ID: 1193869306

View in Genome Browser
Species Human (GRCh38)
Location X:86777377-86777399
Sequence ATGTGCAGGGACAAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 247}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193869306_1193869314 17 Left 1193869306 X:86777377-86777399 CCTTCACACTTGTCCCTGCACAT 0: 1
1: 0
2: 1
3: 22
4: 247
Right 1193869314 X:86777417-86777439 AGAGGGTTATCAGTGGTTTCAGG 0: 1
1: 0
2: 0
3: 10
4: 114
1193869306_1193869313 10 Left 1193869306 X:86777377-86777399 CCTTCACACTTGTCCCTGCACAT 0: 1
1: 0
2: 1
3: 22
4: 247
Right 1193869313 X:86777410-86777432 CTAGAGAAGAGGGTTATCAGTGG 0: 1
1: 0
2: 1
3: 10
4: 127
1193869306_1193869316 25 Left 1193869306 X:86777377-86777399 CCTTCACACTTGTCCCTGCACAT 0: 1
1: 0
2: 1
3: 22
4: 247
Right 1193869316 X:86777425-86777447 ATCAGTGGTTTCAGGGAGAAAGG 0: 1
1: 1
2: 1
3: 35
4: 341
1193869306_1193869310 0 Left 1193869306 X:86777377-86777399 CCTTCACACTTGTCCCTGCACAT 0: 1
1: 0
2: 1
3: 22
4: 247
Right 1193869310 X:86777400-86777422 CAAAAAATCCCTAGAGAAGAGGG 0: 1
1: 0
2: 3
3: 35
4: 414
1193869306_1193869315 18 Left 1193869306 X:86777377-86777399 CCTTCACACTTGTCCCTGCACAT 0: 1
1: 0
2: 1
3: 22
4: 247
Right 1193869315 X:86777418-86777440 GAGGGTTATCAGTGGTTTCAGGG 0: 1
1: 0
2: 1
3: 5
4: 119
1193869306_1193869309 -1 Left 1193869306 X:86777377-86777399 CCTTCACACTTGTCCCTGCACAT 0: 1
1: 0
2: 1
3: 22
4: 247
Right 1193869309 X:86777399-86777421 TCAAAAAATCCCTAGAGAAGAGG 0: 1
1: 0
2: 9
3: 43
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193869306 Original CRISPR ATGTGCAGGGACAAGTGTGA AGG (reversed) Intronic
900618597 1:3576774-3576796 GTGTGCAGGGCCAGGTGTGCAGG - Intronic
900618621 1:3576874-3576896 GTGTGCAGGGCCAGGTGTGCGGG - Intronic
900618630 1:3576903-3576925 GTGTGCAGGGCCAGGTGTGCAGG - Intronic
900618638 1:3576932-3576954 ATGTGCAGGGCCAGGTGTGCAGG - Intronic
900618653 1:3577003-3577025 GTGTGCAGGGCCAGGTGTGCAGG - Intronic
900618661 1:3577032-3577054 GTGTGCAGGGCCAGGTGTGCAGG - Intronic
901183801 1:7359257-7359279 ATGTGCAGGGACCATGGAGAAGG + Intronic
902292723 1:15445760-15445782 AGGTGCAGGGACAGCTGTGGAGG - Intronic
902714817 1:18265487-18265509 ATGTACAGGGGCAAGTGAGGAGG - Intronic
902848703 1:19134816-19134838 AGGTGCAGGGAAGAGTGTGAAGG - Intronic
902983127 1:20139581-20139603 AGGGGCAGGGACAGGCGTGAGGG + Intronic
903812174 1:26040802-26040824 AGGTGCAGGGCCAGGTGTGGTGG + Intronic
904318530 1:29681578-29681600 AGGTGCAGGGACAGGTGGGGTGG + Intergenic
904768857 1:32870222-32870244 CTGTGCAGGAGCACGTGTGAAGG - Intronic
