ID: 1193897016

View in Genome Browser
Species Human (GRCh38)
Location X:87127115-87127137
Sequence CTTCTGCTTGAGAAAAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2422
Summary {0: 27, 1: 236, 2: 524, 3: 705, 4: 930}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193897008_1193897016 8 Left 1193897008 X:87127084-87127106 CCCCAGGTATGGTAACAATAGAA No data
Right 1193897016 X:87127115-87127137 CTTCTGCTTGAGAAAAGGAGAGG 0: 27
1: 236
2: 524
3: 705
4: 930
1193897009_1193897016 7 Left 1193897009 X:87127085-87127107 CCCAGGTATGGTAACAATAGAAA No data
Right 1193897016 X:87127115-87127137 CTTCTGCTTGAGAAAAGGAGAGG 0: 27
1: 236
2: 524
3: 705
4: 930
1193897010_1193897016 6 Left 1193897010 X:87127086-87127108 CCAGGTATGGTAACAATAGAAAG No data
Right 1193897016 X:87127115-87127137 CTTCTGCTTGAGAAAAGGAGAGG 0: 27
1: 236
2: 524
3: 705
4: 930
1193897007_1193897016 17 Left 1193897007 X:87127075-87127097 CCAGCACATCCCCAGGTATGGTA No data
Right 1193897016 X:87127115-87127137 CTTCTGCTTGAGAAAAGGAGAGG 0: 27
1: 236
2: 524
3: 705
4: 930

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193897016 Original CRISPR CTTCTGCTTGAGAAAAGGAG AGG Intergenic
Too many off-targets to display for this crispr