ID: 1193898830

View in Genome Browser
Species Human (GRCh38)
Location X:87149916-87149938
Sequence CCCAGCTTCCACCTTCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193898822_1193898830 30 Left 1193898822 X:87149863-87149885 CCCAAGTAATAAGCACAGTACTT No data
Right 1193898830 X:87149916-87149938 CCCAGCTTCCACCTTCATGTAGG No data
1193898824_1193898830 -7 Left 1193898824 X:87149900-87149922 CCATCCTCACCCTCCTCCCAGCT No data
Right 1193898830 X:87149916-87149938 CCCAGCTTCCACCTTCATGTAGG No data
1193898823_1193898830 29 Left 1193898823 X:87149864-87149886 CCAAGTAATAAGCACAGTACTTT No data
Right 1193898830 X:87149916-87149938 CCCAGCTTCCACCTTCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193898830 Original CRISPR CCCAGCTTCCACCTTCATGT AGG Intergenic
No off target data available for this crispr