905635189 1:39546266-39546288 ATGTGCAGGGCCAAGTCTAGAGG - Intergenic
905862300 1:41359839-41359861 AGGAGCAGGGCCAAGGGTGAGGG - Intergenic
905892569 1:41526508-41526530 ATGTGTGAGGGCAAGTGTGACGG - Intronic
905931451 1:41790816-41790838 ATATGCTAGGACAAGTGTTAGGG - Intronic
907240672 1:53079274-53079296 ACCTGCAGGTACAAGAGTGAGGG + Intronic
908169720 1:61492555-61492577 ATGTGGAAGGCCAAGTGTGGTGG - Intergenic
909446952 1:75758404-75758426 ATGTGCAGGGTAAGGTATGAGGG + Intronic
909660483 1:78076433-78076455 ATGTATTGGGACAAGTGGGATGG + Intronic
909772868 1:79446041-79446063 ATGTTCAGGGACACTTGTGCAGG - Intergenic
910430283 1:87153224-87153246 CTGTGCAGGGCTAGGTGTGAGGG + Intronic
911482063 1:98456051-98456073 ATGTGAAGGGACACGGGTGCAGG - Intergenic
912747053 1:112253600-112253622 AGGGCCAGGGACAAGTGAGAGGG + Intergenic
912991538 1:114492142-114492164 ATGTGTAGGGATGACTGTGAAGG + Intronic
915552757 1:156644720-156644742 AAGTGCAGGGACAGGTATGAAGG + Intronic
923158078 1:231295893-231295915 ATGTGAAAGGACAGCTGTGAAGG - Intergenic
923552801 1:234977652-234977674 CTGTGCCTGGCCAAGTGTGAGGG - Intergenic
923989474 1:239419768-239419790 ATGTACAGGGAAAAGGCTGAAGG - Intronic
1062787660 10:278640-278662 ATGTGCAGGGAAAAGTCTTCTGG + Intronic
1069153318 10:64993359-64993381 TTGTGCAGGGATAACTGAGAAGG + Intergenic
1072879221 10:99207664-99207686 ATGTGGAGGGAGTAGAGTGAAGG + Intronic
1073625586 10:105092586-105092608 TTGTGAATGCACAAGTGTGAGGG - Intronic
1074359458 10:112813526-112813548 ATGTGTAGGGACCATTCTGAAGG + Intronic
1076354757 10:129843454-129843476 AGGTGCACGGACAAGCGGGAGGG + Intronic
1076801633 10:132833699-132833721 GTGTGGAGGGACAGGCGTGATGG - Intronic
1078930351 11:15907680-15907702 GTGTGTAGGGCCAAGTGTGATGG - Intergenic
1079341778 11:19617621-19617643 AAGTGCATGGTAAAGTGTGAGGG + Intronic
1079401744 11:20111465-20111487 ATGTCCAGTGACAAGTGAGGAGG + Intronic
1080866640 11:36201109-36201131 ATTTGAAGGTAGAAGTGTGATGG + Intronic
1081063752 11:38512998-38513020 ATTTGCAGGGACATGGATGAAGG - Intergenic
1081690813 11:45076670-45076692 ATGTACAGGGACAACTATAAGGG - Intergenic
1081933138 11:46886338-46886360 ATCAGCAGGGCCAAGTGGGATGG - Exonic
1082747998 11:56987780-56987802 ATGTTCAGGGGTACGTGTGAAGG - Intergenic
1088544614 11:110947004-110947026 ATGTGCCAGGCAAAGTGTGAGGG - Intergenic
1091302320 11:134515411-134515433 GTGTGCAGGGTGCAGTGTGAAGG - Intergenic
1097146169 12:56940854-56940876 CTCAACAGGGACAAGTGTGAAGG + Intergenic
1097151886 12:56985331-56985353 CTCAACAGGGACAAGTGTGAAGG + Intergenic
1099029822 12:77512250-77512272 ATGGGCAGGCACAAGGGGGAAGG + Intergenic
