ID: 1193873379

View in Genome Browser
Species Human (GRCh38)
Location X:86829841-86829863
Sequence AGGGACACACACTGACATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193873379_1193873383 -1 Left 1193873379 X:86829841-86829863 CCCAAATGTCAGTGTGTGTCCCT 0: 1
1: 0
2: 2
3: 19
4: 219
Right 1193873383 X:86829863-86829885 TCTTTTTAAGTTCTCAAGCTCGG 0: 1
1: 0
2: 3
3: 28
4: 288
1193873379_1193873384 13 Left 1193873379 X:86829841-86829863 CCCAAATGTCAGTGTGTGTCCCT 0: 1
1: 0
2: 2
3: 19
4: 219
Right 1193873384 X:86829877-86829899 CAAGCTCGGTAACATTCCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193873379 Original CRISPR AGGGACACACACTGACATTT GGG (reversed) Intronic
901638385 1:10680826-10680848 GGGGACACACACTGACTTCCCGG + Intronic
902339181 1:15771656-15771678 AGGGACACGCGATGGCATTTAGG + Intronic
903674194 1:25054218-25054240 AAGGACAGAAACTGAGATTTGGG - Intergenic
904207644 1:28865140-28865162 AAGGACAGACACTGATATTCTGG - Intergenic
913100495 1:115559815-115559837 AGGCACAGAGAGTGACATTTGGG - Intergenic
914891782 1:151631144-151631166 AAGGACAGACCCTTACATTTTGG + Intronic
915342008 1:155181790-155181812 AGGGACAAACACTGGCACTGGGG - Intronic
915581016 1:156813577-156813599 AGGGGCACACAGAGTCATTTGGG - Intronic
917493370 1:175517505-175517527 AGGGACACAGGTTGGCATTTAGG + Intronic
921369499 1:214407031-214407053 TGGGAAACACCCTGACTTTTGGG + Intronic
922215353 1:223515816-223515838 AGGGAGACACACAGGTATTTTGG + Intergenic
923845325 1:237724164-237724186 ATGCACACACACATACATTTAGG - Intronic
924444998 1:244120776-244120798 AGGACAACACACAGACATTTTGG - Intergenic
1063328871 10:5135198-5135220 AGCTCCACACACTGATATTTGGG + Intronic
1065638638 10:27757087-27757109 ACACACACACACTGTCATTTGGG - Intergenic
1066439662 10:35426263-35426285 ACACACACACACTGGCATTTAGG + Intronic
1067195808 10:44117046-44117068 GGGAACACCTACTGACATTTTGG - Intergenic
1070181245 10:74016129-74016151 AGGGAAAAAGACTGTCATTTAGG - Intronic
1071287166 10:84159511-84159533 AAGCACACACACTGAAATTAAGG - Intergenic
1071859514 10:89657694-89657716 AGGGAGATACACTGTCTTTTGGG - Intergenic
1073957837 10:108892912-108892934 AGGGGGCCACAATGACATTTTGG + Intergenic
1076765784 10:132632290-132632312 AGGGACACACACAGAGCTCTAGG - Intronic
1077353043 11:2101537-2101559 AGAGAGACGCCCTGACATTTGGG - Intergenic
1079143605 11:17831462-17831484 AGGGACACACTCAGACAATGAGG + Intronic
1080314897 11:30937309-30937331 AGGGAGAAAAAGTGACATTTTGG - Intronic
1080413452 11:32048007-32048029 AGGCACACACACTCATATTCAGG + Intronic
1087043185 11:93821308-93821330 AGGGACACACCCTGACCTGCAGG + Exonic
1089454592 11:118618614-118618636 GAGTACACACACAGACATTTTGG - Intronic
1090928537 11:131274617-131274639 AGAGACACACACACACGTTTTGG - Intergenic
1091629172 12:2146438-2146460 AGGGACTCACAAATACATTTTGG + Intronic
