ID: 1193897015

View in Genome Browser
Species Human (GRCh38)
Location X:87127114-87127136
Sequence CTCTCCTTTTCTCAAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2306
Summary {0: 27, 1: 240, 2: 502, 3: 638, 4: 899}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193897015_1193897017 -10 Left 1193897015 X:87127114-87127136 CCTTCTGCTTGAGAAAAGGAGAG 0: 27
1: 240
2: 502
3: 638
4: 899
Right 1193897017 X:87127127-87127149 AAAAGGAGAGGAAATAGTAAAGG No data
1193897015_1193897018 -9 Left 1193897015 X:87127114-87127136 CCTTCTGCTTGAGAAAAGGAGAG 0: 27
1: 240
2: 502
3: 638
4: 899
Right 1193897018 X:87127128-87127150 AAAGGAGAGGAAATAGTAAAGGG No data
1193897015_1193897019 -8 Left 1193897015 X:87127114-87127136 CCTTCTGCTTGAGAAAAGGAGAG 0: 27
1: 240
2: 502
3: 638
4: 899
Right 1193897019 X:87127129-87127151 AAGGAGAGGAAATAGTAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193897015 Original CRISPR CTCTCCTTTTCTCAAGCAGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr