ID: 1193875761

View in Genome Browser
Species Human (GRCh38)
Location X:86861084-86861106
Sequence GATATTACTGCCACTGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193875761_1193875770 25 Left 1193875761 X:86861084-86861106 CCCCACTCAGTGGCAGTAATATC No data
Right 1193875770 X:86861132-86861154 ATAAGATTTTACACCCATCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193875761 Original CRISPR GATATTACTGCCACTGAGTG GGG (reversed) Intergenic
No off target data available for this crispr