ID: 1193878044

View in Genome Browser
Species Human (GRCh38)
Location X:86886323-86886345
Sequence GGGTTTAAACAAATGTATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193878044_1193878052 4 Left 1193878044 X:86886323-86886345 CCCTTATACATTTGTTTAAACCC No data
Right 1193878052 X:86886350-86886372 AGTGGGAGATGTTAATACTAGGG No data
1193878044_1193878051 3 Left 1193878044 X:86886323-86886345 CCCTTATACATTTGTTTAAACCC No data
Right 1193878051 X:86886349-86886371 GAGTGGGAGATGTTAATACTAGG No data
1193878044_1193878054 29 Left 1193878044 X:86886323-86886345 CCCTTATACATTTGTTTAAACCC No data
Right 1193878054 X:86886375-86886397 ATTATGCATGTGTACAGACAGGG No data
1193878044_1193878053 28 Left 1193878044 X:86886323-86886345 CCCTTATACATTTGTTTAAACCC No data
Right 1193878053 X:86886374-86886396 GATTATGCATGTGTACAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193878044 Original CRISPR GGGTTTAAACAAATGTATAA GGG (reversed) Intergenic
No off target data available for this crispr