1100793323 12:98154054-98154076 ATATGGAAGGACAGGTGTGAAGG - Intergenic
1101119235 12:101562037-101562059 GTGTGCAGGGACTGGTGAGAGGG - Intergenic
1101657465 12:106735814-106735836 AAGTACAGAGACAAGTGTTATGG + Intronic
1102588076 12:113937135-113937157 AACTGCAGAGACAAGAGTGATGG + Exonic
1102637531 12:114337110-114337132 AGGTGCAGGGACCAGTGTGATGG - Intergenic
1103077331 12:117994741-117994763 AGATGCATGGACAAGGGTGAAGG - Intergenic
1103698806 12:122836723-122836745 CTCTGCAAGGACAAGTGGGACGG - Intronic
1105276079 13:18928150-18928172 TTGGGCAGGGCCCAGTGTGAAGG + Intergenic
1106524758 13:30530402-30530424 TTGTGCAGGTAAAAGTGTGTAGG + Intronic
1108760762 13:53560986-53561008 AGTTGCAGGGAGAAGTGGGAGGG - Intergenic
1109947588 13:69457857-69457879 ATGTAAAGGAACAAATGTGAAGG + Intergenic
1111610695 13:90603223-90603245 AGGTGCAGGGGCCAGGGTGAGGG + Intergenic
1113840430 13:113356551-113356573 ATGTGCAGGGCCAGGCGTGGTGG - Intronic
1113991974 14:16035177-16035199 ATGTGACGGGAGAAGTGTCAAGG - Intergenic
1118538991 14:66802187-66802209 ATGTGAAGGGAAAAGTGCAAAGG - Intronic
1118899978 14:69978384-69978406 ATGTGCTGGGACAATTATGAAGG - Intronic
1119014088 14:71031332-71031354 AAGTGCTGGGACAGGTGTGCAGG + Intronic
1121297128 14:92837363-92837385 CTGTGCAGACACAGGTGTGAGGG - Intronic
1122181037 14:99954730-99954752 ATGCTCAGGGTGAAGTGTGAAGG - Intergenic
1122885063 14:104707218-104707240 ATGTCCAGGGTCAAGGGAGAAGG - Intronic
1123961137 15:25402349-25402371 ATCTGCAAGGACCAGTGTGAAGG + Intronic
1124358326 15:29015765-29015787 TTGTGGGGGGACAAGAGTGAAGG + Intronic
1129084396 15:73073333-73073355 AGGTTGAGGGACAAGTGGGAAGG + Intronic
1129800233 15:78408330-78408352 ATGTGCAGGGAGACTTGAGAAGG - Intergenic
1130069518 15:80634789-80634811 AGGTTCAGGGACACGTGTGCAGG + Intergenic
1132650385 16:1018919-1018941 ATGGGCAGGCACAGGTGTGGTGG + Intergenic
1134669005 16:16040831-16040853 ATATTTAGGGACAAGAGTGAAGG + Intronic
1137005967 16:35274580-35274602 ATGAGCAGAGCCAAGTGGGAGGG + Intergenic
1139538755 16:67597622-67597644 ATTGGCAGGGCCAAGTGTGGTGG - Intronic
1142303804 16:89274531-89274553 AACTGCATGGACAAGTGTTACGG + Intronic
1143420667 17:6789202-6789224 ATGTGAATGGCCAAGTTTGATGG + Intronic
1144212225 17:13025429-13025451 CTGTCCAGGGAGAAGGGTGAGGG + Intergenic
1144483961 17:15649778-15649800 ATGAGCTTGGACAAGTGTGGTGG + Intronic
1147219306 17:38919245-38919267 CTGTGTAGGGACCAGTGGGATGG + Exonic
1147960822 17:44166690-44166712 ATGTGAAGGGACCAGGGTGCAGG - Intergenic
1151577338 17:74959347-74959369 GTGGGCAGGGACAAGGTTGAGGG - Intronic
1152376125 17:79919876-79919898 AGGGGCATGGACAGGTGTGAGGG + Intergenic