1093383123 12:18519668-18519690 AAAGACACACACTGACAAATTGG - Intronic
1094324586 12:29222935-29222957 TTGCACACACACTGACAATTTGG + Intronic
1096899302 12:54858218-54858240 AGGGACACACTCTACCATTCGGG - Exonic
1097432883 12:59530353-59530375 GCGGACACACACTGCGATTTGGG - Intergenic
1098056795 12:66515561-66515583 AGGGACAGACAGTGACGTTCTGG + Intronic
1100866759 12:98865741-98865763 AGGGACTCACACAGATATCTGGG + Intronic
1101533595 12:105596853-105596875 AGAGACACAGACTGAAAGTTGGG - Intergenic
1101780126 12:107827708-107827730 AGGGAGGCACACTGACATGGGGG + Intergenic
1103839872 12:123853938-123853960 ACGCACACACACACACATTTGGG + Intronic
1105803746 13:23936370-23936392 AGGGTGACACTCTGACACTTAGG + Intergenic
1108474267 13:50798403-50798425 TGGGACATACACTGACACCTAGG + Intronic
1108522836 13:51260610-51260632 AGATGCACACACTGATATTTAGG + Intronic
1115367639 14:32576566-32576588 AGGCTCAGACACAGACATTTGGG + Intronic
1118686428 14:68295886-68295908 TGAGACACACACTGGGATTTGGG - Intronic
1119856466 14:77904751-77904773 AGGGTCACACCCTGACCATTAGG - Intronic
1119900210 14:78253207-78253229 AAGGAAACACACTGAAATTTGGG + Intronic
1120391112 14:83909736-83909758 AGTGACATACACTCACATCTTGG - Intergenic
1121423483 14:93832152-93832174 AGATACACACTCTGACATCTGGG - Intergenic
1122022584 14:98851540-98851562 AGGGAGATACCCTGACATCTAGG - Intergenic
1122689691 14:103526326-103526348 GGGGTCTCACCCTGACATTTAGG - Intergenic
1122907786 14:104810196-104810218 AGGTACACCCACGGACACTTGGG + Intergenic
1125950836 15:43749919-43749941 ATGGTCTCACACTGTCATTTAGG - Intronic
1127265407 15:57356861-57356883 AGGGACTCACTCTGTCATTGAGG - Intergenic
1128536119 15:68491880-68491902 TGGGAAACACACTGACACTGGGG + Intergenic
1132514425 16:359638-359660 AGGGTCACACACGGACCTCTGGG - Intergenic
1133094761 16:3435800-3435822 AGGGGCACATACTGGCATTTAGG - Exonic
1133654759 16:7850138-7850160 AGTGAAACTCAGTGACATTTGGG + Intergenic
1133820644 16:9233260-9233282 AGGCACACACACTGCATTTTGGG - Intergenic
1136463196 16:30424688-30424710 AGGGAGAGACACAGACATCTTGG - Intronic
1138070797 16:53991170-53991192 AAGGACACACGCTGAGATTTGGG - Intronic
1139298644 16:65925152-65925174 ATGGACACATACTGCAATTTGGG + Intergenic
1139455282 16:67069961-67069983 AGGGACTCACTCTGTCACTTAGG - Intronic
1140571168 16:76107903-76107925 AGGGACACACACTAATCTTAAGG + Intergenic
1141988676 16:87596772-87596794 AGGGACACACAGTGGGTTTTGGG + Intergenic
1144478200 17:15607510-15607532 AGTTATCCACACTGACATTTGGG - Intronic
1144920093 17:18756196-18756218 AGTTACCCACACTGACATTTGGG + Intronic
1145118673 17:20235958-20235980 AGGCACACACAGTGACACTCAGG - Intronic
1148046893 17:44749859-44749881 GGGGACAAACACAGTCATTTTGG - Intronic
1148252785 17:46099458-46099480 AGGGACACACATTGAACATTAGG + Intronic
1148781375 17:50123906-50123928 AGGGACAGACACTGAGATTGAGG + Intronic
