ID: 1193875299

View in Genome Browser
Species Human (GRCh38)
Location X:86855285-86855307
Sequence AGGTTGCCTCTTCACTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193875294_1193875299 22 Left 1193875294 X:86855240-86855262 CCCTTTGTCAGATGAGTAGATTG 0: 3404
1: 11409
2: 5352
3: 2526
4: 2433
Right 1193875299 X:86855285-86855307 AGGTTGCCTCTTCACTCTCATGG No data
1193875295_1193875299 21 Left 1193875295 X:86855241-86855263 CCTTTGTCAGATGAGTAGATTGC 0: 3280
1: 9819
2: 8590
3: 6643
4: 5505
Right 1193875299 X:86855285-86855307 AGGTTGCCTCTTCACTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193875299 Original CRISPR AGGTTGCCTCTTCACTCTCA TGG Intergenic
No off target data available for this crispr