1152722447 17:81929576-81929598 GTGTCCAGGGACAAGTGTCCTGG - Intergenic
1153475590 18:5495124-5495146 AGATGCAGGGACAATTCTGATGG + Intronic
1155179577 18:23332180-23332202 ATGTTCAAGGCCAAGTGTGGTGG - Intronic
1156089272 18:33445338-33445360 ATGTGCATGGGCTAGTGTGAGGG + Intergenic
1157484395 18:48076643-48076665 ATGGGCAGGGAGCAGGGTGAGGG + Intronic
1158406511 18:57164718-57164740 GAGAGCAGGGTCAAGTGTGAAGG - Intergenic
1159618273 18:70607320-70607342 ATGTGCAGGGTGAAATGGGAGGG + Intergenic
1164616749 19:29671698-29671720 ATCTGCAGGGGCAAGTGGAACGG + Intronic
1164630614 19:29759395-29759417 AACTGCAGGCACAAGTGTGGTGG - Intergenic
1164630890 19:29760790-29760812 AACTGCAGGCACAAGTGTGGTGG - Intergenic
1164704450 19:30309954-30309976 AGGGGCAGGGACAAGTGGGAAGG + Intronic
1166054576 19:40280665-40280687 AGGTGCAGGGACAAGCCTCACGG - Intronic
925958930 2:8996679-8996701 ATGTGGAGGGTCAAGAGGGAAGG - Intronic
926166175 2:10523121-10523143 ATGTGCAGGGACCGATGGGAGGG + Intergenic
929405381 2:41636121-41636143 ATGTCCAGGGTCAAGTTTAAAGG - Intergenic
932574580 2:72955716-72955738 ATGTGCAGGGTCCAGTGTCCAGG - Intronic
934856605 2:97733750-97733772 ATGTGCACAGGCAGGTGTGATGG - Intronic
935664494 2:105498344-105498366 CTGTGCTGGGTCAAGAGTGAAGG - Intergenic
935935749 2:108181408-108181430 ATGAGATGGGAGAAGTGTGAGGG + Intergenic
936410943 2:112257585-112257607 TTTTGCAGGGAGAAGTGTTAAGG - Intergenic
937241781 2:120466513-120466535 ATTTGCAGGGCCAAGTGTGGGGG + Intergenic
937571879 2:123373361-123373383 ATGTGCAGGGACAGGAGGCAGGG + Intergenic
938160372 2:128980082-128980104 AGGAGCAGGGACCACTGTGATGG + Intergenic
938173137 2:129100816-129100838 CTGGGCAGGGACAAGGGTCATGG - Intergenic
938317344 2:130339336-130339358 ATGTTTTGGGACAAGTGTGGGGG - Intronic
941919872 2:170839643-170839665 ATGTGCAGAAACAGGTGTAAAGG - Intronic
942352390 2:175065850-175065872 ATGGGTAGGGAAGAGTGTGAAGG + Intergenic
945910647 2:215645036-215645058 ATGTGTAGGGCCTAGTGAGAAGG - Intergenic
946572068 2:221035273-221035295 ATGGGCAATGACAAGTGTTATGG - Intergenic
946639732 2:221771080-221771102 ATGTATAGGTACAATTGTGAAGG + Intergenic
948371675 2:237493628-237493650 ACGTGCAGGGTGAAGAGTGATGG + Intronic
948926169 2:241099706-241099728 ATGTGCAGGAACCAGAGTGCAGG - Exonic
1169359879 20:4938952-4938974 ATGTGGAGGGCTGAGTGTGATGG + Intronic
1169623483 20:7536216-7536238 ACTTGCAGGGAAAAGTGGGAGGG + Intergenic
1170773616 20:19356258-19356280 GTGTGCAGTGACAAGTCTGCAGG - Intronic
1171769876 20:29314092-29314114 ATGTGTTGGGAGAAGTGTCAAGG + Intergenic