1149254647 17:54811882-54811904 ATGGATACACACAGACATTAAGG + Intergenic
1149398893 17:56273913-56273935 AGGGAGAGACAGTAACATTTGGG - Intronic
1152757657 17:82093727-82093749 AGGAACACACACTGGCGTCTGGG - Exonic
1155841762 18:30653747-30653769 AGGGTCTCACTCTGTCATTTAGG - Intergenic
1156295167 18:35782906-35782928 AGTGACACATATTGACACTTAGG + Intergenic
1156833490 18:41524306-41524328 AGGGTCACACTCTGTCATTCAGG - Intergenic
1158158603 18:54454239-54454261 TGTGACACATAATGACATTTTGG - Intergenic
1158740565 18:60136905-60136927 ACGCACACACACTCACATATAGG + Intergenic
1160511422 18:79455573-79455595 AGGGAGACACACAGAAATGTGGG + Intronic
1161138742 19:2635907-2635929 AGGGACACTGAGTGATATTTGGG + Intronic
1165976319 19:39680005-39680027 TGGGACACACACTGACACATGGG - Intergenic
925086923 2:1115822-1115844 AGGGACAGTCACTGAAGTTTGGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926497744 2:13612508-13612530 AGGGTCACACTCTGTCATCTAGG - Intergenic
928286925 2:29998908-29998930 AGAGACAAAGAATGACATTTGGG + Intergenic
928341216 2:30444762-30444784 AGGGACACACTATGACATACAGG - Intergenic
928479790 2:31670735-31670757 ATGGAAACACATTGACATTATGG - Intergenic
929037561 2:37709084-37709106 ATGCACACACACTGACATGCGGG - Intronic
929252366 2:39773010-39773032 AGGAACAGACAATGACATTATGG + Intronic
929329011 2:40656898-40656920 AGAGACACACACTGAACATTGGG + Intergenic
930478298 2:51913471-51913493 AAAGACACACACTGACAAATTGG + Intergenic
931495810 2:62806003-62806025 AGGGTCTCACTCTGTCATTTAGG + Intronic
933748624 2:85588785-85588807 AGGGATACACCCTGACAGTGAGG - Intronic
934892129 2:98079851-98079873 AAAGACAAACAATGACATTTAGG + Intergenic
937003371 2:118488813-118488835 AGGGAAACTCACTGACATTTTGG + Intergenic
937053780 2:118914046-118914068 AGGGACAGACACTACCAGTTGGG - Intergenic
937979060 2:127602622-127602644 AGGGTCTCACTCTGTCATTTGGG - Intronic
939846115 2:147247767-147247789 GGGGAAGCAAACTGACATTTAGG + Intergenic
940892791 2:159051196-159051218 TGGACCACACACTTACATTTAGG + Intronic
941184022 2:162298800-162298822 ACACACACACACTCACATTTTGG + Intronic
941552197 2:166930693-166930715 AGATACAGAAACTGACATTTAGG - Intronic
945137377 2:206642593-206642615 AGGGACCCACTCTGTCCTTTGGG - Intergenic
945230843 2:207587831-207587853 ATGGACACAAACTTACATCTAGG + Intronic
945852430 2:215025321-215025343 AGGGTCTCACACTGTCACTTAGG + Intronic
945970942 2:216231496-216231518 AGGGTCACACTCTGTCACTTAGG + Intergenic
1169130390 20:3163819-3163841 AGGGACACACACTCACAACCAGG + Exonic
1173026916 20:39316209-39316231 AGGGACACAAACTGAAAGCTGGG + Intergenic
1173470476 20:43319816-43319838 AGGGAAAGAAACTTACATTTAGG + Intergenic
1174356523 20:50001900-50001922 AGGGCCATAGAGTGACATTTGGG + Intergenic
1178809940 21:35872382-35872404 GGGGACACACAGTGACACATGGG - Intronic
1179895333 21:44358656-44358678 AGGAACATACAAGGACATTTGGG + Intronic
