611-182071633 TTAGTTTTGTACATATTTGGGGG + Intergenic
984827643 4:183941265-183941287 TTCATTCAAAAAATATTTTGTGG + Intronic
986033951 5:3919942-3919964 TCAGTTTAAAACATATTTTTTGG - Intergenic
986217843 5:5737649-5737671 TTATTTCAGAACATAATTGTAGG + Intergenic
986565654 5:9111078-9111100 TGTTTTGAGAACATATTTTGAGG + Intronic
987219747 5:15778491-15778513 TTAGTTAAGAATATGGTTTGAGG + Intronic
988109668 5:26801937-26801959 TTCATTGAGAAAATATTTTGAGG + Intergenic
990050238 5:51490242-51490264 CTAGTTCATTACAAATTTTGAGG + Intergenic
990078412 5:51880502-51880524 TTATTTTAAAACATATTTTAAGG - Intergenic
991010395 5:61876628-61876650 TTAATTCAGCAAATGTTTTGGGG - Intergenic
991319559 5:65355858-65355880 TTATTTCAGAAAATATGTTCTGG + Intronic
993002933 5:82400455-82400477 TTAGTTCAATCCAAATTTTGTGG + Intergenic
993926956 5:93877476-93877498 TTAGTACAGAGCATATTATGAGG - Intronic
994821831 5:104662432-104662454 TTAGTTAAAAAAGTATTTTGGGG + Intergenic
995935976 5:117514501-117514523 TTAATTGAGGATATATTTTGTGG - Intergenic
997422544 5:133780572-133780594 TTAGCACAGAAGACATTTTGAGG + Intergenic
998045837 5:138985919-138985941 TTAGTACAGAACATCATCTGTGG - Intronic
998515454 5:142749739-142749761 TTTGTTGACAACATTTTTTGAGG + Intergenic
1000366324 5:160494549-160494571 CTGCTACAGAACATATTTTGAGG - Intergenic
1000727347 5:164788152-164788174 ATAGTTTAGAGCATATTTTCTGG + Intergenic
1000758900 5:165196389-165196411 TTTTTTCAGAATTTATTTTGTGG - Intergenic
1001040936 5:168334711-168334733 TGAGTTCTGAACATATATTTTGG + Intronic
1001372790 5:171223110-171223132 TCATTTCAGAACACATTCTGGGG + Intronic
1002619564 5:180478093-180478115 TTAGTTCAGGATCTTTTTTGTGG + Intergenic
1002726208 5:181298524-181298546 TTAGTAGAGAACACAGTTTGAGG + Intergenic
1003311382 6:4972418-4972440 TTAATTTAGAAAATATCTTGTGG - Intergenic
1003545517 6:7055080-7055102 TTCATTCAAAAAATATTTTGAGG - Intergenic
1004326321 6:14676985-14677007 TAGGTTCTGGACATATTTTGAGG - Intergenic
1004599926 6:17139332-17139354 TTTGTGTTGAACATATTTTGTGG - Intergenic
1005521916 6:26609072-26609094 TTACTTCTTAACATATTCTGGGG - Intergenic
1005925971 6:30446046-30446068 TTTGTTCAGTACCTATTTTGGGG - Intergenic
1008150366 6:47942926-47942948 TTATATCAGAAAATATTCTGTGG + Intronic
1008528823 6:52435256-52435278 TTGCTGCAGAACAGATTTTGGGG - Intronic
1009530395 6:64805005-64805027 TTAATTCAGCAAATATTTTTTGG - Intronic
1009729406 6:67580339-67580361 TTAGTTCAGGGCATATGTTCAGG + Intergenic
1009885804 6:69622564-69622586 TTAGAAAAGAAAATATTTTGGGG + Intergenic
1009951184 6:70398423-70398445 GTGGTTCAGAAATTATTTTGGGG - Intergenic
1010558357 6:77314543-77314565 TTGGTACAGAACATATTTTTGGG + Intergenic
1010904214 6:81466576-81466598 TTCGTTCAGTAAAAATTTTGTGG + Intergenic
1011126795 6:84016246-84016268 TTAATTCAGTACAGATTGTGAGG - Intergenic
1011171495 6:84509647-84509669 TAATTTCTGAACATATTGTGTGG + Intergenic
1011207004 6:84910396-84910418 TTAGTTCAAAGCATATTATAAGG - Intergenic
1011403428 6:86989701-86989723 TTATTTCTGACCATCTTTTGGGG - Intronic
1012205053 6:96450942-96450964 TGAGTTCAAAACATTTTCTGTGG - Intergenic
1012304347 6:97632616-97632638 GTAATTCTGAAAATATTTTGTGG - Intergenic