1171812603 20:29757242-29757264 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1171868672 20:30508982-30509004 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1173533160 20:43786310-43786332 ATATGCAGGGCCAGGTGTGATGG - Intergenic
1173825267 20:46044013-46044035 AGGTGCTGGGACCTGTGTGAGGG + Intronic
1174540497 20:51285552-51285574 ATATGCAGGGACAGTTGGGAAGG + Intergenic
1175771822 20:61628820-61628842 ATGGGCACAGACAAGTGTGTGGG + Intronic
1175947267 20:62564754-62564776 CTCTGCAGGGACTGGTGTGAAGG - Intronic
1176171305 20:63697574-63697596 ACGTGCAGGGGCAGGAGTGAGGG - Intronic
1176427520 21:6557894-6557916 ATGTGCAGGGCCAGCTGTGAAGG + Intergenic
1179554238 21:42162443-42162465 CTGTGCAGGGATAAGTGAGGAGG + Intergenic
1179554357 21:42162959-42162981 CTGTGCAGGGATAAGTGAGCAGG + Intergenic
1179703011 21:43166211-43166233 ATGTGCAGGGCCAGCTGTGAAGG + Intergenic
1180315296 22:11272350-11272372 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1183844500 22:40529931-40529953 CTGTGCATGGACAAATGTGTGGG + Intronic
949542326 3:5042731-5042753 ATGTACAGGGAAAAGTGTCTGGG + Intergenic
949922607 3:9014663-9014685 ATGAGCAGGGAATAGTGTGGAGG + Intronic
950574640 3:13824695-13824717 ATGTGCAGGGCCAAGAGGCATGG - Intronic
951660320 3:25056098-25056120 ATGTGCAGGGAGAGGTTTCAGGG + Intergenic
953010850 3:39024066-39024088 ATCTGCAGTGACACTTGTGATGG - Intergenic
953345420 3:42171613-42171635 ATGAGCCGGGAGAAGTGGGAAGG - Intronic
953448869 3:42990039-42990061 CTGTGCAGGGCCAGGTGTGGTGG + Intronic
954421162 3:50419760-50419782 ATGTGCAGGGAGGCGTCTGAGGG - Intronic
954508449 3:51099787-51099809 ATTTGAAGGGATAAGTGTTATGG + Intronic
954615111 3:51965601-51965623 GTGTGCAGGGAGAAGAGTTAAGG + Intronic
954941009 3:54373206-54373228 ATGTTCAGGGACCAGAGTCAGGG + Intronic
955131629 3:56175160-56175182 ATGTCCAAGGACCAGTGTGGGGG + Intronic
955369069 3:58335160-58335182 ATCTGCAGGGCCAGGTGTGGTGG - Intronic
955683866 3:61530012-61530034 ATTTGCAGTGCCAAGTGTAAAGG + Intergenic
961001900 3:123379573-123379595 AAGTGCAGGGAGCAGTGGGAAGG + Intronic
961096427 3:124160412-124160434 CTGTGCAGAGAGAAGGGTGATGG + Intronic
962269598 3:133968063-133968085 ATGTGAAGGGGAAGGTGTGAGGG - Intronic
965516719 3:169629728-169629750 ATGGTCAGGGACAAGTGGGGAGG + Intronic
965930134 3:174032265-174032287 ATGTGAAGGGAAATCTGTGAAGG + Intronic
966280933 3:178227672-178227694 ATGTGCAGAAACACGAGTGATGG + Intergenic
966927868 3:184657314-184657336 AGGGGCAGGGATAAGTGGGAGGG - Intronic
968925951 4:3548511-3548533 AAGTGCAGGAAGAAGTGTTATGG + Intergenic
969072101 4:4547791-4547813 ATGGGCAGGGAAAAGAGTTAGGG - Intergenic