1181264395 22:21622331-21622353 AGTTACACACACTGACATCAGGG - Exonic
1184068085 22:42131509-42131531 ACAGACTCACACTGACACTTAGG + Intergenic
1184785544 22:46669959-46669981 TGGGCCACACACTGGCATGTGGG + Intronic
949676835 3:6464378-6464400 ACGCACACACACACACATTTTGG + Intergenic
949880100 3:8654829-8654851 GAGGCCACACACTGAGATTTGGG - Intronic
950460015 3:13115615-13115637 AGGGGCACACACTGGCACCTGGG + Intergenic
952971059 3:38650277-38650299 ATTGACACACACTGACACTGAGG + Intergenic
954600018 3:51859966-51859988 AGGCACAAACACAGACATATAGG + Intergenic
954710406 3:52502604-52502626 AGGGACACACAGAGACAGATGGG - Intronic
956007180 3:64792565-64792587 AGTGACAGACACTGAGACTTGGG + Intergenic
956820402 3:72948997-72949019 ATGGACAGACTCAGACATTTTGG + Intronic
958594450 3:96202779-96202801 AAGGACACACTCTGGCTTTTAGG - Intergenic
959204634 3:103290185-103290207 TGTGGCACATACTGACATTTTGG + Intergenic
959512040 3:107224954-107224976 AGGTACACACACTCACAGTTGGG - Intergenic
959527471 3:107393809-107393831 AGGGACACAGAGTGGCCTTTAGG - Intergenic
962020742 3:131498812-131498834 AGAGACACACACGGGCTTTTGGG - Intronic
962341458 3:134587964-134587986 AGGGACATATTCTGACATTTTGG - Intergenic
965990577 3:174812238-174812260 AGATACACAATCTGACATTTTGG + Intronic
966906761 3:184531793-184531815 AGTGAGACAGACGGACATTTGGG - Intronic
967201051 3:187072941-187072963 ACGGACACCCACTTACCTTTGGG - Exonic
967527353 3:190510081-190510103 AGGGCCACACAAGGACTTTTAGG + Intergenic
968604364 4:1525090-1525112 AGCTACACACAGAGACATTTGGG - Intergenic
968712101 4:2126730-2126752 AGGGAGACACACGGACATTCGGG + Intronic
970928113 4:21476795-21476817 AGGGACACACACAATTATTTTGG - Intronic
971981408 4:33755858-33755880 AGGGAAACACACTAAAATTTTGG + Intergenic
974262552 4:59543642-59543664 AGGGAAATAATCTGACATTTCGG - Intergenic
974889307 4:67860326-67860348 AGTCACACACACTGACACTGGGG + Intronic
975123773 4:70758601-70758623 AGGGATACAGACTGACATTTTGG + Intronic
975539660 4:75494419-75494441 ACAGACACACACACACATTTCGG + Intronic
976034357 4:80797058-80797080 AGAGAACCACAATGACATTTTGG + Intronic
979421615 4:120511303-120511325 AAAGACACAGACTGACATATTGG + Intergenic
980098893 4:128521677-128521699 AGGGAAACCCATTAACATTTAGG - Intergenic
980507094 4:133737888-133737910 AAAGACACACACTGACAAATTGG - Intergenic
984903185 4:184602856-184602878 AAGGACACAGACTGGCATATTGG + Intergenic
985339025 4:188928192-188928214 ACCAACACACAATGACATTTAGG + Intergenic
986518521 5:8589052-8589074 ATGGACTCACACTTACAATTTGG + Intergenic
988503218 5:31800379-31800401 AGGGACACTCACTCAAATCTTGG + Intronic
990016239 5:51065576-51065598 AAAGACACACACTGACAAATTGG + Intergenic
990875104 5:60475353-60475375 AGGATCAAACACTGAGATTTGGG + Intronic
991098046 5:62760126-62760148 AGGGACACAAAATGGCCTTTAGG - Intergenic
