ID: 1193873325

View in Genome Browser
Species Human (GRCh38)
Location X:86829147-86829169
Sequence AAGCATAAGCATTTGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193873323_1193873325 2 Left 1193873323 X:86829122-86829144 CCAAGCTCTGAAGGAATGTTTTC 0: 1
1: 0
2: 1
3: 18
4: 240
Right 1193873325 X:86829147-86829169 AAGCATAAGCATTTGGATTCTGG 0: 1
1: 0
2: 1
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193873325 Original CRISPR AAGCATAAGCATTTGGATTC TGG Intronic
906178540 1:43797982-43798004 ACACATAAGTATTTGGTTTCGGG - Intronic
907084683 1:51660014-51660036 AAACAGAACCATTTGGATTTGGG + Intronic
907981301 1:59484184-59484206 AAGCATGAGATTTTGGAGTCAGG - Intronic
909652759 1:77993869-77993891 AAGCTTATGCATTTGGAATTAGG + Intronic
910655810 1:89616769-89616791 AAGAACAAGCATTAGCATTCAGG - Intergenic
911775985 1:101813076-101813098 AAGCATAAGCAATAGTATTTTGG - Intronic
914442775 1:147721883-147721905 AGGCATGAGAATTTGCATTCTGG - Intergenic
914710279 1:150206997-150207019 AAGGAGAATCATTTGAATTCGGG - Intergenic
916323023 1:163526443-163526465 ATGCCTAAGCTTTTGAATTCAGG + Intergenic
917590948 1:176476392-176476414 GAGCTTCAGCTTTTGGATTCAGG - Intronic
917686999 1:177426561-177426583 AAGTAGAAGCATTTGCATTCTGG - Intergenic
919491155 1:198206750-198206772 AAACATAAGCTTTTGGATATAGG - Intronic
921467584 1:215508259-215508281 AAGCTTCAGCATTTAGATTTAGG + Intergenic
922975578 1:229780857-229780879 AAACAAAAGCCTTTGGATGCTGG - Intergenic
924144224 1:241057561-241057583 AAGAATAAGAGTTTGAATTCTGG - Intronic
1065043506 10:21722570-21722592 AAGCAAAAGCATTAAGATTCAGG - Intronic
1066755704 10:38710720-38710742 AAGAATCAGCATTTGGTTTTGGG - Intergenic
1067010736 10:42711161-42711183 AAGAATCACCATTTGGAATCTGG + Intergenic
1070355517 10:75636232-75636254 CAGCATCAGGATTTGAATTCAGG - Intronic
1070520949 10:77253141-77253163 AGGCATAAGCAGTTAGATCCTGG + Intronic
1071091210 10:81920644-81920666 AAGCAAAAGCATTAGCTTTCTGG - Intronic
1071285466 10:84140012-84140034 AGGCATAAGCCCTTGGATTAGGG + Intronic
1073719035 10:106144251-106144273 AAGCATAACCATTTGAAATTTGG + Intergenic
1079548007 11:21658587-21658609 AAGCAAAAGTAATTTGATTCCGG - Intergenic
1081195098 11:40151725-40151747 AAGCCTATACTTTTGGATTCTGG + Intronic
1081370082 11:42289903-42289925 AGGCATTAGCATTTGAATTGGGG + Intergenic
1081513155 11:43796495-43796517 TAGCATAAGCAAATGGCTTCTGG - Intronic
1082922518 11:58510837-58510859 CAGCAGCAGGATTTGGATTCAGG - Intergenic
1085679363 11:78557329-78557351 AAGCATAAGAATTTGAATTTTGG - Intronic
1086268832 11:85034910-85034932 AAGCATCTGCATTTGAATTAAGG + Intronic
1088991455 11:114957171-114957193 AAGCATAAGCTTTGGGATGAAGG + Intergenic
1091084377 11:132706209-132706231 AAACACAAGCACTTGGAGTCTGG - Intronic
1094780270 12:33784097-33784119 AAGAATAAGCATTTTTATTCAGG + Intergenic
1095267958 12:40181936-40181958 GAGGATAAGCAGGTGGATTCTGG - Intergenic
