ID: 1193878054

View in Genome Browser
Species Human (GRCh38)
Location X:86886375-86886397
Sequence ATTATGCATGTGTACAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193878045_1193878054 28 Left 1193878045 X:86886324-86886346 CCTTATACATTTGTTTAAACCCA No data
Right 1193878054 X:86886375-86886397 ATTATGCATGTGTACAGACAGGG No data
1193878050_1193878054 8 Left 1193878050 X:86886344-86886366 CCATGGAGTGGGAGATGTTAATA No data
Right 1193878054 X:86886375-86886397 ATTATGCATGTGTACAGACAGGG No data
1193878049_1193878054 9 Left 1193878049 X:86886343-86886365 CCCATGGAGTGGGAGATGTTAAT No data
Right 1193878054 X:86886375-86886397 ATTATGCATGTGTACAGACAGGG No data
1193878044_1193878054 29 Left 1193878044 X:86886323-86886345 CCCTTATACATTTGTTTAAACCC No data
Right 1193878054 X:86886375-86886397 ATTATGCATGTGTACAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193878054 Original CRISPR ATTATGCATGTGTACAGACA GGG Intergenic
No off target data available for this crispr