993421557 5:87708133-87708155 TGGGAGAAAGACTGACATTTTGG + Intergenic
994583415 5:101676411-101676433 AGGGACACAAAGAGCCATTTGGG - Intergenic
997334061 5:133092021-133092043 AGGGTCACACTCTGACACATAGG - Intronic
997918991 5:137959439-137959461 AGTGAAACACACTGAGATTTTGG - Intronic
998014951 5:138724647-138724669 AGGGACAGGCACTGACAGTCTGG + Intronic
998709394 5:144805778-144805800 AAGGACACACAATGGCAGTTAGG - Intergenic
1000940069 5:167350131-167350153 AGGGACTCAAACTCAGATTTTGG - Intronic
1001583961 5:172820345-172820367 TGTGACACACACTCACACTTGGG + Intergenic
1001745738 5:174090943-174090965 AGTGCCACACATTGAAATTTGGG + Intronic
1002267721 5:178046766-178046788 AGGGACCCCCAGTGACATCTGGG + Intronic
1002861644 6:1084851-1084873 AGGGACAGTCAGTGACAATTTGG - Intergenic
1003583587 6:7365343-7365365 AGGGTCACACACTGGCATCATGG - Intronic
1004038196 6:11945203-11945225 AGGGTCTCACTCTGTCATTTAGG - Intergenic
1004333312 6:14741082-14741104 AGGGATACAGCCTGCCATTTTGG + Intergenic
1004903067 6:20211606-20211628 CGGGACACACAAGGACACTTTGG - Intronic
1005753803 6:28907651-28907673 AGTGACACTCACTGACACTCTGG + Intronic
1005842635 6:29753607-29753629 AGAGACACACCCTGACACATCGG - Intergenic
1006599904 6:35218476-35218498 AGGCCCACACCCTGACATTTGGG - Intronic
1006726393 6:36202041-36202063 AGGGGCACTAAGTGACATTTTGG + Intronic
1007845295 6:44749619-44749641 AAAGACACAGACTGGCATTTCGG + Intergenic
1009584080 6:65574042-65574064 AGGGACTCCCACTGCCATGTTGG - Intronic
1010739497 6:79483293-79483315 AAGGATACACACAGACATTAAGG + Intergenic
1011323024 6:86117856-86117878 AGGGTCACATCCTGAAATTTTGG - Intergenic
1012363129 6:98407923-98407945 AGCGAGCCACAGTGACATTTTGG + Intergenic
1012945659 6:105463201-105463223 AGGGTCTCACTCTGCCATTTGGG + Intergenic
1015508286 6:134011704-134011726 AGGGTCTCACTCTGACACTTGGG - Intronic
1019374285 7:680905-680927 GGGGACACAAAGTGAAATTTGGG - Intronic
1020834924 7:13136952-13136974 AGGGACTCACATTGAAATATCGG + Intergenic
1023924497 7:44656165-44656187 AGGGACACACACACACATCAAGG - Intronic
1024484587 7:49903774-49903796 AGGGACACACACAAAGAGTTTGG + Intronic
1027528729 7:79303174-79303196 AGGGACACAAAGCTACATTTGGG + Intronic
1028410941 7:90529933-90529955 AGGTATACACATTGACAGTTTGG + Intronic
1031451007 7:121918241-121918263 ATGGATAGACAGTGACATTTGGG + Intronic
1032206077 7:129866775-129866797 AGGCTCACACAGTGGCATTTAGG - Intronic
1032336140 7:131026713-131026735 AAGGACACACACTGTTATTAAGG - Intergenic
1033834448 7:145291898-145291920 ACAGACACACACAAACATTTTGG - Intergenic
1036393868 8:8349982-8350004 ATGCACACACACACACATTTCGG + Intronic
1036480676 8:9136683-9136705 AGGGTCACACAAAGACAATTTGG - Exonic
1039759136 8:40555799-40555821 AGGGACCCACTCTGAGATTTGGG - Intronic
1039912701 8:41837404-41837426 GGGGAAACACACTGACACATGGG + Intronic