1012473551 6:99596994-99597016 TAAGTTCAGATCACATTTGGTGG + Intergenic
1012486589 6:99728501-99728523 TTATTTCAGAACATCTGTTAAGG + Intergenic
1012532278 6:100252127-100252149 TTAGTTCAGTAAATTTTTTAAGG + Intergenic
1013747972 6:113368142-113368164 CTAATTCAGCACATATTCTGTGG - Intergenic
1013845779 6:114449677-114449699 TAAGTTCAGAACACTTTTTTAGG + Intergenic
1014653179 6:124066784-124066806 TTAGTGCAGAGCATATTCTAAGG + Intronic
1014829000 6:126079495-126079517 TTAGTGAAGAAGATATCTTGTGG - Intergenic
1015613470 6:135050805-135050827 TTAGTAAATAACCTATTTTGTGG - Intronic
1018347655 6:162919241-162919263 TTGATTAAGAAAATATTTTGTGG + Intronic
1019597649 7:1865687-1865709 TTAGTTCACATCAAAGTTTGTGG - Intronic
1019842378 7:3460726-3460748 TCAGTTAAAAACTTATTTTGGGG + Intronic
1020816799 7:12915752-12915774 TGACTTCAGAAACTATTTTGAGG - Intergenic
1021123334 7:16821729-16821751 TAAGTTCACAGCATATTTTATGG + Intronic
1021377888 7:19931426-19931448 TTAATCAAGACCATATTTTGTGG - Intergenic
1022804741 7:33810236-33810258 TTTCTTCAGAACATATCTTGGGG + Intergenic
1023527350 7:41118588-41118610 TTAGTTCAGGGCTTCTTTTGAGG + Intergenic
1024071085 7:45786047-45786069 TTAGTAGAGAACACAGTTTGAGG + Intergenic
1024740235 7:52345763-52345785 TTAATTCAGAACATCTTTTGTGG + Intergenic
1024880699 7:54082408-54082430 TGTGTTCAGATCATATTCTGTGG - Intergenic
1025256386 7:57386353-57386375 TTAATTCAGCAGATATTTTATGG - Intergenic
1027597868 7:80198831-80198853 TTAGTTTAGAAAACATTTTGAGG + Intronic
1028283069 7:88957200-88957222 TTTATCCAGAACACATTTTGTGG + Intronic
1028381878 7:90209337-90209359 TTTGTTCAAAACAAATTTGGGGG + Intronic
1028402845 7:90442996-90443018 TCAATTCAGATCACATTTTGTGG + Intronic
1028980813 7:96966388-96966410 TGAGTGCAGAAAATATTTTATGG - Intergenic
1029123465 7:98282641-98282663 TTGGCTCTGAACACATTTTGTGG + Intronic
1030343300 7:108405321-108405343 TTTGTTCTGAACATGTTTTCGGG + Intronic
1030898258 7:115088636-115088658 GTACTTCAGCAGATATTTTGGGG + Intergenic
1031707771 7:125003482-125003504 CTAGTTCAAAACATGTTTTGTGG - Intergenic
1031802293 7:126263121-126263143 TCAGTTCTAAGCATATTTTGTGG + Intergenic
1032872170 7:135997963-135997985 TTGGGTCAGATAATATTTTGTGG + Intergenic
1032954714 7:136957192-136957214 TTTGTTCAGTACATCTTTTGGGG + Intronic
1034204883 7:149306799-149306821 TTGCTTCAAAAAATATTTTGTGG - Intergenic
1034634419 7:152555862-152555884 CTAGTTTAGAAAATATATTGTGG - Intergenic
1035197651 7:157236283-157236305 TAAGTTCAGAATATTTATTGAGG + Intronic
1037024629 8:14019194-14019216 TTAGATCACAACATACTTAGTGG + Intergenic
1039747818 8:40446121-40446143 TTAGAACAGAACACATTTTAAGG - Intergenic
1039862529 8:41471258-41471280 TTAGCTCAGAACACATGTTCAGG - Intergenic
1041425247 8:57713524-57713546 CTAATTCAGCAAATATTTTGAGG + Intergenic
1042611325 8:70604596-70604618 TCAGGTCAGAACAAAGTTTGAGG - Intronic
1042729763 8:71919816-71919838 CCAGTTCAAAACATATTTTAAGG - Intronic
1045082794 8:98646926-98646948 TTTGTTGAGAACAGATTGTGGGG - Intronic
1045584034 8:103510859-103510881 TTAGGACAGAACATCTTTGGGGG + Intronic
1046830254 8:118737878-118737900 CTTGTTCAGAGCATCTTTTGTGG - Intergenic