1095282420 12:40370434-40370456 GAGTATTAGCATCTGGATTCTGG + Intergenic
1095336143 12:41028972-41028994 AAGTATAAGCATTTTTATTCTGG + Intronic
1095580887 12:43796469-43796491 AAGCATAAACATTTGAATTTTGG - Intronic
1099429672 12:82567590-82567612 AAGTATACGCATTTGGATCAAGG - Intergenic
1099905607 12:88766076-88766098 AAGCATAAGAATGGAGATTCAGG - Intergenic
1102798177 12:115707611-115707633 TAGCACAAACATTTGGATTCGGG + Intergenic
1102804474 12:115767570-115767592 AGACATGAGCATTTGGTTTCTGG + Intergenic
1103216105 12:119202584-119202606 ATGCTTTGGCATTTGGATTCTGG + Intronic
1106966694 13:35079477-35079499 AAGCTTACATATTTGGATTCTGG - Intronic
1107607967 13:42080993-42081015 AAGCATAAAAATTAGGAGTCAGG - Intronic
1107808803 13:44179577-44179599 AAGAATAGGGATTTGAATTCAGG - Intergenic
1108215488 13:48179783-48179805 AAACATAAACATTTTAATTCTGG + Intergenic
1108595487 13:51945250-51945272 AATCTTCAGCCTTTGGATTCTGG + Intronic
1109723946 13:66315168-66315190 AAACACAAGCAACTGGATTCTGG + Intronic
1111632506 13:90860240-90860262 AAACACAAGCATTTGGATGCTGG + Intergenic
1118062209 14:62151771-62151793 ATGGATAAGCTTTTGGAGTCAGG + Intergenic
1118923888 14:70174088-70174110 AAAGGTAAGCATTTGAATTCTGG + Intronic
1122161244 14:99785572-99785594 AAGCAGAAAAAGTTGGATTCTGG + Intronic
1125914797 15:43476295-43476317 AAGCAGAAGTATAAGGATTCTGG - Intronic
1126371097 15:47947740-47947762 AAGCAGGAGCATGTGGGTTCAGG - Intergenic
1127224669 15:56917558-56917580 AAGAAGGAGCCTTTGGATTCCGG - Intronic
1128635127 15:69298281-69298303 AAGAAGAAACATTTGGCTTCAGG - Intergenic
1132214086 15:100050005-100050027 AAGCACAACTATTTGGATCCTGG + Intronic
1133213495 16:4276086-4276108 AAGCAGCGGCATTTGGAGTCCGG + Intergenic
1135087489 16:19486974-19486996 AAGCATAATCATTTGGATAAAGG - Exonic
1135648641 16:24186300-24186322 AGGCAGAAGCATGTGCATTCTGG - Intronic
1137324051 16:47415197-47415219 AAGAATAAGCATCTGCATTGAGG - Intronic
1137499882 16:49002636-49002658 AAGCATCATCATTTGTCTTCTGG - Intergenic
1139513199 16:67438891-67438913 AAGCACAAGCATGAGGGTTCTGG + Intronic
1140170327 16:72598098-72598120 AAGCAGTAGCATTTAGTTTCAGG - Intergenic
1140440270 16:74982755-74982777 GAGCAGTAGCATTTGGATTAAGG - Intronic
1148920834 17:51032147-51032169 AAGAAAAAGGATTTGGATTTTGG - Intronic
1150198424 17:63326358-63326380 AAGAATAAGCAAATGGATTAAGG + Intronic
1150876651 17:68977934-68977956 AAGCAGAAGCATGTTGATTTGGG + Intronic
1153116064 18:1657959-1657981 AAGAAAAAGCAATTGAATTCAGG + Intergenic
1155828898 18:30486621-30486643 AAACATACGCACTAGGATTCAGG + Intergenic
1156609275 18:38707370-38707392 AGCCATCAGCATTTGGTTTCTGG - Intergenic
1157732055 18:50012574-50012596 ATGCACAAGCATTAAGATTCAGG + Intronic
1157864338 18:51167909-51167931 AAGCCTAAGAAAATGGATTCAGG + Intergenic
1159900973 18:74045270-74045292 AAGCATGAGCATTTGGAAGTTGG - Intergenic
1161605072 19:5210353-5210375 AGGCATAAGCATTGGGAATCAGG - Intronic
