ID: 1193902551

View in Genome Browser
Species Human (GRCh38)
Location X:87200139-87200161
Sequence CCTCATCCCCCAGAAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1193902551_1193902555 10 Left 1193902551 X:87200139-87200161 CCACCTCCTTCTGGGGGATGAGG No data
Right 1193902555 X:87200172-87200194 GTCACATCAATAAGTTTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1193902551 Original CRISPR CCTCATCCCCCAGAAGGAGG TGG (reversed) Intergenic
No off target data available for this crispr