ID: 1193897017

View in Genome Browser
Species Human (GRCh38)
Location X:87127127-87127149
Sequence AAAAGGAGAGGAAATAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193897007_1193897017 29 Left 1193897007 X:87127075-87127097 CCAGCACATCCCCAGGTATGGTA No data
Right 1193897017 X:87127127-87127149 AAAAGGAGAGGAAATAGTAAAGG No data
1193897009_1193897017 19 Left 1193897009 X:87127085-87127107 CCCAGGTATGGTAACAATAGAAA No data
Right 1193897017 X:87127127-87127149 AAAAGGAGAGGAAATAGTAAAGG No data
1193897010_1193897017 18 Left 1193897010 X:87127086-87127108 CCAGGTATGGTAACAATAGAAAG No data
Right 1193897017 X:87127127-87127149 AAAAGGAGAGGAAATAGTAAAGG No data
1193897008_1193897017 20 Left 1193897008 X:87127084-87127106 CCCCAGGTATGGTAACAATAGAA No data
Right 1193897017 X:87127127-87127149 AAAAGGAGAGGAAATAGTAAAGG No data
1193897015_1193897017 -10 Left 1193897015 X:87127114-87127136 CCTTCTGCTTGAGAAAAGGAGAG 0: 27
1: 240
2: 502
3: 638
4: 899
Right 1193897017 X:87127127-87127149 AAAAGGAGAGGAAATAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193897017 Original CRISPR AAAAGGAGAGGAAATAGTAA AGG Intergenic
No off target data available for this crispr