970171145 4:13291548-13291570 AAGAGCAGGGACCAGTGTGGTGG + Intergenic
971265277 4:25091431-25091453 AGGGGCAGGGACAGGTGAGAAGG - Intergenic
972711584 4:41601554-41601576 ATGTGTAAGGACATGTGTGGTGG + Intronic
974280524 4:59785716-59785738 TTGGGCAGGGCCCAGTGTGAAGG - Intergenic
975288777 4:72651804-72651826 CTTTGCAGGGACACGGGTGATGG + Intergenic
977991934 4:103454266-103454288 AAGTTCAGGGACACATGTGAAGG + Intergenic
979701425 4:123672096-123672118 ATGGGCAGGGGCGTGTGTGATGG + Intergenic
981363787 4:143877761-143877783 ATGGACACGGCCAAGTGTGAAGG + Intronic
981374516 4:143998534-143998556 ATGGACACGGCCAAGTGTGAAGG + Intronic
981582702 4:146266398-146266420 ATGTGCATGGGCATGTGTGGTGG - Intronic
981751777 4:148099289-148099311 ATCTCCAGGGCCAAGTGTCATGG - Intronic
981944542 4:150325904-150325926 AAGGGCAGGGGCAAGTCTGAAGG + Intronic
983567797 4:169173221-169173243 ATGAGCAGGGACAATAGTAAGGG - Intronic
983867827 4:172789565-172789587 ATGTGCAGGGCAAGGTGTGAGGG + Intronic
985019489 4:185672285-185672307 ATGTGCAGTGGCAGCTGTGAAGG + Intronic
985603999 5:849043-849065 GTGTGCAGGGCCATGTGTGAAGG - Intronic
986060687 5:4187528-4187550 ATGTGCAGGGACAGGGAAGATGG - Intergenic
986118898 5:4811679-4811701 ATTTGCAGGGACATGGATGATGG - Intergenic
988923363 5:35964367-35964389 ATGTGGAGGTGCAAGTGAGATGG - Intronic
988938569 5:36117213-36117235 ATTCCCAGGGCCAAGTGTGATGG + Intronic
989747370 5:44846008-44846030 ATGTGCAGCCACATGTGTGAGGG - Intergenic
992440068 5:76790065-76790087 TTGTGCAAGGACACTTGTGATGG - Intergenic
992456257 5:76918854-76918876 ATTGCCAGGGACAAGTGGGAGGG - Intronic
993403378 5:87481006-87481028 AGGTCCAGGGAAAAGTGTGAAGG - Intergenic
994146696 5:96403034-96403056 ATGTGCAGGTGCATGTGTGGAGG + Intronic
995416162 5:111915671-111915693 ATGTGTAGGTGCATGTGTGAGGG - Intronic
995840652 5:116440446-116440468 ATGTGCATGCACAAATGTCACGG - Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998377457 5:141700652-141700674 TTGTCCAGGGCCATGTGTGATGG + Intergenic
999232417 5:150069604-150069626 GAGTGCAGGGACAAGAGTGGGGG + Intronic
1002669593 5:180855825-180855847 TTGGGCAGGGATAAGAGTGAAGG - Intronic
1004847761 6:19664232-19664254 ATGTGCGGGGAACAATGTGATGG - Intergenic
1004887013 6:20060868-20060890 AAGTGCAGGTTGAAGTGTGAAGG + Intergenic
1004901599 6:20199680-20199702 ATGTGCAGGGCCAGGTGCGGTGG + Intronic
1005242309 6:23845587-23845609 GTGTGTTGGCACAAGTGTGAAGG + Intergenic
1006292462 6:33149859-33149881 ATGTGGAGGGGAAAGTATGAAGG + Intergenic
1006468662 6:34212662-34212684 ATGTGTAGGGAAAAGAGTGAAGG - Intergenic