1162839427 19:13345100-13345122 TAGCTTAATCATTTGGATTTGGG - Intronic
1163164708 19:15487921-15487943 CAGCATAGGCATTTGAATCCAGG - Intronic
1164908456 19:31986411-31986433 AAACATGAGCATTTGGGCTCTGG - Intergenic
926316054 2:11710809-11710831 AAGCTCAGCCATTTGGATTCTGG - Intronic
926623757 2:15071725-15071747 AAGCAGAAGCACGAGGATTCAGG + Intergenic
927347209 2:22058921-22058943 AAGCCTAAATATTTGGTTTCAGG + Intergenic
928192869 2:29189685-29189707 AAGGAGATGCATTTGAATTCAGG - Intergenic
928461200 2:31474452-31474474 AAGCATAAGCCTTGGCCTTCAGG + Intergenic
929846759 2:45538236-45538258 AAGCATCAGCAATTGTATTTGGG + Intronic
931077217 2:58729179-58729201 GACCATAAACAGTTGGATTCTGG - Intergenic
934087365 2:88521188-88521210 AAGTATCAGAATTTGAATTCAGG + Intergenic
935469174 2:103436337-103436359 AAGAATAATAATTTGGCTTCTGG + Intergenic
937714442 2:125015294-125015316 AAGCATCAGCTCTTGGAATCAGG + Intergenic
937840701 2:126521442-126521464 AAGCCTTAGAATTTGAATTCTGG - Intergenic
939099300 2:137877516-137877538 AAGCAGAAACATTTGGTTTTTGG - Intergenic
940081403 2:149806709-149806731 AAGCAAAAACATTTGGTTTGTGG - Intergenic
941351713 2:164445736-164445758 AAGCATAAAAATTTGTATTTGGG + Intergenic
941585824 2:167357863-167357885 AACTATAAACATTTGAATTCAGG + Intergenic
941603415 2:167565412-167565434 AAACCTAAGCATTAGCATTCAGG + Intergenic
943341111 2:186683325-186683347 AAACATAAGCCTTGGTATTCAGG + Intergenic
943344187 2:186718087-186718109 AAGCAAAAGCATTTCGGATCTGG - Intronic
944041946 2:195365638-195365660 AAGCAAAAGCATTTTGATGGAGG - Intergenic
945322349 2:208439879-208439901 AAGCATAAGGATTTAGAATGGGG + Intronic
945698126 2:213134686-213134708 ATGAATAAGCATTTAGATTCGGG - Intronic
1169264331 20:4158417-4158439 GAGGAAAAGCATCTGGATTCAGG + Intronic
1173395465 20:42675540-42675562 TAGCATATACATTTGGAGTCAGG - Intronic
1173863668 20:46300380-46300402 AAGCAGAAGCAGGTGGATCCAGG - Intronic
1177017176 21:15806591-15806613 AAGCAAAAGCATTTATATTGTGG - Intronic
1177445004 21:21183281-21183303 AACCACAAGCATTTTAATTCTGG - Intronic
1177537422 21:22446636-22446658 AAGTAAAAGCATTTGCATTATGG + Intergenic
1183412665 22:37664495-37664517 CAGCAAAAGGATTTGCATTCGGG - Intronic
959814333 3:110657953-110657975 AAGCATAAGCAAATGGAAACAGG - Intergenic
960980074 3:123215688-123215710 AACCACAATCTTTTGGATTCAGG + Intronic
969162907 4:5277060-5277082 TATCATAAGGATTTGGAGTCAGG - Intronic
971761433 4:30771341-30771363 AAACATAAGCCCTTGCATTCTGG + Intronic
971773271 4:30927122-30927144 AAGCAAAAGCTTTGGGAGTCTGG - Intronic
977000636 4:91495923-91495945 AAGCATAAACATTTGAATCCTGG + Intronic
977132671 4:93262159-93262181 GAGCTTAAGAATTTGGTTTCAGG + Intronic
982272937 4:153609859-153609881 AAGAATATCCCTTTGGATTCTGG - Intronic
982273090 4:153611400-153611422 AAGGATAAAGACTTGGATTCTGG - Intronic
982861370 4:160454373-160454395 AAGCATAACCATATGGATTTTGG - Intergenic
