ID: 1193897010

View in Genome Browser
Species Human (GRCh38)
Location X:87127086-87127108
Sequence CTTTCTATTGTTACCATACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193897010_1193897018 19 Left 1193897010 X:87127086-87127108 CCAGGTATGGTAACAATAGAAAG No data
Right 1193897018 X:87127128-87127150 AAAGGAGAGGAAATAGTAAAGGG No data
1193897010_1193897019 20 Left 1193897010 X:87127086-87127108 CCAGGTATGGTAACAATAGAAAG No data
Right 1193897019 X:87127129-87127151 AAGGAGAGGAAATAGTAAAGGGG No data
1193897010_1193897014 1 Left 1193897010 X:87127086-87127108 CCAGGTATGGTAACAATAGAAAG No data
Right 1193897014 X:87127110-87127132 GGTTCCTTCTGCTTGAGAAAAGG No data
1193897010_1193897016 6 Left 1193897010 X:87127086-87127108 CCAGGTATGGTAACAATAGAAAG No data
Right 1193897016 X:87127115-87127137 CTTCTGCTTGAGAAAAGGAGAGG 0: 27
1: 236
2: 524
3: 705
4: 930
1193897010_1193897017 18 Left 1193897010 X:87127086-87127108 CCAGGTATGGTAACAATAGAAAG No data
Right 1193897017 X:87127127-87127149 AAAAGGAGAGGAAATAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193897010 Original CRISPR CTTTCTATTGTTACCATACC TGG (reversed) Intergenic
No off target data available for this crispr