1007584374 6:42979754-42979776 ATGTGCTGGAACATGTGTGGTGG - Intergenic
1009886597 6:69631046-69631068 ACCTGGAGGGTCAAGTGTGAGGG - Intergenic
1009898769 6:69785493-69785515 ATGTGCATGGGCAAGTGAGGGGG - Intronic
1011053322 6:83178017-83178039 AGGTACAGGGACTAATGTGATGG - Intronic
1011779540 6:90771488-90771510 ATCTCCAGGGAAAAGTTTGAGGG + Intergenic
1013263547 6:108471080-108471102 ATGAGGAGGGAGAAATGTGAGGG + Intronic
1014142801 6:117963830-117963852 ATGTGCAGGGATACATGTGCAGG + Intronic
1015626140 6:135182209-135182231 AAGTGCAGTGACATGTGCGACGG - Intronic
1017884175 6:158585416-158585438 ATGTGCAGGGGTGAGTGTGTGGG + Exonic
1021578837 7:22130533-22130555 ATTTGCAGGGTCTTGTGTGAAGG - Intronic
1021751071 7:23800425-23800447 CTTTGCAGGGACATGGGTGAAGG + Intronic
1022386573 7:29904941-29904963 ATGTGCAGGGAAATGTGTCCAGG - Intronic
1023240657 7:38143257-38143279 ATTTGCAGGGACTAGTGGGAGGG + Intergenic
1023620775 7:42069939-42069961 CTGAGCAGGGAAATGTGTGAAGG + Intronic
1023969983 7:44983809-44983831 CTGTGCAGGGGTAAGTGTGCAGG - Intergenic
1024661407 7:51498696-51498718 ATCTACAGGGACCAATGTGATGG + Intergenic
1026777365 7:73239113-73239135 ACGTGCCAGGCCAAGTGTGAGGG + Intergenic
1027018215 7:74792485-74792507 ACGTGCCAGGCCAAGTGTGAGGG + Intergenic
1027069812 7:75153433-75153455 ACGTGCCAGGCCAAGTGTGAGGG - Intergenic
1029505901 7:100963973-100963995 AGTTGCAGGGACATGTGGGAAGG + Intronic
1032446411 7:131987611-131987633 ATGTGTAGAGAGAAGTGTGCAGG + Intergenic
1032553207 7:132805128-132805150 ATGTGCAGGAACAAAGGGGAGGG + Intronic
1032749409 7:134823043-134823065 ATGTGGAGGGACAGGTGGGGTGG - Intronic
1034854438 7:154528859-154528881 AGGTGCAGGGAGCAGTGTGAGGG + Intronic
1035725029 8:1818908-1818930 ATGTGCAGAGACCGGTGTCAGGG - Intergenic
1036212145 8:6851089-6851111 ATGTGCAGGGGCACATGTGCAGG - Intergenic
1037089774 8:14899559-14899581 CTGTGCAGTGGGAAGTGTGAAGG - Intronic
1037740946 8:21608842-21608864 ATGTGCAGGGACAAGAGGCATGG - Intergenic
1037754644 8:21703023-21703045 AGGAGCAGGGACAGGAGTGACGG - Intronic
1038798057 8:30727142-30727164 GTGTGTAGGGACGAGGGTGACGG - Intronic
1039886861 8:41659715-41659737 AGGCACAGGGACAAGTGTGAGGG - Intronic
1044607273 8:94058246-94058268 AGGGGCAGGTACAGGTGTGATGG - Intergenic
1044857281 8:96489683-96489705 ACATGAAGGGCCAAGTGTGATGG + Intergenic
1047678395 8:127227725-127227747 ATGGCCAGGAACAAGGGTGAAGG + Intergenic
1048164594 8:132051261-132051283 GGATGTAGGGACAAGTGTGAGGG - Intronic
1048750610 8:137669765-137669787 ATTTGCTGGTACAAGTGTGGTGG - Intergenic
1049525486 8:143124117-143124139 GTGTGCATGTACATGTGTGAGGG - Intergenic
