ID: 1193878051

View in Genome Browser
Species Human (GRCh38)
Location X:86886349-86886371
Sequence GAGTGGGAGATGTTAATACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193878045_1193878051 2 Left 1193878045 X:86886324-86886346 CCTTATACATTTGTTTAAACCCA No data
Right 1193878051 X:86886349-86886371 GAGTGGGAGATGTTAATACTAGG No data
1193878043_1193878051 22 Left 1193878043 X:86886304-86886326 CCATAGTGTTGGATATATGCCCT No data
Right 1193878051 X:86886349-86886371 GAGTGGGAGATGTTAATACTAGG No data
1193878044_1193878051 3 Left 1193878044 X:86886323-86886345 CCCTTATACATTTGTTTAAACCC No data
Right 1193878051 X:86886349-86886371 GAGTGGGAGATGTTAATACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193878051 Original CRISPR GAGTGGGAGATGTTAATACT AGG Intergenic
No off target data available for this crispr