1046970679 8:120219765-120219787 TTTGTTGAGAACATATGTTTGGG + Intronic
1047323943 8:123818509-123818531 TTAATTCATAATATATTTAGGGG - Intergenic
1048322709 8:133412791-133412813 TTAGCTAAGAAAATATTTTCCGG + Intergenic
1048513929 8:135087985-135088007 TTAGTTCTGGATATGTTTTGAGG - Intergenic
1048648505 8:136449067-136449089 CTAGATCAGAAAATATTTGGGGG + Intergenic
1048827526 8:138443366-138443388 AGAGTTCAGATCATATTTTCTGG - Intronic
1050108430 9:2189853-2189875 TTAGTTTTGGAAATATTTTGTGG + Intronic
1050569866 9:6926436-6926458 TTTGCTCTGAAAATATTTTGTGG + Intronic
1050886763 9:10776571-10776593 TAAGCTCAGAACATATTCAGAGG + Intergenic
1051407182 9:16750298-16750320 TAATTTCAGAAAATATTTTTAGG - Intronic
1051704033 9:19857424-19857446 TTAGATATGAACATCTTTTGAGG + Intergenic
1053590965 9:39514216-39514238 TCAACTGAGAACATATTTTGGGG - Intergenic
1053650685 9:40165882-40165904 AGAGTTCAGAACATATTCAGGGG - Intergenic
1053755051 9:41298042-41298064 AGAGTTCAGAACATATTCAGGGG + Intergenic
1053848813 9:42269584-42269606 TCAACTGAGAACATATTTTGGGG - Intergenic
1054331194 9:63757653-63757675 AGAGTTCAGAACATATTCAGGGG - Intergenic
1054533896 9:66210321-66210343 AGAGTTCAGAACATATTCAGGGG + Intergenic
1054575341 9:66851074-66851096 TCAACTGAGAACATATTTTGGGG + Intergenic
1055166279 9:73199284-73199306 TTAATTCAGAATATATTTTTTGG - Intergenic
1055256597 9:74379092-74379114 TTATTTCAGAAAGTATTTAGAGG + Intergenic
1055928811 9:81538725-81538747 TCAGTTCAGAATAGAATTTGTGG - Intergenic
1057619847 9:96625186-96625208 TTAGATAAAAACAGATTTTGGGG + Intergenic
1057844854 9:98515480-98515502 TTAGAGCAGAACATAAGTTGAGG - Intronic
1058044891 9:100347187-100347209 TTTGTTCAGCTCGTATTTTGGGG + Exonic
1058338108 9:103858883-103858905 TTGGTGAAGCACATATTTTGTGG - Intergenic
1059767275 9:117395420-117395442 ATAATTCAAAACCTATTTTGGGG - Intronic
1061468563 9:130803587-130803609 ATAGTTAACAAAATATTTTGAGG + Intronic
1062751339 9:138256170-138256192 TTAGTAGAGAACACAGTTTGAGG + Intergenic
1186071240 X:5822895-5822917 TTTTTCCAGAACATCTTTTGTGG - Intergenic
1188642823 X:32527678-32527700 TTAGTTCTAAAAATATTTTTAGG + Intronic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1190039625 X:47059326-47059348 TTTGCTCAGTAAATATTTTGGGG + Exonic
1193868758 X:86770335-86770357 TTAGTTCAGAACATATTTTGAGG + Intronic
1193943493 X:87705271-87705293 TTATTTCAGAAAATATCTTGGGG + Intergenic
1195266470 X:103185088-103185110 TTATTTCAAGACATATTCTGTGG + Intergenic
1195287605 X:103400599-103400621 TTATTCCAGGACATATCTTGAGG + Intergenic
1195300929 X:103529213-103529235 TTATTCCAGGACATATTCTGAGG - Intergenic
1195546764 X:106121275-106121297 CTAATTCAGAACATATTTAAAGG - Intergenic
1196054305 X:111338743-111338765 TTATTTCAGCACAGATTTTAGGG - Intronic
1197001357 X:121442969-121442991 TTAGATCAGATCATATTCTAAGG - Intergenic
1197119867 X:122878032-122878054 TTTGTACAGAACAGAATTTGCGG + Intergenic
1198614599 X:138442525-138442547 TTAATTAAGTACGTATTTTGTGG + Intergenic
1200698764 Y:6384518-6384540 TCAATTCAGAACAGAATTTGAGG + Intergenic
1201035348 Y:9780181-9780203 TCAATTCAGAACAGAATTTGAGG - Intergenic