1049810834 8:144569629-144569651 TTGTGCAGAGACAGGTGGGAGGG + Intronic
1052257306 9:26473078-26473100 ATATGCAGGGAGAATTGTGTAGG - Intergenic
1054464049 9:65482108-65482130 AAGTGCAGGAAGAAGTGTTATGG - Intergenic
1055304873 9:74919206-74919228 ATTTGGAGGGACAACTGTAATGG - Intergenic
1055501681 9:76907634-76907656 ATGGGAAGGGAAAAGTGTGTTGG - Intergenic
1056235923 9:84594332-84594354 ATGATCAGGAATAAGTGTGATGG + Intergenic
1056450390 9:86710999-86711021 ATGTGCATGGAGAAGTGACAAGG + Intergenic
1056636798 9:88337969-88337991 ATGTGCAGGGAAACTTGGGAAGG - Intergenic
1057509621 9:95666592-95666614 AGGGGGAGGGACAAGTGTTATGG - Intergenic
1058779570 9:108319324-108319346 TAGTGCAGGGAAAGGTGTGAGGG + Intergenic
1062208240 9:135348942-135348964 ATGTGCAGAGATCGGTGTGAGGG + Intergenic
1062276337 9:135733281-135733303 AGGTGCAGGGGCAGGTGTGGGGG - Intronic
1062390919 9:136333533-136333555 TTGTGCAGGGCCCAGGGTGAGGG + Intronic
1062399401 9:136365848-136365870 AGGAGCAGGGGCAGGTGTGAAGG - Intronic
1203363583 Un_KI270442v1:238259-238281 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1185906491 X:3938739-3938761 GTGTGCAAGGGCAAGTGTAAAGG + Intergenic
1186409265 X:9332060-9332082 ATGTGCAGGGACCAATGTGGTGG - Intergenic
1187717407 X:22116714-22116736 ACGTGCTGGGACAGTTGTGATGG - Intronic
1188984310 X:36755741-36755763 ATGTGCAGGGATAACTCAGAAGG - Intergenic
1191963824 X:66734085-66734107 ATTTGGAGGGACAAGTAGGAGGG + Intergenic
1192856865 X:75021228-75021250 CTTTGCAGGGACATGTATGAAGG - Intergenic
1193305839 X:79950043-79950065 AAGTGGAGAGACAAGTGAGAAGG + Intergenic
1193869306 X:86777377-86777399 ATGTGCAGGGACAAGTGTGAAGG - Intronic
1193890544 X:87040354-87040376 ATGTACAGGAATAGGTGTGATGG + Intergenic
1194661862 X:96636784-96636806 ATGGGCAGGTACTGGTGTGATGG - Intergenic
1196226475 X:113173420-113173442 ATGCCCAGGGACAAGGGTGGAGG - Intergenic
1197628509 X:128831134-128831156 CTTTGCAGGGACATGAGTGAAGG - Intergenic
1198519477 X:137438315-137438337 ATGTGACGGGAGAAGTGTCAAGG + Intergenic
1199992008 X:152992827-152992849 CTGGGCAGGGACATGTGTGTGGG - Intronic
1200703997 Y:6426077-6426099 ATGTGCATGCACAAGTCTCAGGG - Intergenic
1201030114 Y:9738631-9738653 ATGTGCATGCACAAGTCTCAGGG + Intergenic
1201182316 Y:11360514-11360536 AAGTGCAGGAAAAAGTGTTAAGG + Intergenic
1201762122 Y:17551905-17551927 ATGTTCAGGGGTACGTGTGAAGG - Intergenic
1201839430 Y:18354083-18354105 ATGTTCAGGGGTACGTGTGAAGG + Intergenic
1202178445 Y:22119077-22119099 ATGTGCATGCACAAGTCTCAGGG - Intergenic
1202212916 Y:22467317-22467339 ATGTGCATGCACAAGTCTCAGGG + Intergenic