ID: 1193897007

View in Genome Browser
Species Human (GRCh38)
Location X:87127075-87127097
Sequence TACCATACCTGGGGATGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193897007_1193897017 29 Left 1193897007 X:87127075-87127097 CCAGCACATCCCCAGGTATGGTA No data
Right 1193897017 X:87127127-87127149 AAAAGGAGAGGAAATAGTAAAGG No data
1193897007_1193897016 17 Left 1193897007 X:87127075-87127097 CCAGCACATCCCCAGGTATGGTA No data
Right 1193897016 X:87127115-87127137 CTTCTGCTTGAGAAAAGGAGAGG 0: 27
1: 236
2: 524
3: 705
4: 930
1193897007_1193897014 12 Left 1193897007 X:87127075-87127097 CCAGCACATCCCCAGGTATGGTA No data
Right 1193897014 X:87127110-87127132 GGTTCCTTCTGCTTGAGAAAAGG No data
1193897007_1193897018 30 Left 1193897007 X:87127075-87127097 CCAGCACATCCCCAGGTATGGTA No data
Right 1193897018 X:87127128-87127150 AAAGGAGAGGAAATAGTAAAGGG No data
1193897007_1193897012 -10 Left 1193897007 X:87127075-87127097 CCAGCACATCCCCAGGTATGGTA No data
Right 1193897012 X:87127088-87127110 AGGTATGGTAACAATAGAAAGGG No data
1193897007_1193897013 -9 Left 1193897007 X:87127075-87127097 CCAGCACATCCCCAGGTATGGTA No data
Right 1193897013 X:87127089-87127111 GGTATGGTAACAATAGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193897007 Original CRISPR TACCATACCTGGGGATGTGC TGG (reversed) Intergenic
No off target data available for this crispr