983749173 4:171243182-171243204 AAGTTTAAGAATTTGTATTCAGG - Intergenic
984719388 4:182955781-182955803 AGGCATAAGCTTTTGGGTTGTGG + Intergenic
984882378 4:184421556-184421578 AAGCATAAAGCTTTAGATTCTGG - Intronic
986888475 5:12270231-12270253 AAGCACAAGAAATTGAATTCAGG + Intergenic
990577291 5:57135701-57135723 AAGAATAAGAATTTGCATTTGGG + Intergenic
990981802 5:61608112-61608134 AAGCATATACATTTTGAATCAGG + Intergenic
992625218 5:78630722-78630744 AAGCAAAAGAATTTGTCTTCTGG - Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993343436 5:86753381-86753403 AAGCATAGGCATTACCATTCAGG - Intergenic
1000076387 5:157791503-157791525 TAGCATAGTCATTTGCATTCTGG - Intronic
1000106323 5:158062500-158062522 AAGAATAAGTATTTGGAATCTGG - Intergenic
1000393487 5:160749072-160749094 AAGAACATGGATTTGGATTCAGG - Intronic
1000407941 5:160908473-160908495 AAACATAAACATTTGGATTCTGG - Intergenic
1000736857 5:164914144-164914166 AAACATAAGCTTTTGTATTATGG - Intergenic
1004914891 6:20322370-20322392 AAGCATCTGCAGTTGGATTATGG + Intergenic
1008800362 6:55361640-55361662 AGGCCTAAGGATTTGGTTTCTGG - Intronic
1010415244 6:75604328-75604350 GAGCATAAGCATAAGGGTTCTGG + Intronic
1014835662 6:126157417-126157439 AACCAAAAGCCTTTGCATTCAGG + Intergenic
1015383085 6:132592082-132592104 AGGCAAAAGTAATTGGATTCTGG + Intergenic
1015480426 6:133702309-133702331 AAACATAAGACTTTGGATCCTGG - Intergenic
1016302941 6:142652155-142652177 AAGCAAAAGCATTTTTAGTCTGG - Intergenic
1016556550 6:145344912-145344934 AAGCATAAGTATATGGACTTCGG + Intergenic
1016703486 6:147079829-147079851 AACCAGAAGCTTTTGGATTTAGG + Intergenic
1016882327 6:148923119-148923141 AAGCATAAGCATTTTTTTTAAGG - Intronic
1018115948 6:160585640-160585662 AAGCAAAAGCCTTCAGATTCTGG + Intronic
1019110583 6:169708278-169708300 AAGCATAATTATTAGGATTCCGG - Intronic
1020738915 7:11988454-11988476 AAGCAGAAACAACTGGATTCTGG + Intergenic
1022043623 7:26604290-26604312 AAGCATAAACATTTGCCTCCTGG + Intergenic
1022567423 7:31417174-31417196 AAGCATAAGAATTTGTCTCCAGG + Intergenic
1023371329 7:39515252-39515274 AAGAAAAAGCAATTGGAATCAGG - Intergenic
1024485830 7:49918478-49918500 TAGCATAAGCATTTAGACTAGGG - Exonic
1026522667 7:71131128-71131150 AAGCATATTCATTTGGCTCCTGG - Intergenic
1030206708 7:106958523-106958545 AAGTAAAAGCATTTGTATACAGG + Intergenic
1031861483 7:126984541-126984563 AAGCTGAAGAATTTGGAGTCTGG - Intronic
1033685061 7:143631827-143631849 AAGCATAAACATTTTGGTTGAGG - Intronic
1033688234 7:143711046-143711068 AAGCATAAACATTTTGGTTGAGG - Intronic
1033699552 7:143825794-143825816 AAGCATAAACATTTTGGTTGAGG + Intergenic
1036688709 8:10927984-10928006 AAGGATGAGCATTTGCATTGAGG - Intronic
1040351865 8:46577042-46577064 AAGTATAATCATTTGGAGGCTGG + Intergenic
1040700013 8:50051865-50051887 AACCATAACAATTTGTATTCTGG + Intronic
1040844289 8:51820979-51821001 AAGCATAAGAATTTGGAAACAGG + Intronic