1040285262 8:46097534-46097556 TGGGACAGACACAGACACTTTGG - Intergenic
1040310113 8:46232477-46232499 AGGGACACAGAATAACATTGAGG + Intergenic
1040325767 8:46340751-46340773 AGGGACACACGGGGACATTGAGG + Intergenic
1043548977 8:81347407-81347429 ATGGACACACACAGACACATTGG + Intergenic
1045349786 8:101328438-101328460 ACAGCCACACACTTACATTTTGG - Intergenic
1045928718 8:107599661-107599683 AGGGAGGCACACTGACATGGGGG + Intergenic
1046410470 8:113835185-113835207 AGGCACACACAGTCACTTTTTGG + Intergenic
1047307193 8:123662418-123662440 AGGAACATCCACTGACATCTGGG - Intergenic
1047758718 8:127938340-127938362 AAGGAAACACACTGTGATTTGGG - Intergenic
1049402412 8:142434339-142434361 CTGCACACAGACTGACATTTGGG - Intergenic
1051948864 9:22606332-22606354 AAGGACATACACTGATATTTGGG - Intergenic
1052705127 9:31985830-31985852 AGAGAGACATACTGATATTTTGG + Intergenic
1052970610 9:34375146-34375168 AGAGACAGACACTGGCATCTGGG - Intronic
1053167126 9:35852912-35852934 AGTGACCCACACGGACATTAAGG - Exonic
1055509029 9:76976308-76976330 TGGGACAAAAACTGAGATTTGGG - Intergenic
1056549919 9:87643793-87643815 AGACACACGCACTGATATTTTGG + Intronic
1058057824 9:100466834-100466856 AGGGTCACACTCTGTCACTTGGG - Intronic
1058656401 9:107225468-107225490 CGGGATACTCAATGACATTTTGG + Intergenic
1058835955 9:108858856-108858878 ACACACACACACTCACATTTGGG + Intergenic
1059138587 9:111830966-111830988 AAGCACACACATTGACATTTAGG - Intergenic
1059545252 9:115169268-115169290 AGGGGGACATACTGACATGTGGG + Intronic
1060160779 9:121361341-121361363 AGGGACAAATAGTGATATTTTGG + Intronic
1062212669 9:135373110-135373132 AGGGACACACCCAGACATGTGGG + Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619241 X:1443283-1443305 ATGGACACACACCGCCATCTTGG + Intronic
1185619286 X:1443575-1443597 ATGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619325 X:1443815-1443837 GTGGACACACACCGCCATTTTGG + Intronic
1185619341 X:1443900-1443922 ATGGACACACACCGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1189229324 X:39440017-39440039 AGACACACACACTGGCAGTTAGG + Intergenic
1191139127 X:57096796-57096818 AGAGACACACACTGGCAAATTGG + Intergenic
1193873379 X:86829841-86829863 AGGGACACACACTGACATTTGGG - Intronic
1195636059 X:107117510-107117532 AGTTACACAGACTGAAATTTTGG - Intronic
1197180895 X:123535562-123535584 AGGGACACACGTTGACATTAAGG - Intergenic
1197181020 X:123537509-123537531 AAGGACATACATTGACATTAAGG + Intergenic
1197606873 X:128595634-128595656 AGAGACACAGACTGACAAATTGG - Intergenic
1198097378 X:133393256-133393278 AGTGAGACACACAGACATGTGGG + Intronic
1198933844 X:141886543-141886565 GGGGACCCAAAATGACATTTTGG + Intronic
1200692391 Y:6319576-6319598 ATGGACACAGACTGAATTTTTGG - Intergenic
1201042881 Y:9855151-9855173 ATGGACACAGACTGAATTTTTGG + Intergenic
1201687044 Y:16716490-16716512 AGTGAGGCACACTGACATTGGGG + Intergenic