ID: 1193875404

View in Genome Browser
Species Human (GRCh38)
Location X:86856350-86856372
Sequence CGAACTCTACAAGAGGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193875398_1193875404 16 Left 1193875398 X:86856311-86856333 CCAATCAAAAAAAAGTCCAGGAC 0: 4
1: 193
2: 478
3: 893
4: 1386
Right 1193875404 X:86856350-86856372 CGAACTCTACAAGAGGTACAAGG No data
1193875400_1193875404 0 Left 1193875400 X:86856327-86856349 CCAGGACCAGATGGATTCACAGC 0: 7225
1: 4730
2: 3869
3: 2939
4: 2526
Right 1193875404 X:86856350-86856372 CGAACTCTACAAGAGGTACAAGG No data
1193875401_1193875404 -6 Left 1193875401 X:86856333-86856355 CCAGATGGATTCACAGCCGAACT 0: 27
1: 4753
2: 5095
3: 4222
4: 3758
Right 1193875404 X:86856350-86856372 CGAACTCTACAAGAGGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193875404 Original CRISPR CGAACTCTACAAGAGGTACA AGG Intergenic
No off target data available for this crispr