1041682814 8:60610122-60610144 CAGCATAAGCATAAGGCTTCTGG - Intronic
1041756410 8:61317779-61317801 AAGCTGAAGCATTTTTATTCGGG - Intronic
1041835313 8:62205767-62205789 AAGCATAATCTTTGGGATTTGGG - Intergenic
1042260774 8:66857124-66857146 AAGCATGGGCTCTTGGATTCTGG - Intronic
1042350218 8:67769434-67769456 AAGCTTCAACATATGGATTCTGG + Intergenic
1043752734 8:83960641-83960663 AAACATAATCATTTGGATCCAGG + Intergenic
1043996745 8:86826973-86826995 TAGCAAAAGCATTTGGTTCCTGG - Intergenic
1046367080 8:113248791-113248813 AAGCATAAGTATTTTAAATCTGG + Intronic
1048732369 8:137457451-137457473 GTGCTTAAGGATTTGGATTCTGG + Intergenic
1050159254 9:2700041-2700063 AAACCTGTGCATTTGGATTCTGG - Intergenic
1050616785 9:7409472-7409494 AAGAATATGAGTTTGGATTCTGG + Intergenic
1051351762 9:16204326-16204348 AAGGATAAGGATTTGGACACAGG - Intronic
1052138511 9:24946736-24946758 TAGCTTAAGCCTGTGGATTCTGG + Intergenic
1058090805 9:100803499-100803521 AAGCTGAAGAATTTGGAGTCTGG + Intergenic
1058624405 9:106919568-106919590 AAACATAAACAATTGGATTGTGG + Intronic
1059111777 9:111564746-111564768 AAACATATGGATTTGGATTGGGG - Intronic
1059985263 9:119814870-119814892 AAGCAGAATCATTGGAATTCTGG - Intergenic
1061210507 9:129189682-129189704 AGCCATTAGCATTTGGGTTCTGG - Intergenic
1061548305 9:131317568-131317590 ATGCATAAGAATTTGGATTGGGG - Intergenic
1061701270 9:132417756-132417778 AAACATAAATATTTGGACTCGGG - Intronic
1185531872 X:826851-826873 AAGAATAAGAATTTGAATGCAGG + Intergenic
1186745152 X:12560193-12560215 AAGCAGAAGTATTTGAATACAGG - Intronic
1186769883 X:12807157-12807179 AAGCACTAGCATTTGGTGTCTGG + Intronic
1189423521 X:40878024-40878046 AAACATATGCATTTTCATTCAGG + Intergenic
1189921440 X:45906674-45906696 CAGCAGAAGCATGAGGATTCAGG - Intergenic
1190160806 X:48030204-48030226 CAGCAGATGTATTTGGATTCTGG + Intronic
1190377068 X:49798446-49798468 AAGCTAAAGCAGTTGGATTGTGG + Intergenic
1191020309 X:55851998-55852020 AAGCAGAAGCATTTGGACAGTGG - Intergenic
1193198472 X:78660267-78660289 AAGCTTCTGCATTCGGATTCAGG - Intergenic
1193873325 X:86829147-86829169 AAGCATAAGCATTTGGATTCTGG + Intronic
1196430081 X:115615201-115615223 AATCAAAACCACTTGGATTCTGG + Intronic
1197004235 X:121476508-121476530 AATCATAAGCATTAATATTCTGG + Intergenic
1200692578 Y:6321681-6321703 AAGCTTATGCATTTAGACTCTGG - Intergenic
1200712860 Y:6504792-6504814 AAGCTTATGCATTTAGACTCTGG + Intergenic
1201021054 Y:9657248-9657270 AAGCTTATGCATTTAGACTCTGG - Intergenic
1201042695 Y:9853045-9853067 AAGCTTATGCATTTAGACTCTGG + Intergenic
1201723385 Y:17128857-17128879 AAACTTAAGCATGTAGATTCAGG - Intergenic
1201855244 Y:18534295-18534317 AAGAATAAGGATTTGGTTTAGGG + Intergenic
1201878078 Y:18786090-18786112 AAGAATAAGGATTTGGTTTAGGG - Intronic
1201944398 Y:19496277-19496299 CAGCAGAAGCATTTGAATGCTGG + Intergenic
1202079489 Y:21070071-21070093 ATACTTAAGCATTTGAATTCTGG - Intergenic