ID: 1193882271

View in Genome Browser
Species Human (GRCh38)
Location X:86937377-86937399
Sequence GGTTGTTACTGGCTTGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193882256_1193882271 28 Left 1193882256 X:86937326-86937348 CCCCATAGCCACTAGCATAATAA No data
Right 1193882271 X:86937377-86937399 GGTTGTTACTGGCTTGTGCAGGG No data
1193882257_1193882271 27 Left 1193882257 X:86937327-86937349 CCCATAGCCACTAGCATAATAAA No data
Right 1193882271 X:86937377-86937399 GGTTGTTACTGGCTTGTGCAGGG No data
1193882258_1193882271 26 Left 1193882258 X:86937328-86937350 CCATAGCCACTAGCATAATAAAA No data
Right 1193882271 X:86937377-86937399 GGTTGTTACTGGCTTGTGCAGGG No data
1193882260_1193882271 20 Left 1193882260 X:86937334-86937356 CCACTAGCATAATAAAATGGTTT No data
Right 1193882271 X:86937377-86937399 GGTTGTTACTGGCTTGTGCAGGG No data
1193882263_1193882271 -6 Left 1193882263 X:86937360-86937382 CCATCACCCCCCATCAGGGTTGT No data
Right 1193882271 X:86937377-86937399 GGTTGTTACTGGCTTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193882271 Original CRISPR GGTTGTTACTGGCTTGTGCA GGG Intergenic
No off target data available for this crispr